ID: 1062623512

View in Genome Browser
Species Human (GRCh38)
Location 9:137433136-137433158
Sequence CCCTGTGGGTGGAGGGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 552}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623512_1062623521 -4 Left 1062623512 9:137433136-137433158 CCGGCTGCCCTCCACCCACAGGG 0: 1
1: 0
2: 6
3: 69
4: 552
Right 1062623521 9:137433155-137433177 AGGGCCCACTTTGGTGGTAGTGG 0: 1
1: 0
2: 0
3: 24
4: 136
1062623512_1062623524 24 Left 1062623512 9:137433136-137433158 CCGGCTGCCCTCCACCCACAGGG 0: 1
1: 0
2: 6
3: 69
4: 552
Right 1062623524 9:137433183-137433205 TCAGTCTTGCTCTGTCCTACAGG 0: 1
1: 0
2: 19
3: 518
4: 8128
1062623512_1062623525 25 Left 1062623512 9:137433136-137433158 CCGGCTGCCCTCCACCCACAGGG 0: 1
1: 0
2: 6
3: 69
4: 552
Right 1062623525 9:137433184-137433206 CAGTCTTGCTCTGTCCTACAGGG 0: 1
1: 0
2: 7
3: 102
4: 894
1062623512_1062623518 -10 Left 1062623512 9:137433136-137433158 CCGGCTGCCCTCCACCCACAGGG 0: 1
1: 0
2: 6
3: 69
4: 552
Right 1062623518 9:137433149-137433171 ACCCACAGGGCCCACTTTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623512 Original CRISPR CCCTGTGGGTGGAGGGCAGC CGG (reversed) Intronic
900123652 1:1059924-1059946 GCCTGCGGGTGGAGGGGGGCAGG - Intergenic
900386507 1:2413227-2413249 CCTGGCGGGTGGGGGGCAGCCGG + Intronic
900399015 1:2465364-2465386 GCCGGAGGGTGGAGGGCAGAGGG - Intronic
900416131 1:2535566-2535588 GCCAGAGGGTGGAGGGCTGCAGG - Intergenic
900422608 1:2562090-2562112 CCCTGTGGGATGTGGGGAGCAGG + Intronic
900592935 1:3467895-3467917 CCGTGGGCGTGGCGGGCAGCGGG + Intronic
900596472 1:3482355-3482377 CCCGGAGGCTGCAGGGCAGCTGG - Intergenic
900670532 1:3851067-3851089 GCCTGTGGCTGGAGGGCAGGAGG - Intronic
900740581 1:4328529-4328551 CCGGGTGTGTGGAGGGCACCTGG + Intergenic
900757764 1:4449022-4449044 ACTTGTAGGTGGAGGGCAGGAGG - Intergenic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
901024929 1:6274118-6274140 TCCTGGGGGTGGGGAGCAGCAGG + Intronic
901061257 1:6473010-6473032 GCCTGAGGCTGGAGGACAGCTGG - Exonic
901423889 1:9168969-9168991 CCCTGTGGATGGAAGGAAGTAGG - Intergenic
902396580 1:16135188-16135210 CCCTGTGGGTGGGTGGCCGGCGG + Exonic
902646789 1:17805117-17805139 CCGTGTGGCTGGAAGGGAGCTGG - Intronic
902647172 1:17807836-17807858 GCCTGTGGGGGGTGGGGAGCTGG + Intronic
903043896 1:20552216-20552238 TGCTGTGGGTGAGGGGCAGCAGG + Intergenic
903625215 1:24725433-24725455 CCCTGCAGGAGGAGGGCAGCCGG + Intergenic
903886167 1:26542331-26542353 CTCTGCGGGTGGATGGCTGCCGG - Intronic
904297148 1:29527301-29527323 CCCTGGAGGAGAAGGGCAGCAGG + Intergenic
904396948 1:30228372-30228394 CCCTAGGGGTGGAGTGGAGCAGG - Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904462740 1:30689927-30689949 CCCTAGGGGTGGGGGGCAGCGGG - Intergenic
904938613 1:34149410-34149432 GCCTGTTGGTGGGGGGCAGCTGG - Intronic
905546896 1:38807354-38807376 CCTTGTAGGTGGAAGACAGCAGG - Intergenic
905861613 1:41355629-41355651 CCTGGTGGGAGGAGGGAAGCTGG + Intergenic
906259992 1:44379626-44379648 CCATTTGGCTGGAAGGCAGCTGG + Intergenic
906511747 1:46413972-46413994 TCCTGTGGGTGATGGGCACCAGG - Intergenic
907455922 1:54575406-54575428 CCTTGGGGGTGGAGGGAGGCAGG + Intronic
908360932 1:63367791-63367813 CCCTGGGAGTGGAGCGGAGCTGG - Intronic
908460460 1:64343999-64344021 GCCTTTGGCTGGAGGGCAGATGG - Intergenic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
912597502 1:110893928-110893950 ACCTCTGGGTGGAGGACTGCTGG - Intronic
912805920 1:112757081-112757103 CCCAGGGGGAGGAGGCCAGCTGG - Intergenic
913095294 1:115510745-115510767 TCCTGTGGGTGGACAGCAGTTGG + Intergenic
914490878 1:148149460-148149482 CGCTGTGGGTGGAGGGCGCCGGG + Intronic
914627608 1:149478057-149478079 CCCCGTGGGGGGAGGGCAGGCGG + Intergenic
915065293 1:153219835-153219857 CTCCATGGGTGGGGGGCAGCAGG - Intergenic
915943987 1:160136549-160136571 CCCTGTGGGTAGAGGGCCAAAGG - Exonic
916883254 1:169043249-169043271 ACTTGTGGGTGGAGGGTAGGAGG + Intergenic
917788852 1:178486901-178486923 CCTTGGGGCTGGAGGGCCGCTGG + Intergenic
917923606 1:179771040-179771062 CCCTGTCAGCAGAGGGCAGCAGG - Intronic
918789870 1:188812825-188812847 GCCTGTCAGGGGAGGGCAGCTGG + Intergenic
920215255 1:204358336-204358358 CCCTGCTGGTGGAGGGGAGGTGG - Intronic
920232627 1:204480679-204480701 CTGTGTGGGTGGTGGGCTGCCGG + Intronic
920365584 1:205446700-205446722 CACTGTGGGCCCAGGGCAGCTGG + Intronic
920377998 1:205519578-205519600 TCCTGCGGGTGGAGAACAGCTGG + Intronic
920664786 1:207955088-207955110 CCAAGTGGGTGGTGGGCAGTTGG - Intergenic
920880534 1:209876276-209876298 CTCTGTGGTTTTAGGGCAGCTGG + Intergenic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
922175079 1:223190394-223190416 CCAGGTGGGTGGCGGGCAGAAGG - Intergenic
922738184 1:228000965-228000987 CCCTGTGGGACGAGGGCAAGGGG - Intergenic
922792438 1:228317702-228317724 CCCTGTGGGTGCTGGGGAACCGG + Exonic
923049628 1:230381702-230381724 CCCTGGGCGTGGAGGGTGGCTGG - Intronic
923746092 1:236701471-236701493 CCCTGTGACTGGAGGGCTGTGGG + Intronic
924388845 1:243528469-243528491 ACTTGAGGGTGGAGGGCAGGAGG - Intronic
924708420 1:246516401-246516423 ACCCATGGGTGGGGGGCAGCAGG - Intergenic
1062904249 10:1169368-1169390 CCCTGTGGGCTGTGGGCTGCAGG + Intergenic
1063023066 10:2148559-2148581 ACCTGTGGGTGGTGGGAATCTGG - Intergenic
1063461265 10:6216284-6216306 CCCTGAGGGTGGAGGAAAGCAGG + Intronic
1063721275 10:8584089-8584111 GGCTGTGGGTGTAGGGGAGCAGG + Intergenic
1064597513 10:16960881-16960903 CCCTGTTGGTGAAGGGCCCCTGG - Intronic
1064691603 10:17924147-17924169 CCATGTGGGTAGAGAGGAGCAGG + Intergenic
