ID: 1062625118

View in Genome Browser
Species Human (GRCh38)
Location 9:137438987-137439009
Sequence CACCCTAGGAGTGCCTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 176}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062625118_1062625127 -8 Left 1062625118 9:137438987-137439009 CCACCCCAGGCACTCCTAGGGTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1062625127 9:137439002-137439024 CTAGGGTGGGGGTTTCTCTCTGG No data
1062625118_1062625128 2 Left 1062625118 9:137438987-137439009 CCACCCCAGGCACTCCTAGGGTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1062625128 9:137439012-137439034 GGTTTCTCTCTGGAGCCCTGAGG No data
1062625118_1062625134 18 Left 1062625118 9:137438987-137439009 CCACCCCAGGCACTCCTAGGGTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1062625134 9:137439028-137439050 CCTGAGGGGACTGTTGCCGAGGG No data
1062625118_1062625135 19 Left 1062625118 9:137438987-137439009 CCACCCCAGGCACTCCTAGGGTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1062625135 9:137439029-137439051 CTGAGGGGACTGTTGCCGAGGGG No data
1062625118_1062625132 17 Left 1062625118 9:137438987-137439009 CCACCCCAGGCACTCCTAGGGTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1062625132 9:137439027-137439049 CCCTGAGGGGACTGTTGCCGAGG No data
1062625118_1062625136 25 Left 1062625118 9:137438987-137439009 CCACCCCAGGCACTCCTAGGGTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1062625136 9:137439035-137439057 GGACTGTTGCCGAGGGGCTGTGG No data
1062625118_1062625129 3 Left 1062625118 9:137438987-137439009 CCACCCCAGGCACTCCTAGGGTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1062625129 9:137439013-137439035 GTTTCTCTCTGGAGCCCTGAGGG No data
1062625118_1062625130 4 Left 1062625118 9:137438987-137439009 CCACCCCAGGCACTCCTAGGGTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1062625130 9:137439014-137439036 TTTCTCTCTGGAGCCCTGAGGGG No data
1062625118_1062625137 26 Left 1062625118 9:137438987-137439009 CCACCCCAGGCACTCCTAGGGTG 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1062625137 9:137439036-137439058 GACTGTTGCCGAGGGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062625118 Original CRISPR CACCCTAGGAGTGCCTGGGG TGG (reversed) Intronic
900138147 1:1127549-1127571 CCCCCTGGGAGTGGCTGTGGAGG - Intergenic
903278468 1:22236524-22236546 CACCCTGGGAGCTCCTGGGCTGG - Intergenic
903699954 1:25239790-25239812 CAGCCCAGGACTGCCAGGGGTGG + Intergenic
904297218 1:29527825-29527847 CTCGCTGGGAGTCCCTGGGGTGG + Intergenic
904865908 1:33578725-33578747 TGCCCTAGGAGTCCCTGGTGGGG + Intronic
906183183 1:43839038-43839060 CACCAGAGGAGTGCTAGGGGTGG + Intronic
907438634 1:54464983-54465005 GACCCTGGGAGGCCCTGGGGCGG - Intergenic
909099422 1:71332209-71332231 CACCCTAGGTGTGGCTTCGGTGG - Intergenic
