ID: 1062623928

View in Genome Browser
Species Human (GRCh38)
Location 9:137434560-137434582
Sequence ACAGGGGTCCTGCTCCTGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062623928_1062623936 5 Left 1062623928 9:137434560-137434582 CCCATCAGGAGCAGGACCCCTGT 0: 1
1: 0
2: 1
3: 5
4: 111
Right 1062623936 9:137434588-137434610 CGTGGTCTTGCCCTGTTTGCAGG 0: 1
1: 0
2: 1
3: 14
4: 370
1062623928_1062623938 15 Left 1062623928 9:137434560-137434582 CCCATCAGGAGCAGGACCCCTGT 0: 1
1: 0
2: 1
3: 5
4: 111
Right 1062623938 9:137434598-137434620 CCCTGTTTGCAGGCAGCATGTGG 0: 1
1: 0
2: 1
3: 21
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062623928 Original CRISPR ACAGGGGTCCTGCTCCTGAT GGG (reversed) Exonic
901155864 1:7137791-7137813 ACAGGGGTCCTGTTCTTTGTAGG - Intronic
906285140 1:44582268-44582290 GCAGGGGTCCTGCTCCTGAGCGG + Intronic
910845901 1:91604610-91604632 ACAGGGGGCCTGCTCCCTCTAGG - Intergenic
915623659 1:157101237-157101259 ACATGGGAACTGCTCCTGGTGGG + Intergenic
918177729 1:182060197-182060219 ACATGGGTCCTGGCTCTGATGGG - Intronic
923025661 1:230201889-230201911 ACAGGGTTCCTGTTCTTTATGGG - Intronic
924383314 1:243482719-243482741 ACTGGCTTCCTGCCCCTGATGGG + Intronic
1063568799 10:7195699-7195721 ACAGGTGGCCTGCCCCTGGTAGG - Intronic
1067081875 10:43216764-43216786 GGAGGGGCACTGCTCCTGATGGG + Intronic
1071570636 10:86694837-86694859 TCAGGGGTCTTGCTCCTCAGAGG + Intronic
1072683627 10:97524097-97524119 ACAGTGCCCCTGCTCCTTATGGG + Intronic
1072691887 10:97577643-97577665 CCAGGGGCCCTGCTCTTGCTGGG + Intronic
1074204996 10:111275438-111275460 ACAGGAGTCCTGTTCCAGCTGGG + Intergenic
1076719406 10:132386702-132386724 AACGTGGCCCTGCTCCTGATGGG + Intergenic
1078488102 11:11742600-11742622 AGTGGAGTCCTGCTCCTGAGTGG - Intergenic
1082018709 11:47512877-47512899 ACAGGCCTCCAGCTCCTGAGAGG - Intronic
1082987591 11:59181874-59181896 CCAGGGGTGCTGCTTCTCATAGG - Exonic
1085390298 11:76178857-76178879 ACAAGAAGCCTGCTCCTGATGGG - Intergenic
1091215086 11:133896179-133896201 ACAAGGCTCCTGCTCCTGGAGGG - Intergenic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1094390316 12:29942053-29942075 GCTGGGGTCCTGCTCTTTATGGG + Intergenic
1097717046 12:62978076-62978098 ACAGGGCTCCTGCTCTTTGTGGG + Intergenic
1099605533 12:84797499-84797521 ACAGGGAACCTGTTCCTGAGAGG + Intergenic
1102830228 12:115991474-115991496 ACAGCGGTACTGGTCCTCATTGG + Exonic
1104577680 12:129982813-129982835 AGTGGGGTCCTGTTCCTGAAGGG - Intergenic
1104605491 12:130184635-130184657 ACAGGTGACCTGCTGCTCATAGG + Intergenic
1104801144 12:131555960-131555982 ACAGCTGTCCCACTCCTGATGGG - Intergenic
1113794641 13:113049948-113049970 ACATGGGTCTTGCTCTCGATTGG - Intronic
1118906462 14:70027289-70027311 ACTGGGGTCCTTCTCCTGGAGGG - Intronic
1121240932 14:92429633-92429655 ACAGAGGGCCTGCTCCTGGATGG + Intronic
1122211976 14:100179171-100179193 GCTGGGGTCCTGCTCCTGCCTGG + Intergenic
1124197632 15:27646772-27646794 TCAAGGGCCCTGCTCCTGACAGG - Intergenic