1067030563 10:42876746-42876768 CCCTGAAGGTTGAGGACAGCTGG - Intergenic
1067265833 10:44744372-44744394 ACCTGAGGGTGGAGGGCGGAAGG - Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1068619471 10:59164325-59164347 CCTTGTGGGTGGATGGAGGCAGG - Intergenic
1069461524 10:68599544-68599566 CCCAGTGGGTGGTAGGCAGTGGG - Intronic
1069594806 10:69663742-69663764 GGCAGAGGGTGGAGGGCAGCTGG - Intergenic
1070293049 10:75134174-75134196 GCCTGTCAGTGGGGGGCAGCCGG + Intronic
1070764190 10:79047191-79047213 TCCAGTGGGTGGAGGTCAGTGGG + Intergenic
1070827326 10:79398910-79398932 TCCAGTGCGTGAAGGGCAGCAGG + Intronic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1071492962 10:86148817-86148839 CCCTGGGGGAGCAGGGCAGTGGG - Intronic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1071573226 10:86709328-86709350 CCCAGTTGGAGGAGGGCAACAGG + Intronic
1073272838 10:102280796-102280818 CCATGTGGCAGGAGTGCAGCTGG + Intronic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1074121324 10:110496342-110496364 CCCTCTGGGCTGGGGGCAGCTGG + Intergenic
1075089638 10:119436518-119436540 CCATCTGGGTGCAGGGGAGCAGG + Intronic
1075278054 10:121113034-121113056 AGCTGAGGCTGGAGGGCAGCAGG + Intergenic
1075401096 10:122162423-122162445 CCCTGTGGGTGAAGACAAGCTGG + Intronic
1075599136 10:123754412-123754434 CACTGTGCCTGGAGGCCAGCTGG + Intronic
1075662459 10:124207519-124207541 TCCTGGGGGAGGAGGGGAGCCGG + Intergenic
1075738963 10:124681843-124681865 CCCCGTGGGAGGAGGCCGGCTGG - Exonic
1076080812 10:127578957-127578979 CCCAGTGGGTGGGAGGCAGTAGG - Intergenic
1076454348 10:130579052-130579074 CCCTATGGCTGGAGGGAAGCAGG - Intergenic
1076713930 10:132353853-132353875 CACAGTGAGGGGAGGGCAGCTGG - Intronic
1076798954 10:132811888-132811910 CCCTGTTGATGGAGCGGAGCAGG - Intronic
1076817111 10:132920479-132920501 GCCTCTGCTTGGAGGGCAGCTGG - Intronic
1076824753 10:132961202-132961224 CCCTGTGGGCGGACGGCGGAGGG + Intergenic
1076851603 10:133095999-133096021 CCCTGTGGGTGGGTGCCAGCAGG - Intronic
1076853206 10:133103089-133103111 CCCTGAGGGTGGAGGGTCCCGGG + Intronic
1076898942 10:133327724-133327746 CCTGGTGGGTGCAGGGCAGCCGG + Intronic
1077047902 11:554402-554424 CCCTCTTGGTGGAGGGGAGTGGG + Exonic
1077213249 11:1383121-1383143 GCCCGTGGGGGGAGGGCAGGTGG - Intergenic
1077340896 11:2025879-2025901 CGCTGTGGGCGGCGGGCACCCGG - Intergenic
1077473591 11:2776201-2776223 CCCTGCAGAGGGAGGGCAGCTGG + Intronic
1078152688 11:8772788-8772810 GCCTGGGGGTGGCAGGCAGCTGG + Intronic
1080913600 11:36631144-36631166 TTCTGTGGGTGGAGGGCTGGGGG - Intronic
1081549183 11:44096210-44096232 CCCTGTGGCTGGCGGGAAGGTGG - Exonic
1081977517 11:47245082-47245104 AGCTCTGGGTGGAGAGCAGCAGG + Intronic
1081996655 11:47369448-47369470 CACTCTGGGTGGAGAGCAGATGG - Intronic
1083140482 11:60717400-60717422 CCCTGTGGGTGGAGGGCTTGTGG - Intergenic
1083629677 11:64089144-64089166 CCCTGTGCCTGGAAGGCTGCTGG - Intronic
1083719547 11:64597639-64597661 CCCGGTGGGTGTAGGGCAGGTGG + Intronic
1083793303 11:64999796-64999818 CCCAGTGGGTGGAGGGTTGGAGG + Intergenic
1083936748 11:65873361-65873383 TCCTGGGGGTGGAGGGCAGGAGG - Intronic
1084411093 11:69006294-69006316 GTCTGTGGGTGGGGGCCAGCCGG - Intronic
1084594405 11:70108471-70108493 CTCTGTGGGAGGCAGGCAGCCGG + Intronic
1084689197 11:70715311-70715333 CCCAGTGGCGGGAGGGCAGCAGG - Intronic
1084860816 11:72016848-72016870 CCCAGAGGATGGTGGGCAGCTGG - Intronic
1085052985 11:73389229-73389251 CCCTCTTGCTGGAGGGCTGCAGG - Intronic
1085201669 11:74705776-74705798 GCCTGGGTGGGGAGGGCAGCAGG + Intronic
1085438324 11:76531922-76531944 CCTTGGGGGTGGAGGACAGTAGG - Intronic
1085710962 11:78828983-78829005 CCCACTGGGTGGAGAGCAGATGG - Intronic
1085789239 11:79482503-79482525 ACCTGGGGGTGGAGGACAGAAGG + Intergenic
1086009522 11:82083307-82083329 CTTTGTTGGTGTAGGGCAGCTGG + Intergenic
1086155788 11:83664360-83664382 GCCTTTGGGTGGAGGGGAGTGGG + Intronic
1087276747 11:96168585-96168607 CCCTGTGGATGGAGGGTTGTTGG + Intronic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1089147324 11:116338853-116338875 GCCTGTGGGTTGAGGGAAGGGGG + Intergenic
1089153941 11:116386152-116386174 ACCTGTGGGTGCAGGGAAGCCGG + Intergenic
1089261910 11:117229503-117229525 CCCTGGAGGTGGAGGCCATCCGG - Exonic
1089366699 11:117924957-117924979 CCCTGGGGGTGGGGGGCACGGGG + Intronic
1089422331 11:118341137-118341159 GGCTGTGGGTGGAGACCAGCTGG + Intronic
1090255993 11:125284813-125284835 AGCTGGGGGTGGAGGACAGCAGG - Intronic
1091225652 11:133955547-133955569 CGCTGTGGGTGGGAGTCAGCAGG - Intronic
1202823881 11_KI270721v1_random:81068-81090 CGCTGTGGGCGGCGGGCACCCGG - Intergenic
1092917073 12:13198960-13198982 CCCTGAGGGTGGGAGGCAGCGGG - Intronic
1092984451 12:13831994-13832016 CCCTGGTGGTGAAGGGCAGTGGG + Intronic
1093711809 12:22336012-22336034 GCCTGCCGGTGGAGGGCAGTAGG - Intronic
1094221671 12:28000726-28000748 ACTCGTGGGTGGAGGGCAGTGGG + Intergenic
1096627921 12:52906588-52906610 TGCTGTGGGTGGAAGGCAGGAGG + Intronic
1098092276 12:66916282-66916304 CCCTGAGGCTGGAGTACAGCAGG + Intergenic
1101874421 12:108589290-108589312 CCCTGGGGCTGGGGGGCAGTGGG - Intergenic
1102567064 12:113803652-113803674 GGCTGGGGTTGGAGGGCAGCTGG + Intergenic
1102580250 12:113881919-113881941 CCCCATGGGTGGAGGGCATGTGG - Intronic
1102703141 12:114857567-114857589 GCCTGAGGATGGAGGGCAGGAGG - Intergenic
1103446999 12:121001123-121001145 CGCTGTGGTTGGATGGCAGCAGG - Exonic
1103565149 12:121811707-121811729 CCCTGTGGGCGGAGGGGAGGAGG + Intronic
1103953529 12:124564905-124564927 GCCTGGGGGTGGGGGGCAGGGGG - Intronic