911587702 1:99710095-99710117 AAACTTAGGAGAGCCTGGGGTGG - Intronic
912626035 1:111204841-111204863 CACTCTCGGAGTTCCTGAGGAGG + Intronic
915662665 1:157416850-157416872 CACCCTGGGAGTTCCCAGGGTGG - Intergenic
917285230 1:173416101-173416123 CAACCTAGGAGAGCCTGGGTTGG - Intergenic
917749024 1:178037850-178037872 CACCCTGGGACTGCCTTGCGGGG + Intergenic
919974316 1:202600818-202600840 CACCTTACCAGGGCCTGGGGTGG - Intronic
922139377 1:222866992-222867014 CATCCTAGCAATGCCTAGGGTGG + Intergenic
1065497776 10:26347687-26347709 CACGCTGGGAGAGCCTGGGGAGG - Intergenic
1068261943 10:54594470-54594492 CCCCCTTGAGGTGCCTGGGGGGG - Intronic
1069317423 10:67124048-67124070 CACCCTTAGAGTTCCTGGGCTGG - Intronic
1070593711 10:77818188-77818210 CAACCTGGGTGGGCCTGGGGAGG + Intronic
1071976973 10:90964930-90964952 CACCCTGGGGCTGCTTGGGGAGG - Intergenic
1073121223 10:101123509-101123531 CACCCAAGGAGCGCCTGCGGCGG + Intronic
1077011874 11:382439-382461 CACCCTAGAGGAGGCTGGGGTGG - Intergenic
1077437736 11:2550848-2550870 CAGGCGAGGGGTGCCTGGGGAGG + Intronic
1077467805 11:2741880-2741902 CACCCTGGCCCTGCCTGGGGTGG - Intronic
1079094076 11:17499894-17499916 CAGCCTAGGACTGCCTGGAAGGG + Intronic
1081730922 11:45371303-45371325 CACGCTAGGTATGCCAGGGGCGG - Intergenic
1081910161 11:46695297-46695319 CACCCTATCAGTTACTGGGGAGG - Intronic
1083889198 11:65587528-65587550 CACCCTAAGAGTCCATGGGCAGG - Intronic
1084036427 11:66514069-66514091 CTCTCTAGAAGTGCCTGGTGTGG + Intronic
1084751281 11:71205709-71205731 CACATTAGGAGTGCCTTGGTAGG - Intronic
1085320348 11:75570353-75570375 GACCCTGGGAGTTCCTGGAGAGG + Intronic
1085455923 11:76665337-76665359 CAGCCTGGGAGGGGCTGGGGAGG + Intronic
1085505671 11:77057339-77057361 ATCCCTAGGAGTAACTGGGGAGG + Intergenic
1088902413 11:114128208-114128230 TTCCTTAGGAGAGCCTGGGGGGG + Intronic
1090987071 11:131777447-131777469 CACACTAGGATTGCATGGGGTGG - Intronic
1091972626 12:4800568-4800590 AACCCTAGGAATGCCAGGGATGG - Intronic
1094507276 12:31072710-31072732 CACCCTAGGAGTGTGTGTGTAGG + Intergenic
1096210592 12:49762621-49762643 CACCCCAGGAGTGCCGAGGTGGG - Intronic
1096656613 12:53096544-53096566 CTGGCTAGGAGTGCCTGGGATGG + Intergenic
1096781669 12:53995619-53995641 CAGCCTGGGAGTGGCTGGAGGGG - Intronic
1101618184 12:106358215-106358237 CAGCATAGGTGTGCGTGGGGAGG + Intronic
1102006172 12:109590575-109590597 CACCCAACCAGTGCCTGGGATGG + Intronic
1102491247 12:113290782-113290804 CGCCCTAGGAGTGCCTTGCCTGG + Intronic
1104811180 12:131621237-131621259 CATCCTGGGAGTGACTGGGGAGG - Intergenic
1108376990 13:49822968-49822990 AAACCCGGGAGTGCCTGGGGCGG - Intergenic
1108528100 13:51302920-51302942 CAGCCTAGGAATGACTGTGGGGG + Intergenic
1113421783 13:110176656-110176678 GACCCCAGGAGTGCCTGGAAAGG - Exonic