1125533685 15:40430226-40430248 ACAGGGTACCTGCACATGATAGG - Intronic
1131179077 15:90228047-90228069 ACTGGGGACCTGCTGCTGGTGGG + Exonic
1132649359 16:1013650-1013672 ACAGGTGTCCAGCTCTTGACAGG + Intergenic
1138946957 16:61863294-61863316 AAATGGGTCCTGCTGCTAATGGG - Intronic
1142721259 17:1777396-1777418 ACAGGGGCCCTTCTCTTCATTGG + Exonic
1143219247 17:5247687-5247709 ACAGGGGTCCGGGGCCTGTTAGG + Intergenic
1145770860 17:27492043-27492065 ACAGGGGTCAGTCACCTGATGGG + Intronic
1148806494 17:50266600-50266622 ACCGAGGTCCTGCTCCAGGTGGG - Intergenic
1150610325 17:66728167-66728189 ACAGAAGTGCTGCTCTTGATTGG + Intronic
1151228329 17:72663485-72663507 CCTGGGCTCCTGCTCCTCATGGG + Intronic
1158548231 18:58413869-58413891 ACAGGGGTCCTGGTCCCTGTGGG - Intergenic
1159326529 18:66927353-66927375 ACAGAGTTCCTTCTCCTTATGGG + Intergenic
1160611958 18:80095795-80095817 ACAGGCCTCCTGCACCAGATGGG - Exonic
1160761915 19:789738-789760 ACTGGGTCCCTGCTCCTGCTGGG - Intergenic
1163677490 19:18662679-18662701 ACAGGGGTCCAGCACCTGCCTGG - Intronic
1163816996 19:19472694-19472716 CCAGGGGTCCTGCAACTGAAAGG + Intronic
1164479099 19:28597904-28597926 ACAAGGGCACTGCTTCTGATGGG + Intergenic
1167663404 19:50809972-50809994 ACAGAGCTGCTGCTGCTGATGGG + Intergenic
925469139 2:4140046-4140068 AGTGGGGTTCTGCTGCTGATTGG + Intergenic
925805987 2:7648696-7648718 ACATGGGTGCTCCTTCTGATCGG - Intergenic
925944823 2:8851065-8851087 GCAGGGGCTCTGGTCCTGATGGG - Intergenic
926697413 2:15780437-15780459 CCAGGGGGCCTGCCCCTGCTGGG - Intergenic
931703898 2:64931137-64931159 ACAGGGCTCCTAGTACTGATGGG + Intergenic
934993823 2:98939317-98939339 ACAGGGACCCTACTCCTGAGGGG + Intergenic
938070203 2:128304417-128304439 GCAGTGGTCCTGGTCCTGAGGGG - Intronic
946673110 2:222127848-222127870 GAAGGAGTCCTGCTCCTAATTGG + Intergenic
1169003288 20:2184148-2184170 ACAGGGACTCTGCTCCCGATTGG + Intergenic
1172371005 20:34391277-34391299 ACAGGTGCCCTCCTCCTGAATGG + Intronic
1175163239 20:57024202-57024224 CCAGAGATCCTGCTTCTGATTGG - Intergenic
1178715447 21:34960078-34960100 GCAGGGGTCCAGCACCAGATCGG + Intronic
1179926801 21:44539265-44539287 CCAGGAGTCCAGCTGCTGATGGG - Exonic
1179937108 21:44612895-44612917 CCAGGAGTCCAGCTGCTGATGGG + Exonic
1180137432 21:45870886-45870908 ACAGGGGTTCTGCGCATGAGAGG - Intronic
1181064419 22:20298942-20298964 TCAGGGGTCCCGCTCCCAATGGG + Intergenic
1183728836 22:39605697-39605719 AATGGGGTCCTGCTTTTGATTGG + Intronic
1184513072 22:44944334-44944356 ACAGGCGTCCAGCTCCTGGGCGG - Intronic
1184607057 22:45580240-45580262 CCAGGGCTGCTGCTCCTGGTGGG + Intronic
1184669022 22:46003208-46003230 ACATGGGTCCTGATGCAGATAGG - Intergenic
1184714155 22:46271185-46271207 ACAGGTGACCTGCTCCACATCGG - Intronic
1184841067 22:47052679-47052701 ACAGGAGTCCTGCTCAGGACAGG - Intronic
1184849425 22:47111879-47111901 GCAGGGGTCGTGCTGCTGAGGGG - Intronic
1185133119 22:49051917-49051939 CCAGGGGTCCTGCTCCTCCGTGG + Intergenic
958004475 3:87793582-87793604 TCAGGGGTCCTGCCCCTAAAGGG + Intergenic