1104092163 12:125526280-125526302 CCCTGTGCGAGGAGCCCAGCAGG - Intronic
1104298035 12:127536388-127536410 ACCTGAGGGTGGAGGGCAGGAGG + Intergenic
1104440689 12:128791122-128791144 CCCTGGGGGTGGGGGGCACGAGG + Intergenic
1104543789 12:129692839-129692861 GCCTGTCGGGGGAGGGCAGTGGG + Intronic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1104686320 12:130787401-130787423 CCCTGTGTGGCGTGGGCAGCTGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104910474 12:132237925-132237947 CCCTGAAGCTGGAGGGCAGCAGG - Intronic
1104969814 12:132526192-132526214 GCCTGTGGGTGGAGGGCAGGCGG + Intronic
1105058137 12:133122588-133122610 GCCTGTCGGGTGAGGGCAGCAGG + Intronic
1105431356 13:20340321-20340343 CCCAGGGGCTGGAGGGCAGGTGG - Intergenic
1106055047 13:26229522-26229544 GCATGAGGGAGGAGGGCAGCAGG + Intergenic
1107703935 13:43080222-43080244 ACCTGAGGGTGGAGGGTAGGAGG - Intronic
1109442628 13:62394909-62394931 CACTGTGGGTGGTGGGAAGGAGG + Intergenic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110558345 13:76885534-76885556 CCCAGTCGCTGGACGGCAGCCGG - Exonic
1112217391 13:97447338-97447360 CCCTGTGGGTAGAGTGAAGGGGG - Intronic
1113484381 13:110643548-110643570 CCCTCGGGGTGCTGGGCAGCTGG + Intronic
1113651185 13:112035322-112035344 CCCTCTGGGTGGGGGACAGGAGG - Intergenic
1113651206 13:112035390-112035412 CCCTCTGGGTGGGGGACAGGAGG - Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1113906561 13:113822058-113822080 CCCTGGAGGTGGACGGCACCAGG - Exonic
1114438287 14:22726252-22726274 CCATGGGGGTTGAGGGGAGCAGG + Intergenic
1115474263 14:33799102-33799124 CCCTCAGGCTGGAGTGCAGCAGG - Intronic
1116843166 14:49840118-49840140 CCCTGAGGCTGGAGTGCAGTTGG - Intronic
1119740006 14:77008103-77008125 AGGTGTGGGTGAAGGGCAGCAGG + Intergenic
1119768372 14:77205114-77205136 CCCTGTGGCAGGAGGGAAGGTGG + Intronic
1119966539 14:78922692-78922714 GCCTGTAGGTGGAGGGGAGCAGG + Intronic
1121279159 14:92687269-92687291 CCCTAGGGGTGGAGGACGGCGGG + Intronic
1121407170 14:93726109-93726131 CCCTGGGCTTGGAGGGCAGCAGG + Intronic
1121552595 14:94813660-94813682 CCTTGTGGGTAGAGGCCAGGGGG + Intergenic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122902107 14:104786252-104786274 CCCACTGGGTGGAGGGCACTTGG - Intronic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1122987165 14:105217840-105217862 CCCTGATGGTGGAGTGCAGTGGG - Intronic
1123739818 15:23225954-23225976 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1124155957 15:27225588-27225610 CCCTCTGGGTGGAAGGCAGGTGG - Intronic
1124291043 15:28454927-28454949 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1124537470 15:30558526-30558548 CACTGTGGGTGGCTGGCAACGGG - Intronic
1124590127 15:31046671-31046693 CCATGTGGGTGAGGGCCAGCTGG + Intronic
1124614126 15:31229350-31229372 CCCTGTGGGTAGAGACCAACAGG + Intergenic
1124761186 15:32449061-32449083 CACTGTGGGTGGCTGGCAACGGG + Intronic
1124777448 15:32600002-32600024 CACTGTGGGTGGCTGGCAACGGG - Intronic
1125887966 15:43242988-43243010 CCATCTGGGTGAAGGGCAGGGGG - Intronic
1126137020 15:45402526-45402548 CCCAGGGCGTGGAGGGCGGCCGG - Exonic
1127922377 15:63504084-63504106 CCCCGGGGGAGGCGGGCAGCGGG - Intergenic
1127923756 15:63517658-63517680 CCCTCTGGGAGGTGGGCACCTGG + Intronic
1127927017 15:63556571-63556593 CCCTAGGTGTTGAGGGCAGCTGG + Intronic
1128014836 15:64334392-64334414 GACTGGGGGTGGAGGGCAGGGGG + Intronic
1128639279 15:69324209-69324231 CCCTGTGTGAGGATGGCAGGGGG - Intronic
1129296819 15:74604335-74604357 CCCTGTGGGCAGAGGGGAGGTGG + Intronic
1129521302 15:76187956-76187978 TCCTGGGGGTGGAGGGTGGCAGG + Intronic
1129726522 15:77904319-77904341 TCCTCTTGCTGGAGGGCAGCTGG + Intergenic
1129822615 15:78615248-78615270 CCCAGTGGGAGGAGGCCTGCAGG + Intronic
1131056263 15:89377246-89377268 CCCTGGGGGAAGAAGGCAGCTGG - Intergenic
1131314810 15:91326007-91326029 ACCTGAGGGTGGAGGGTGGCAGG - Intergenic
1132295338 15:100730301-100730323 GCCTGTGGCTGCAGGCCAGCAGG - Intergenic
1132463495 16:67054-67076 CCCTGTGGAGGGAGGGCTGGGGG - Intronic
1132571866 16:647762-647784 GGCTGTGGGAGGAGGGCAGTCGG - Exonic
1132629228 16:908812-908834 ACCTGTGGATGGCGGGCACCGGG - Intronic
1132663192 16:1070610-1070632 CCCTGGGGGTGGCGGCCAGGAGG - Intergenic
1132903319 16:2269917-2269939 TCCTGTGGGTGGAGGCTGGCAGG + Intergenic
1134657564 16:15958727-15958749 CCCTGTGGGTGGAGTGGTGCTGG + Intronic
1135094721 16:19555623-19555645 CCATGTTTGTGAAGGGCAGCTGG - Exonic
1135098129 16:19581504-19581526 CCCTGTGGGGAGAAGGCAGAAGG - Exonic
1135289594 16:21223891-21223913 CCCTGTGGGCGTGGGGCAGGAGG + Intergenic
1135469309 16:22715202-22715224 ACTTGTGGGTGGAGGGTAGGAGG + Intergenic
1136616555 16:31401940-31401962 CCATGTGGGAGGAAGGGAGCAGG + Intronic
1136707719 16:32202716-32202738 CGCTGTGGGTGGAGGGCGCCGGG + Intergenic
1136760190 16:32726694-32726716 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1136807914 16:33143692-33143714 CGCTGTGGGTGGAGGGCGCCGGG + Intergenic
1137365947 16:47859548-47859570 CCTTGTGGGTGGAAGTCAGTAGG - Intergenic
1137718155 16:50611472-50611494 GCCAGTGGGGAGAGGGCAGCAGG - Intronic
1138207099 16:55133150-55133172 CCATTTAGGTGGAGGGCAGAGGG + Intergenic
1138515287 16:57532815-57532837 GCCTGTGGGGGGAGGGGAGGAGG + Intronic
1138639334 16:58370798-58370820 CCCTTTCGGTGGAGGACATCAGG - Intronic
1139260609 16:65589880-65589902 CCCTGGGGGTGGAAGGGAGGGGG + Intergenic
1140222797 16:73056479-73056501 TCCTGTGGGTTGAGGGGAGTGGG - Intronic
1140487434 16:75304816-75304838 CACTGCGGGTGGAGGGAAGGCGG - Intronic