1113702185 13:112396098-112396120 CACCCTGGGATTCCCTGAGGCGG - Intronic
1113788674 13:113016054-113016076 CACCCCAGCGGTGCCTGGGAGGG + Intronic
1113842164 13:113366374-113366396 CACCCCAGGAGTGACTGTGCTGG + Intergenic
1114347544 14:21812111-21812133 CACACTAGGAGTGCCTAGGGTGG - Intergenic
1114517328 14:23308431-23308453 CACCCAAGGAGTGCCTGCAGGGG + Intronic
1116480200 14:45387948-45387970 CACTCTAGGAGTGCCTTGTGGGG - Intergenic
1119685607 14:76628585-76628607 CACCCTAGGAGAGGCTGGTGGGG - Intergenic
1119732693 14:76961140-76961162 CACCCCAGGAGTGCCTGTAGGGG + Intergenic
1121244344 14:92451381-92451403 CACCCTGGGTGGGACTGGGGAGG + Intronic
1122093399 14:99354380-99354402 CACCCTAGGGGTGCCCTAGGTGG - Intergenic
1122206785 14:100151676-100151698 CACCCAAGGAGTTCCAGAGGTGG + Intronic
1122852837 14:104546204-104546226 CACCCTGGGATGGCCTGGGGAGG + Intronic
1123495279 15:20817219-20817241 CAAGCTAGGGGTGCCAGGGGAGG + Intergenic
1123551768 15:21386312-21386334 CAAGCTAGGGGTGCCAGGGGAGG + Intergenic
1124372472 15:29111448-29111470 CACCCTGAGAGTGCCAGGGAGGG + Intronic
1125539527 15:40461974-40461996 CACCCCAGGAGTGGGTGGGCGGG - Exonic
1126270918 15:46815907-46815929 CAAAACAGGAGTGCCTGGGGAGG + Intergenic
1128874336 15:71189948-71189970 CACCCCAGCAGTGCGTGGGCGGG - Intronic
1130580791 15:85135346-85135368 CACTCTGGGAGGGCCTGAGGAGG - Intronic
1132100850 15:99021912-99021934 AGGCCTGGGAGTGCCTGGGGAGG + Intergenic
1202960113 15_KI270727v1_random:113554-113576 CAAGCTAGGGGTGCCAGGGGAGG + Intergenic
1132558461 16:582942-582964 CGCCCCAGGAGTGCTTGGGGTGG - Exonic
1132862415 16:2078161-2078183 CAGCCTGGGAGGGCCTGGGTGGG + Intronic
1134059875 16:11192793-11192815 CACTGTAGGAGTGCCTGCTGGGG - Intergenic
1137887164 16:52118129-52118151 CTCTCTAGGAGGGCCTGGGAGGG - Intergenic
1139532538 16:67549559-67549581 CACTCCAGGATTGTCTGGGGTGG - Intergenic
1141628068 16:85271914-85271936 CACCTCAGGAGTGCCTTCGGGGG + Intergenic
1143976646 17:10835339-10835361 CCCCATAGGAGTGACTGGGTGGG - Intronic
1144951061 17:18993680-18993702 CACCTGAGAAGTGCCGGGGGTGG + Intronic
1145061628 17:19737754-19737776 CAGCCAAGGAGAGCCTGAGGAGG - Intergenic
1151348922 17:73520149-73520171 GGCCCTAGGAGTGACTGGGGAGG - Intronic
1151785104 17:76271611-76271633 CTTCCTGGGAGGGCCTGGGGGGG - Intergenic
1152691891 17:81722128-81722150 CACCCAGGGAGTGGCTGGGTAGG + Intergenic
1154452678 18:14489693-14489715 CAAGCTAGGGGTGCCAGGGGAGG + Intergenic
1157711054 18:49849987-49850009 CAGCCTAGGAGTCCCAGGGTGGG + Intronic
1160719378 19:590640-590662 CGTCCTTGGAGCGCCTGGGGAGG + Intronic
1160907119 19:1456657-1456679 CACCCTAGGAATGCCAGGTGAGG + Intronic
1160938871 19:1610637-1610659 CAGCTTAGGGGGGCCTGGGGAGG + Exonic
1161773020 19:6241587-6241609 CAGCCTTGGAGGTCCTGGGGTGG + Intronic
1161843549 19:6696749-6696771 CACCCTAGCATTGCCGGGCGCGG + Intronic