960148389 3:114227343-114227365 ACAGGGTTCCCACTCCTGTTGGG + Intergenic
960949609 3:122990695-122990717 ACAGGGGTCCTGTTCTTCATCGG - Intronic
961048414 3:123725775-123725797 ACTGGGATCCTGCTCCCGACTGG - Intronic
968595518 4:1480286-1480308 ACAGTGGTCCAGCTGCTGCTGGG + Intergenic
968802517 4:2752549-2752571 CCAGGGTTCCTGCTCCTAACGGG + Intronic
972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG + Intergenic
985575588 5:672082-672104 ACCTGGGTCCTGCTCCTGGGAGG + Intronic
985764180 5:1768217-1768239 GCAGGGGTCCTGCTCCACCTGGG - Intergenic
986075080 5:4327810-4327832 ACAGGGGTACTGTTCAAGATAGG + Intergenic
987074461 5:14367630-14367652 ACATGGGTCATGGTTCTGATTGG + Intronic
1002160082 5:177309888-177309910 CCAGGGCTCCTGCTGCTGCTGGG - Intronic
1002688964 5:181037295-181037317 GCCGGGGTCCTGCTCCTGGGAGG - Intergenic
1002779422 6:354804-354826 GCAGGGCTGCTGCTCCTGAGAGG + Intergenic
1004020931 6:11775073-11775095 ACAGTGGTCCTTCTCCAGCTGGG + Intronic
1007198006 6:40079805-40079827 ACAGGTGTGCTGCTACTGCTGGG + Intergenic
1008040384 6:46791353-46791375 ACTGGGGGCCTGCTTCTGATGGG - Intergenic
1010899957 6:81414880-81414902 ACAGCTGCCCTGCTCCTCATTGG + Intergenic
1014344130 6:120246008-120246030 ACAGGGATCCTGGTTTTGATGGG - Intergenic
1019395782 7:816905-816927 GCAGGGGTCCTGCTCCTCCCCGG + Intronic
1020258195 7:6514418-6514440 ACAGAGCTCCTGCTCCTCATAGG + Exonic
1022093456 7:27123343-27123365 TCAGGGGCCCTGCTCCTGCCTGG + Intronic
1022634199 7:32116516-32116538 GCAGGGGGCCTGCTCATAATAGG + Intronic
1024366112 7:48522227-48522249 ACAGGGGCCCTGCTCAGGCTGGG - Intronic
1030680115 7:112425447-112425469 AAAGGTGTCCTGCTCCAGAAGGG - Intronic
1034089949 7:148354576-148354598 AGAGGGGTCTTGGTCCTGAGAGG + Intronic
1034172263 7:149071655-149071677 AGAGGGGCCCTGCTCCTGCTCGG - Exonic
1038609258 8:29044302-29044324 ACAGGGGCCCATTTCCTGATTGG + Intronic
1039110259 8:34034222-34034244 AGATGGGCCCTGCTGCTGATGGG + Intergenic
1044949170 8:97418694-97418716 TCAAGGTTCCTGCTCTTGATGGG - Intergenic
1048004984 8:130411887-130411909 ACTGGGGTGCTGCTCCTGGAAGG - Intronic
1048461655 8:134626279-134626301 TCAGGGATGCTGCTGCTGATTGG - Intronic
1049087220 8:140488103-140488125 AAAGGTGTCCTGCTCCAGAAGGG - Intergenic
1049468661 8:142765281-142765303 ACAGGGGCCCAGCTCCTGAGAGG - Intronic
1052877406 9:33577509-33577531 ACAGGGCTTCTGCTTCTGGTAGG - Intergenic
1053533833 9:38906418-38906440 ACAGGAGTCCTGCAGCTGCTTGG - Intergenic
1054206056 9:62130847-62130869 ACAGGAGTCCTGCAGCTGCTTGG - Intergenic
1054632302 9:67457523-67457545 ACAGGAGTCCTGCAGCTGCTTGG + Intergenic
1055999482 9:82199490-82199512 ACTTGTGTCTTGCTCCTGATGGG + Intergenic
1061352599 9:130077518-130077540 ACAGAGGTCCTGTCCTTGATGGG + Intronic
1062163209 9:135091174-135091196 TCAGGGGGCCTTCTCCTAATGGG + Intronic
1062546462 9:137065853-137065875 ACGGGGCTCCTGCTCCAAATGGG - Intronic
1062623928 9:137434560-137434582 ACAGGGGTCCTGCTCCTGATGGG - Exonic
1195705458 X:107735053-107735075 ACATGGGTCCTGTTGCTGAAGGG + Intronic