1140545345 16:75802657-75802679 ACCTGAGGGTGGAGGGCGGGGGG - Intergenic
1141466326 16:84208147-84208169 CCCTAAGGGAGGAGGGCTGCAGG - Intergenic
1141832634 16:86518222-86518244 CCCTGTGGATGGAGGCAAACGGG - Intergenic
1141923690 16:87153318-87153340 CCTTGAGGGTGGAAGGCAGAGGG + Intronic
1141946709 16:87315704-87315726 CCCTGTGGGGTGAGGAGAGCAGG - Intronic
1142178668 16:88656732-88656754 CCCTGTGGGAGGAGGGGAGAAGG - Intronic
1142178850 16:88657517-88657539 AGCTGAGGCTGGAGGGCAGCGGG + Exonic
1142406361 16:89892372-89892394 TGCTGGGGGTGGAGGGCGGCGGG + Intronic
1203062345 16_KI270728v1_random:987016-987038 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1142480342 17:215027-215049 CCCGGGGTGTGGAGGGCACCCGG - Intronic
1142746812 17:1963497-1963519 CCCTGAAGGTGGCGGGCAGTAGG - Intronic
1143461826 17:7108887-7108909 CCCTGTGGGAGAGGGGCATCAGG + Exonic
1143778279 17:9213394-9213416 CCCTGAGAGAGCAGGGCAGCAGG + Intronic
1144778221 17:17795452-17795474 ACCGGTGGCTGGAGGACAGCCGG + Exonic
1144827725 17:18115772-18115794 CCAGGTGGCTGGAGGGCAGTGGG - Intronic
1145191499 17:20844155-20844177 CGCTGTGGGTGGAGGGCGCCGGG + Intronic
1145969767 17:28950068-28950090 CACTGGAGGTGGAAGGCAGCCGG + Exonic
1146000359 17:29126921-29126943 CCCTGTGCTTGGATGGCAGATGG - Intronic
1146063131 17:29617419-29617441 CCCTGCGGGTGGGGGGCGCCTGG + Intronic
1146086879 17:29838244-29838266 CCCAGTGTGTGGAGGGGACCAGG - Intronic
1146259720 17:31413483-31413505 CTCAGTGGCTGGAGGGCAGGGGG - Intronic
1146682053 17:34815444-34815466 GCCCCTGGGTGGATGGCAGCAGG - Intergenic
1147427001 17:40350682-40350704 CCCTTTGTGGGGAGGGCAGTGGG + Intronic
1147447612 17:40484313-40484335 CCTTGGGGCTGGAGGGCATCGGG + Intronic
1148463540 17:47851351-47851373 CCCTGGGAGTGGAGGGGACCAGG - Intronic
1148491021 17:48024095-48024117 CGCTGGGGGTGGAGGGCCGCCGG - Intergenic
1148739834 17:49886515-49886537 TCCCGTGGGTGGAGGGGGGCAGG - Intergenic
1148865133 17:50624339-50624361 GCCTGTGGAGGGAGGGAAGCGGG - Exonic
1148865347 17:50625507-50625529 ACCTATGTGTGGAGGGCAGCAGG + Intronic
1149684512 17:58527687-58527709 GACTGTGGGTGGGAGGCAGCTGG + Intronic
1149821754 17:59786688-59786710 CCCTGTGGTTACAGGGAAGCTGG - Intronic
1150649438 17:67000372-67000394 GCCTGTGGAAGGAGGGAAGCTGG + Intronic
1150790186 17:68196711-68196733 CCATTGGGCTGGAGGGCAGCAGG + Intergenic
1151296805 17:73192332-73192354 CCATGGGGGAGGAGGGCGGCGGG - Intergenic
1151407812 17:73900856-73900878 GCCTGTGGGTGGAGGCTGGCAGG - Intergenic
1151631771 17:75315857-75315879 CCCTGTGGCCGGCGTGCAGCCGG - Intergenic
1151871834 17:76841783-76841805 CCCAGTGGGTCCAGGGCACCTGG + Intergenic
1151966004 17:77432036-77432058 AGCTGGGGGTGGGGGGCAGCAGG + Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG + Intronic
1152339429 17:79716095-79716117 CCCTGGGGGTACAGGGCAGAGGG + Intergenic
1152376290 17:79920445-79920467 GCCTGTGGGTGGTGGGTGGCAGG + Intergenic
1152544412 17:80993472-80993494 CTCCGTGGGTGGAGGGAACCGGG + Intronic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1152912615 17:83013702-83013724 CCCCGCGGGGGGAGGGCAGAGGG + Intronic
1154015461 18:10612443-10612465 CCCTGTCTGTGGATGTCAGCGGG - Intergenic
1154085977 18:11305809-11305831 CTCTGTGGGTGGGCGTCAGCTGG + Intergenic
1154190050 18:12223188-12223210 CCCTGTCTGTGGATGTCAGCGGG + Intergenic
1154262050 18:12843611-12843633 CTCCGCTGGTGGAGGGCAGCAGG + Intronic
1156927310 18:42597219-42597241 CCCTGAGGTTGTAGTGCAGCAGG - Intergenic
1158130662 18:54149181-54149203 CACTGGGGGTGGAGGGCTGGGGG - Intergenic
1158648714 18:59268748-59268770 CCCTGCAGCTGGAGGGCAACAGG - Exonic
1159564795 18:70036539-70036561 ACCAGTGGGTGAAGGGTAGCAGG + Intronic
1159774302 18:72585712-72585734 CCCTGGAGGTTGATGGCAGCAGG - Intronic
1160620017 18:80164122-80164144 CTCTGTGTGTGGGGTGCAGCAGG - Intronic
1160766939 19:812904-812926 CCCTGGGAGTGGAAGGCGGCGGG - Exonic
1160991392 19:1861748-1861770 GCCTGAGGGTGGAGAGCAGGAGG - Intronic
1160994708 19:1877284-1877306 CGCTGTGGGTGGAGGGCGCCGGG - Exonic
1161062016 19:2219959-2219981 CCGCGTGGGAAGAGGGCAGCGGG - Intronic
1161062048 19:2220071-2220093 CCCTGTGTGTCAGGGGCAGCAGG - Intronic
1161098744 19:2409722-2409744 CCCTGGGGTGGGAGGACAGCAGG + Intronic
1161121443 19:2529042-2529064 CCCTGAGGCTGGGGTGCAGCAGG + Intronic
1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234487 19:3191063-3191085 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234493 19:3191094-3191116 CGCGGTGCGTGGCGGGCAGCAGG + Intronic
1161637298 19:5396881-5396903 GCCAGTGGGTAGAGGGAAGCAGG + Intergenic
1162109525 19:8392482-8392504 GCCAGTGTGGGGAGGGCAGCAGG - Intronic
1162386196 19:10361887-10361909 GCCTGCGAGTGGAGGGCAGCGGG - Exonic
1162907611 19:13833086-13833108 CTCCGTGGGTGGGGGGCAGGGGG + Intergenic
1163283598 19:16332284-16332306 ACCTGTGTGTGGAGGGAAACAGG - Intergenic
1163765745 19:19162449-19162471 CCTGGTGGGTGGAGAGCACCCGG - Intronic
1164707578 19:30331856-30331878 CCCACTGGGTGAAGGGCAGCGGG - Intronic
1164796746 19:31039793-31039815 TCCTGGGGGTGGAGTGCATCTGG + Intergenic
1164825531 19:31282455-31282477 CTCTGTGGGTGAAGGCCACCAGG + Intronic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1165884102 19:39064951-39064973 CCCTGGGGGTGGGGGGCGGGCGG + Intergenic
1166007060 19:39915227-39915249 CCGTGCGGGTGGAGGCCCGCGGG - Exonic
1166924824 19:46260387-46260409 CATTGTGGGTGCAGGGGAGCGGG - Intergenic
1167293999 19:48638957-48638979 CCCTGTGGGCCAAGGGCTGCAGG + Exonic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
