ID: 1062623189

View in Genome Browser
Species Human (GRCh38)
Location 9:137431691-137431713
Sequence GGAGGCAGGACAGCTCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623172_1062623189 27 Left 1062623172 9:137431641-137431663 CCTCCCACTGGGGTGCGAGTGAC No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623174_1062623189 23 Left 1062623174 9:137431645-137431667 CCACTGGGGTGCGAGTGACCAGG No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623179_1062623189 5 Left 1062623179 9:137431663-137431685 CCAGGAGTGACCCAGCTGGGGAC No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623173_1062623189 24 Left 1062623173 9:137431644-137431666 CCCACTGGGGTGCGAGTGACCAG No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623183_1062623189 -5 Left 1062623183 9:137431673-137431695 CCCAGCTGGGGACAGGCGGGAGG No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623170_1062623189 29 Left 1062623170 9:137431639-137431661 CCCCTCCCACTGGGGTGCGAGTG No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623185_1062623189 -6 Left 1062623185 9:137431674-137431696 CCAGCTGGGGACAGGCGGGAGGC No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data
1062623171_1062623189 28 Left 1062623171 9:137431640-137431662 CCCTCCCACTGGGGTGCGAGTGA No data
Right 1062623189 9:137431691-137431713 GGAGGCAGGACAGCTCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623189 Original CRISPR GGAGGCAGGACAGCTCTGGA GGG Intronic