1168717896 19:58539802-58539824 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718045 19:58540422-58540444 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718288 19:58541390-58541412 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718397 19:58541853-58541875 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718489 19:58542240-58542262 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718539 19:58542436-58542458 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
1168718619 19:58542784-58542806 CCCTGTCTGAGGAGGGAAGCAGG - Intergenic
925293828 2:2765278-2765300 CCCTGTGTGTGGAGGGGCACGGG - Intergenic
925910877 2:8572941-8572963 CCCTGTGGGTCCCAGGCAGCTGG - Intergenic
926296753 2:11574477-11574499 GCCTGTGGGTGGAGGGCAGTGGG + Intronic
926698212 2:15785238-15785260 CCCTGTGTGCCGAGGGCAGCGGG + Intergenic
926820753 2:16849101-16849123 CCATGTGGGTGTTGGGCAGGTGG - Intergenic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
929236069 2:39606916-39606938 TCCTGTGGGTTGTGGGCACCTGG + Intergenic
929259682 2:39851760-39851782 CACTGTGGGTGCAGGGGAGAGGG - Intergenic
929564993 2:42978640-42978662 CCCAGTGGATGGAGGGCACATGG + Intergenic
929938952 2:46315773-46315795 CTCTGAGGGTGGAGGGCAAGAGG + Intronic
931235725 2:60410918-60410940 CCCTGTGGGTGGGGGGGGGGGGG + Intergenic
932433858 2:71691724-71691746 CCCTGGGGGTGGAGGCAAACTGG - Intergenic
933419860 2:82031246-82031268 CCCACTGGGTGGAGTGGAGCTGG + Intergenic
933846881 2:86333988-86334010 CCCTGGGGACGGAGGTCAGCAGG - Intronic
934654537 2:96110312-96110334 CCCTGTGTGTGGGGGGCCACTGG - Intergenic
934761571 2:96859654-96859676 CTCTCTGGGTGGAGGGAGGCTGG - Intergenic
935363519 2:102267405-102267427 CCCTGTGAATGGAGGTCAGCAGG - Intergenic
936614311 2:114033042-114033064 CCATGGGGGTTGGGGGCAGCAGG - Intergenic
937304665 2:120863985-120864007 ACTTGTGTGTGGAGGGCGGCTGG + Intronic
937335387 2:121059336-121059358 CCAGGTGGGTGAAGGGCAGGTGG - Intergenic
937365412 2:121257487-121257509 TCAGGTGGGTGGAGGGCAGGAGG - Intronic
938312430 2:130301866-130301888 CACTGTTGGTGGCAGGCAGCAGG + Intergenic
938395020 2:130939050-130939072 ACTTGAGGGTGGAGGGCAGGAGG - Intronic
938442406 2:131347647-131347669 CCCTGAGGGTGGAGCGAAGACGG - Intronic
938952726 2:136270340-136270362 ACATGTGGCTGGAGGGCAGGAGG + Intergenic
940637884 2:156320325-156320347 CCCTGAGGGTGGGGGGCGGGGGG + Intergenic
941659361 2:168179801-168179823 GCTTCTGGGTGGAGGTCAGCAGG - Intronic
942604874 2:177679964-177679986 CCCTCTGGGGAGAGGGCTGCAGG + Intronic
943725244 2:191245738-191245760 CCCTGCGGGCGGGGGTCAGCGGG + Intronic
943753220 2:191531724-191531746 ACCTGTGGGAGGAAGGCAGATGG + Intergenic
944923067 2:204435632-204435654 TCCTGATGCTGGAGGGCAGCAGG - Intergenic
945049284 2:205807816-205807838 CCATGTGGTGGGAGGGCGGCAGG - Intergenic
946182995 2:217960132-217960154 CCCAGTGAGTGGGGGGCAGAAGG + Intronic
946398505 2:219455855-219455877 CCCTCTGGGTGCTGGGCAGGAGG + Intronic
947078911 2:226373849-226373871 CACTGTGGTTGGAGCACAGCAGG - Intergenic
947793145 2:232879112-232879134 CCCTGTGGGAGGCAGGCAGAAGG - Exonic
947948942 2:234131055-234131077 TCATGTGTGTGGAGGGCAGTGGG + Intergenic
948426074 2:237887157-237887179 TCCTGTGTGGGGAGGGCAGTGGG + Intronic
948568545 2:238901797-238901819 CCATGGGGGTGGCTGGCAGCTGG + Intronic
948878223 2:240841426-240841448 CCCTGCGGGGAGAGGTCAGCGGG + Intergenic
1168742627 20:206059-206081 CCTTGAGGGTGGAGGGCGGGAGG + Intergenic
1168800794 20:642348-642370 GCCTGTGGGGGGGGGCCAGCGGG + Intergenic
1169040691 20:2492873-2492895 CCCTGTGTGTGGAGCACAGCTGG + Intronic
1169074223 20:2751643-2751665 CCCTGGGAGTGGGGGGCTGCGGG + Intronic
1171324224 20:24276633-24276655 CAGTGTGGGTGCAGGACAGCAGG + Intergenic
1171936917 20:31283523-31283545 ATCTGAGGGTGGAGGGCAGGAGG + Intergenic
1172130594 20:32652376-32652398 CCCTTTGCATGGAGGGCTGCTGG - Intergenic
1172183388 20:33016979-33017001 CCCTGGGGCTGGAGGGCACAAGG - Intronic
1172205319 20:33159170-33159192 CCCTGTGTGTGGCCAGCAGCGGG - Intergenic
1172387930 20:34547093-34547115 CTCTGTGGAGTGAGGGCAGCAGG + Intronic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1172623380 20:36333966-36333988 CCCTGTGGGTTGTGGGTCGCTGG - Intronic
1172993884 20:39055794-39055816 CCCTGAAGGTGGATGGCAGATGG + Intergenic
1173521170 20:43701357-43701379 TCCTAAGGGTGGAGGCCAGCTGG - Intronic
1173732726 20:45339790-45339812 CCCTGTGGCTGGTGGGGATCTGG + Intronic
1174082746 20:47982820-47982842 CGCAGTGGGTGGTGGGCAGGGGG - Intergenic
1174354351 20:49988270-49988292 TTCTGTGGAGGGAGGGCAGCTGG + Exonic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175724404 20:61307831-61307853 CCCCGTGGGTGGAGCCCGGCTGG - Intronic
1175762457 20:61570933-61570955 CTGTGTGGGTGCAGGGCTGCAGG + Intronic
1175895628 20:62334485-62334507 CCCACTGGGTGGTGGGGAGCGGG - Intronic
1175974627 20:62704356-62704378 CCTGGTGGCTGCAGGGCAGCTGG - Intergenic
1176000975 20:62830949-62830971 CCTTGTGGGTGGGAGGCTGCGGG + Intronic
1176069892 20:63220734-63220756 CCCCGTGTGTGGAGAACAGCAGG - Intergenic
1176120557 20:63452785-63452807 CTCTGTGGCTGCAGGCCAGCTGG - Intronic
1176127089 20:63480464-63480486 TCCAGTGGGTGGAGGCCAGGGGG + Intergenic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176255672 20:64151490-64151512 TCCTGAGGTTGGAGGGCGGCTGG - Intergenic
1178809384 21:35867520-35867542 CCCTGTGGGGAGAATGCAGCGGG + Intronic
1179709999 21:43207897-43207919 CCATGTGGCTTGAGGGCAGTGGG + Intergenic
1179887644 21:44321199-44321221 CACGGTGGGTGGAGGGGAGGTGG + Intronic
1179890312 21:44331822-44331844 ACGTGAGGCTGGAGGGCAGCGGG - Exonic
1180581940 22:16846089-16846111 CCTGGTGTGTGGAGGGCAGGGGG - Intergenic
1181120796 22:20667902-20667924 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1181306515 22:21920226-21920248 CGCTGTGGGTGCAGGTGAGCCGG - Exonic
1181333758 22:22114928-22114950 CGCTGTGGGTGGAGGGCGCCGGG - Intergenic
1181359067 22:22321189-22321211 CCATGTGGTTGGAGAACAGCAGG - Intergenic
1181369166 22:22402942-22402964 CCATGTGGTTGGAGAACAGCAGG - Intergenic
1181454960 22:23053925-23053947 CCCTATGGGTCTAGGGCAGATGG - Intergenic
1181552681 22:23649705-23649727 CCCTGTGGGAGAAGAGGAGCAGG + Intergenic
1181594506 22:23905623-23905645 CCCTGTGGTTGGCGAGCAGGAGG + Intergenic
1181672079 22:24430375-24430397 CACTGAGGCTGGTGGGCAGCAGG + Intronic
1181688168 22:24543428-24543450 CCCTGTGCCCGGAGGGCAGTAGG + Intronic
1181976578 22:26735166-26735188 CACTGTGGGTGGCCGGGAGCTGG + Intergenic
1182420201 22:30245275-30245297 CCCTCTGGCTGGAAGGCACCAGG + Intronic
1182481646 22:30613059-30613081 CGCTGGGGGTGGGGAGCAGCTGG + Intronic
1182747926 22:32619943-32619965 TCCTGTGTTTGGAGGTCAGCTGG - Intronic
1183326547 22:37197666-37197688 CCCTCTAGGTGCAGGGCAGCTGG + Intronic
1183954583 22:41371811-41371833 CCCATTGGGTGCAGGGCAGATGG - Intronic
1184021899 22:41826633-41826655 ACCTGTGGGTGGGGGGCTGCAGG + Intergenic
1184109259 22:42385412-42385434 CCATGTGGCTGGAGGGCAATGGG - Intronic
1184206583 22:43007867-43007889 ATCTGTGGGTGGAAGGCAACAGG - Intronic
1184333125 22:43838386-43838408 CCCGCTGGGAGGAGGACAGCCGG - Intronic
1184583199 22:45430690-45430712 TCCTGACGGGGGAGGGCAGCTGG + Intronic
1185141143 22:49102016-49102038 CCTGGTGGGCGCAGGGCAGCAGG - Intergenic
1185168996 22:49281281-49281303 CCCTGTGAGTGCTGGGCTGCTGG + Intergenic
1185204700 22:49531123-49531145 GCCTGTGGATGGAGGGCGTCTGG + Intronic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185399348 22:50607913-50607935 GCCTGTGCCTGGAGGGAAGCTGG - Intronic
950539123 3:13599569-13599591 CCCTGTGGGTGATGGGCTGGAGG + Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950625638 3:14244695-14244717 CCATGGGCGTGGAGAGCAGCAGG + Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
951673896 3:25215543-25215565 GCCTGTGGTTGAAGTGCAGCAGG + Intronic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
953022993 3:39127724-39127746 CCCTGGGGCTTGAGGGCTGCGGG - Intronic
953680060 3:45032301-45032323 CCCTGTGGTGGGAGTGCAGAAGG - Intronic
953881907 3:46695065-46695087 GCCTGGGGGTGGAGGGCATGGGG - Intergenic
954204835 3:49050880-49050902 GCCTGTGGGTGGTGGGGAGGAGG - Intronic
954581113 3:51703404-51703426 AAATGTGGGGGGAGGGCAGCAGG + Intronic
954624821 3:52016678-52016700 CCCTGGAGGCTGAGGGCAGCAGG + Intergenic
954628644 3:52036361-52036383 CCCTGGGGGATGAGAGCAGCTGG - Intergenic
954753540 3:52826952-52826974 CCCTGGGGGAGAAGGGCATCAGG + Exonic
955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG + Intronic
955655381 3:61239966-61239988 TCCTGTGGGTTGAGGACTGCTGG - Intronic
956578030 3:70777441-70777463 CCTTGAGGGTGGAGGGTAGAAGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958185202 3:90110989-90111011 GACAGTGGGTGCAGGGCAGCAGG - Intergenic
960056348 3:113279106-113279128 ACCAGTGGGTGGAGGGCTGTGGG + Intronic
961148048 3:124611785-124611807 TCTTGTGGCTGGAGCGCAGCTGG - Intronic
961504472 3:127361036-127361058 ACCTGTGGCTGGAGGGCTTCCGG + Intergenic
961616160 3:128182853-128182875 CTCTGTGGCTGGTGGGAAGCAGG - Intronic
962200609 3:133398599-133398621 CTCTCTGGGTGGTGGGCAACAGG + Intergenic
962275922 3:134013441-134013463 CCCTGTTGGTGGGGGGCAAAGGG - Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964229623 3:154449759-154449781 GCCTGTAGGGGGAGGGCAGTGGG - Intergenic
964928906 3:161991574-161991596 CCCTGTGGGAAGAAGGCAGGAGG + Intergenic
965319026 3:167228588-167228610 CCCTAGGAGTGGAGGGCATCAGG - Intergenic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
966881611 3:184354054-184354076 GGCTGTGGGTGAAGGGCAGAGGG - Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967055188 3:185824590-185824612 AGCTGTGGGGGGAGGGGAGCGGG + Intronic
967570490 3:191022493-191022515 CACTGTGGCTGGAGGGGAACAGG + Intergenic
967744997 3:193045385-193045407 ACCTGAGGGTGGAGGGTAGGAGG + Intergenic
967975914 3:195034766-195034788 CACTGTGCGTGGAGGGATGCAGG + Intergenic
968383173 4:112148-112170 ACCTGTGGGAGGGTGGCAGCAGG - Intergenic
968489429 4:882122-882144 CCCTGTGGCTGCAGGGACGCAGG + Intronic
968522383 4:1039869-1039891 CCCTGTGGAGGGTGGGCACCCGG + Intergenic
968758428 4:2428526-2428548 CGCTGTGGGTGGAGGGGTGGGGG - Intronic
968969602 4:3786724-3786746 CCAGGTGGGAGGAGGCCAGCTGG - Intergenic
969107749 4:4820626-4820648 CTCTGTGGCTGGGGTGCAGCAGG - Intergenic
969131830 4:4995723-4995745 CCCTCTGGGTGGAGGAGAGGTGG + Intergenic
969442740 4:7226944-7226966 CCATGTGGCTGAAGGGCAGTGGG + Intronic
969472747 4:7399272-7399294 CCCTGTGGATGGAAGGCTGGCGG + Intronic
969608307 4:8213097-8213119 CCTTGTGGGTGGAGGGCAGGTGG - Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
971841272 4:31855749-31855771 GCATGTGGGTGGAGGTCAGGAGG - Intergenic
973668609 4:53190350-53190372 CCATGTGGCTGGAGCACAGCAGG - Intronic
974295536 4:59994320-59994342 CTCTGCTGGTGGAGGGCAGAGGG + Intergenic
976389101 4:84491665-84491687 CCCTGGGGTTGGGGGGCAGTTGG - Intergenic
977569280 4:98612814-98612836 CCCTGTGGGGGGAGGGAGGAAGG - Intronic
977738473 4:100446736-100446758 ACCTGAGGGTGGAGGGTAGGAGG - Intronic
978949484 4:114540446-114540468 CCTTGAGGGTGGAGGGTAGGAGG - Intergenic
980929969 4:139176405-139176427 CGCTCTGGGTGGCGGGCAGGCGG - Intronic
981388364 4:144158223-144158245 CCTTGTGGGTGGAGGGTGGCAGG - Intergenic
981730278 4:147889709-147889731 TCCTGTGTTGGGAGGGCAGCTGG + Intronic
982750568 4:159156632-159156654 CCATGTGGGTGGTTGGGAGCTGG - Intronic
983156723 4:164356960-164356982 CCCAGTGGGTGGAGGGTAGGAGG + Intronic
984852406 4:184165439-184165461 CACCGTGGCTGGAGGGGAGCAGG - Intronic
985504979 5:273683-273705 CGCTGTGGGTGGGGGGGTGCTGG + Intronic
985994676 5:3591365-3591387 CCCCGAGGGTGCAGGGCTGCAGG - Intergenic
987324927 5:16804118-16804140 CCCTGTGGGTGGATGGGTGATGG - Intronic
987332148 5:16866869-16866891 GGCTGTGGGTGGAGACCAGCAGG - Intronic
987400955 5:17476153-17476175 ACCTGTGGGTGGAGGGTGGGAGG + Intergenic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
990365414 5:55065697-55065719 CACAGTGGGTGGAGGGGAGTAGG - Intergenic
990560921 5:56982135-56982157 CCCTGTGGTTGGAGGGGGGAAGG - Intergenic
992460313 5:76954008-76954030 CCCTGGGGGAGGAGGGCATGGGG - Exonic
994496306 5:100517532-100517554 CCTTCTGGCTGGAGGCCAGCTGG + Intergenic
996265954 5:121540522-121540544 ACTTGTGGGTGGAGGGCAAGAGG + Intergenic
996379940 5:122852901-122852923 CACAGTGGGAGAAGGGCAGCAGG + Intronic
996794036 5:127324843-127324865 CCTTGAGGGTGGAGAGCAGAAGG - Intronic
996953809 5:129159723-129159745 ACCTGAGGGTGGAGGGTAGGAGG - Intergenic
998823403 5:146077180-146077202 CCTTGTGAGGGGAGGGCAGGTGG - Intronic
999306130 5:150520936-150520958 TTCTGGGGGTGCAGGGCAGCAGG - Exonic
999389582 5:151180481-151180503 CCCTGTATGTGGAGGGGACCTGG + Intergenic
999593668 5:153177854-153177876 ACCTGAGGGTGGAGGGTAGGAGG + Intergenic
1000293368 5:159891693-159891715 ACCTGAGGGAGGAGGGCTGCAGG - Intergenic
1001049651 5:168404156-168404178 CCCTGTTGGCAGAGGACAGCTGG + Intronic
1001571218 5:172731939-172731961 CACAGTGGGGGGAGGGTAGCAGG + Intergenic
1003491593 6:6627144-6627166 CCCTGGGAGGGGAGAGCAGCTGG - Intronic
1003815703 6:9837758-9837780 TCCTGAGGGTGGAGGGCGGCAGG + Intronic
1004141320 6:13020507-13020529 CCCTGGGGGTGAAGGCCAGCAGG + Intronic
1004465428 6:15880817-15880839 CCTTGAGGGAGGAGGGTAGCAGG - Intergenic
1004819173 6:19348103-19348125 CACTGGGGGTGGAGGGGAGGTGG - Intergenic
1005164896 6:22908535-22908557 GACTATGGGTGGAGGGCAGCAGG + Intergenic
1006136687 6:31900355-31900377 GCCTGGGGGCGGGGGGCAGCCGG - Exonic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1006420497 6:33930986-33931008 GCCGGTGTGAGGAGGGCAGCAGG + Intergenic
1006438073 6:34036726-34036748 CCCTGTGGGGTCCGGGCAGCTGG - Intronic
1007275657 6:40671695-40671717 CCCTGTGGATGGAGAGCCACAGG - Intergenic
1007416669 6:41694981-41695003 GGCTGTGGGTGGACAGCAGCAGG - Intronic
1015643335 6:135362293-135362315 CCCTCTGGGTAGATGGTAGCGGG + Intronic
1017004204 6:150018769-150018791 CACCGTAGGTGGTGGGCAGCTGG + Exonic
1017198785 6:151730223-151730245 CCCGGGGGGTCGAAGGCAGCAGG - Intronic
1017201943 6:151763981-151764003 CCCTGTGGGTAAAGGGAAGGAGG + Intronic
1018673830 6:166201984-166202006 CCCTGTGGGTGGAGGAAGGAAGG + Intergenic
1018812578 6:167308464-167308486 CCCTGTGGATGTGGGGGAGCAGG + Intronic
1018849083 6:167574909-167574931 CCCTGGCTGTGGAGGGCGGCGGG - Intergenic
1019033645 6:169035193-169035215 TGATGTGGGCGGAGGGCAGCAGG - Intergenic
1019042503 6:169118634-169118656 CTCTGTGGGTGTATGGCAGGAGG - Intergenic
1019422091 7:955169-955191 ATCTGTGGGTGGTGGGCGGCTGG - Intronic
1019711765 7:2521176-2521198 CACTGTGGGTGGGTGGGAGCAGG + Intronic
1020097721 7:5377853-5377875 CCCTGGGGGTGAGGGGCAGCTGG - Intronic
1021351732 7:19602386-19602408 GCCTGAGGGTGGAGTGCAGAGGG + Intergenic
1021761532 7:23906722-23906744 CCAAGTGTGTGGAAGGCAGCAGG + Intergenic
1021962510 7:25887007-25887029 CACTGTGGGTGGCAGGCAGGTGG + Intergenic
1022114181 7:27248273-27248295 ACTTGAGGGTGGAGGACAGCAGG + Intergenic
1022247645 7:28575879-28575901 CCCCGTGAGTGGAAGGCTGCCGG - Intronic
1022739085 7:33104300-33104322 ACTTGAGGGTGGAGGGCAGGCGG + Intronic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1026024270 7:66732366-66732388 CTTGGTGGGTGGTGGGCAGCAGG - Intronic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1026938922 7:74275472-74275494 CACTGTGGGTGGCTGCCAGCAGG + Intergenic
1029127287 7:98303374-98303396 ACCTGTGGGTGAAGGGGAGGAGG - Intronic
1029195149 7:98800278-98800300 ACTTGAGGGTGGAGGGCAGGAGG - Intergenic
1029207444 7:98878289-98878311 CCCTGGGGGCGGTGGGCACCTGG - Intronic
1029250105 7:99230090-99230112 ACCTGAGGGTGGAGGGCGGGAGG - Intergenic
1029270183 7:99372943-99372965 CCCTGTGGGAAGAGGGCTGCCGG + Intronic
1029280627 7:99433253-99433275 GCATGTGGGCGCAGGGCAGCCGG - Intronic
1029490348 7:100867195-100867217 CACTGGGGGTTGCGGGCAGCTGG - Exonic
1029595473 7:101535465-101535487 CCAGGTGGGTGGGGGACAGCTGG - Intronic
1030298106 7:107948801-107948823 CCCGGTGGCACGAGGGCAGCAGG - Intronic
1034267057 7:149786177-149786199 CCAGGTGGGTCGAGAGCAGCAGG - Intergenic
1034562461 7:151889933-151889955 TCCCGTGGGTCCAGGGCAGCCGG + Intergenic
1035012296 7:155729975-155729997 CCCTGTGCTTTGTGGGCAGCTGG + Intronic
1035225959 7:157432348-157432370 CCGTGTGGGTGATGGGCTGCGGG - Intergenic
1035442120 7:158910495-158910517 GCCTGTGGGTGGAGGGCCATTGG + Intronic
1035442174 7:158910752-158910774 ACCTGTGGGTGGAGGGCCATTGG + Intronic
1036620171 8:10419739-10419761 CTCTTTGGGTGGAGGGCAGGCGG + Intronic
1037323772 8:17668822-17668844 GCCTGAGGGTGGAGGGCGGGAGG - Intronic
1037381894 8:18294067-18294089 CCCTGTGGTTTCAGGGAAGCTGG + Intergenic
1037542832 8:19888794-19888816 AGCTGTGGGTGGAGAGGAGCTGG - Intergenic
1037771850 8:21805912-21805934 CCCAGTGGCTGCAGGGCAGAAGG + Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040407615 8:47121803-47121825 ACTTGAGGGTGGAGGGCAGCAGG + Intergenic
1041691842 8:60694792-60694814 CCCTGAGGGAGAGGGGCAGCAGG + Intronic
1042817550 8:72894252-72894274 CCCTAAGGGTGGAGCTCAGCAGG + Intronic
1043171499 8:76972344-76972366 CGGTGTGGGTGGGGGGCAGCAGG + Intergenic
1043256138 8:78138879-78138901 TACTGTGGGTGGGGGGCAGGGGG + Intergenic
1043454846 8:80402863-80402885 ACCTGTGGCTGCAGGGCAGTAGG - Intergenic
1044170573 8:89046738-89046760 ACTTGAGGGTGGAGGGCAGGAGG - Intergenic
1044302111 8:90596726-90596748 CCCTGTGGGAGGAGCACTGCAGG + Intergenic
1044557928 8:93584846-93584868 ACTTGAGGGTGGAGGGCAGGAGG + Intergenic
1044829189 8:96229383-96229405 CCGGGTGGGTGGAGGGAGGCTGG - Intronic
1044862283 8:96534776-96534798 TCCTGGGGGAGAAGGGCAGCGGG - Intronic
1045381552 8:101632387-101632409 CCCTGTGGATGGATGGGAGGTGG - Intronic
1045436256 8:102167935-102167957 CCCTGTCTGTGGGAGGCAGCTGG + Intergenic
1046975479 8:120271219-120271241 ACTTGTGGGTGGAGGGTAGGAGG + Intronic
1048295851 8:133212843-133212865 GCCTGCGGGGGGAGGGCAGAGGG - Exonic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1048860302 8:138719894-138719916 CCCTGTGGGTGGAGGGCGGGAGG + Intronic
1049167688 8:141136825-141136847 CACTCTGGGTGGCCGGCAGCAGG - Intronic
1049256015 8:141614352-141614374 GGCTGGGGGTGGAGGGGAGCAGG - Intergenic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1049797815 8:144504583-144504605 CCCTGGGAGGGGAGGGGAGCAGG - Exonic
1051421025 9:16889456-16889478 CCCTGTGGTTGAAGGACAGAAGG + Intergenic
1051936230 9:22446690-22446712 CCTTCTGGGAGGAGGGCGGCGGG - Intergenic
1055369890 9:75586220-75586242 CCCTGAGGGTGGAGGGTGGGAGG + Intergenic
1055513161 9:77014858-77014880 GCCCGAGGGTGGAGGGCAGAAGG - Intergenic
1056532197 9:87497824-87497846 CCTTTTGGGCGGAGGGCGGCCGG - Intronic
1056606543 9:88090316-88090338 GCCAGTGGTTGGAGGGCAGGGGG + Intergenic
1057129604 9:92644390-92644412 CTCTGTGGCTGCTGGGCAGCTGG - Intronic
1057606112 9:96498927-96498949 GCCTGTGGCTGGGAGGCAGCAGG - Intronic
1058267291 9:102918427-102918449 CCCTCCTGTTGGAGGGCAGCAGG + Intergenic
1059336531 9:113572566-113572588 CCCTGAAGGAGGAGGGCAGTGGG + Intronic
1059368840 9:113808599-113808621 CCCTGTGTGTTCAAGGCAGCAGG - Intergenic
1059405059 9:114094264-114094286 CCCTGAGGCTGCAGGGAAGCAGG + Exonic
1060199716 9:121645404-121645426 TCCTGTGGGCAGAAGGCAGCAGG + Intronic
1060913104 9:127366464-127366486 ACCTGGGGATGCAGGGCAGCAGG - Intronic
1061078779 9:128357580-128357602 CCAGGTGGGAGGTGGGCAGCGGG + Intronic
1061481435 9:130899274-130899296 ACCTGTCGGGGGCGGGCAGCCGG - Intergenic
1061864470 9:133485270-133485292 CCGTGCAGGGGGAGGGCAGCTGG + Intergenic
1062021127 9:134319890-134319912 CCCTGGAGCTGGAGGGCTGCAGG + Intronic
1062069399 9:134547422-134547444 TCCCTTGGGTGCAGGGCAGCTGG + Intergenic
1062254699 9:135615354-135615376 CCCTGCAGGTGGAGGGGCGCTGG + Intergenic
1062261229 9:135664124-135664146 TCCAGTGGGTGGGGGGCCGCGGG - Intronic
1062278902 9:135743348-135743370 CGCTGAAGGTGGATGGCAGCGGG - Intronic
1062373984 9:136253803-136253825 CCCTGTGGATGGAGGACGGGAGG + Intergenic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1062625044 9:137438748-137438770 CCCTGTGGGAGGGGGGCGGGGGG + Intronic
1186180485 X:6968432-6968454 CCCTGTGGGTCTGGGGCAGGGGG + Intergenic
1186402335 X:9271346-9271368 ACATGAGGGTGGAGGGCAGGAGG - Intergenic
1186416908 X:9391777-9391799 GGCTGTGGGTGGAGGGCAACGGG + Intergenic
1186618552 X:11214703-11214725 ACATGTGGGTGGTGGGCCGCTGG - Intronic
1186747205 X:12582513-12582535 CCCTGTGGGAGGAGGGAGGCAGG + Intronic
1186870244 X:13764480-13764502 CCCTGCGGGTGGAGGGAGACGGG + Intronic
1187027401 X:15450132-15450154 CCCTTTGGGGTGAGGGTAGCAGG - Intronic
1188106672 X:26155588-26155610 CCCCATGTGTGGAGGGCAGGAGG - Intergenic
1189855815 X:45223895-45223917 CCCGGTGGGTGGGGGGTTGCGGG + Intergenic
1189891333 X:45605547-45605569 GCCTGTTGGCGGAGGGCAGCGGG - Intergenic
1190214502 X:48470570-48470592 CCCTGTCGGGGGTGGGCAGGCGG - Intergenic
1190399230 X:50014906-50014928 CCCTGTGTGTGGACAGCAGGTGG - Intronic
1190732759 X:53235824-53235846 GCTTGTGGGTGCAGGGAAGCGGG - Exonic
1191101608 X:56735566-56735588 CCGGGTGGGTGGAGGGAGGCTGG - Intergenic
1192175314 X:68881306-68881328 CCCTGAGGCTGGAGGGGAGGGGG + Intergenic
1192210793 X:69126572-69126594 CACTGTGGGTGGGGGGCAGGGGG - Intergenic
1192554623 X:72079934-72079956 GGCTGTGGGTGGAGTGCAGCGGG + Intergenic
1192917896 X:75673549-75673571 CCCTGGGAGTGGCTGGCAGCAGG - Intergenic
1193030747 X:76896080-76896102 ACTTGTGGGTGGAGGGTAGAAGG + Intergenic
1193096789 X:77557919-77557941 CTCTGTAGGAGGAGGACAGCAGG + Intronic
1193389882 X:80913911-80913933 CCTTCTGGGAGGAGGCCAGCTGG - Intergenic
1193638737 X:83985205-83985227 GCCAGTGGGTGCAGGGCTGCTGG - Intergenic
1195460303 X:105116100-105116122 CCCTGCAAGTGGAGGGAAGCCGG + Intronic
1197689199 X:129478583-129478605 CTCTTTGGGTGGTGGCCAGCTGG - Intronic
1198534547 X:137573948-137573970 CCCTGTAGGTGGAGGTCAAAGGG - Intronic
1198754838 X:139971577-139971599 TCCCTTGGGTGGAGGCCAGCTGG + Intergenic
1198794148 X:140377942-140377964 ACTTGTGGGTGGAGGGTAGGAGG + Intergenic
1198855449 X:141010730-141010752 GCCTCTGGGTGGAGGGGAGGAGG - Intergenic
1198907246 X:141576638-141576660 GCCTCTGGGTGGAGGGGAGGAGG + Intergenic
1198909545 X:141597763-141597785 GCCTCTGGGTGGAGGGGAGGAGG - Intronic
1198917541 X:141690382-141690404 GCCTCTGGGTGGAGGGGAGGAGG + Intronic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1199094344 X:143722635-143722657 CCTTGTGTCTGGAGGTCAGCGGG - Intergenic