1161866158 19:6833575-6833597 CACACAAGGAGTGTCTGGGGAGG + Exonic
1162158797 19:8697177-8697199 CAACCCAAGGGTGCCTGGGGAGG + Intergenic
1164566161 19:29327488-29327510 CACCCAGGGAGAGGCTGGGGAGG - Intergenic
1165012396 19:32858409-32858431 CACCCTGGGAGTGACGGTGGGGG + Intronic
1165591714 19:36974318-36974340 CTCCCTTTCAGTGCCTGGGGTGG + Intronic
1165893475 19:39128286-39128308 CACCCCACCACTGCCTGGGGAGG + Intronic
1167572510 19:50297960-50297982 CACCCCATGGGTGCATGGGGAGG + Intronic
1168271342 19:55251449-55251471 CCCCGTAGGAGTGGCTGGGAGGG - Intronic
928983302 2:37157199-37157221 AACCCTAGGAGCCCCGGGGGCGG - Intergenic
929578109 2:43065314-43065336 CACCATTGGTGTGCCTAGGGTGG + Intergenic
931665353 2:64606521-64606543 CACCCAAGGAGTGCCTTGTATGG + Intergenic
932476447 2:72009315-72009337 CAGTCTAGTAGTGGCTGGGGTGG - Intergenic
932577304 2:72969871-72969893 CACCCCAGGAATCCCTTGGGAGG - Intronic
935066930 2:99657341-99657363 CAGACTAGGAGTGCATGGAGAGG - Intronic
935326364 2:101941305-101941327 CACCCTAGCAGTACCTGGAGAGG - Intergenic
937391130 2:121487526-121487548 CAACCTAGAAGAGCCTAGGGAGG - Intronic
937477838 2:122230656-122230678 CAGGGAAGGAGTGCCTGGGGAGG - Intergenic
940130845 2:150379776-150379798 CCCCCTGTGAGTGCCTGGTGCGG - Intergenic
942183818 2:173405546-173405568 CACCCTAGGTGGCCCAGGGGAGG + Intergenic
944441639 2:199749233-199749255 CAGCCTAGGAGTTCCTGAGGGGG + Intergenic
948206490 2:236165180-236165202 CACCCTGGCAGTGCCCGGGACGG + Intergenic
948387216 2:237588442-237588464 CACAGTGAGAGTGCCTGGGGTGG + Intronic
948846921 2:240687663-240687685 CACCCTAGGCCTGCCCTGGGGGG + Intergenic
1172990709 20:39034416-39034438 CCCCCTAGGGGTGCATAGGGTGG + Intronic
1173007604 20:39152069-39152091 CATCTTTGGAGGGCCTGGGGGGG + Intergenic
1173980464 20:47220119-47220141 ATCCTTAGGGGTGCCTGGGGTGG - Intronic
1174600211 20:51718358-51718380 CACCCTATGTGTGTGTGGGGGGG + Intronic
1175264031 20:57691889-57691911 AACCCTGGGTGTGCCTGGGACGG + Intronic
1175335394 20:58192825-58192847 CCCGCTAGAAATGCCTGGGGTGG + Intergenic
1175684104 20:61014635-61014657 TGCCCTAGGAGTACTTGGGGTGG + Intergenic
1175765026 20:61586474-61586496 CAGCCAGGGAGTGCCTGAGGGGG + Intronic
1175939205 20:62530224-62530246 CACCCTAGGACAGCCTGCAGAGG - Intergenic
1176199549 20:63854280-63854302 CACTCCAGGTGTGCCTGGGCTGG - Intergenic
1176443355 21:6798591-6798613 CAAGCTAGGGGTGCCAGGGGAGG - Intergenic
1176821523 21:13663638-13663660 CAAGCTAGGGGTGCCAGGGGAGG - Intergenic
1178056005 21:28799076-28799098 CTCCCTAGGATTGCCAGGGCTGG + Intergenic
1178060469 21:28848861-28848883 CACACTGGCAGTGACTGGGGTGG - Intergenic
1178983739 21:37285768-37285790 CACCCTAGGAAGGCCAGGGCTGG - Intergenic
1180876137 22:19176085-19176107 CACTCTGGCGGTGCCTGGGGCGG + Exonic
1181104976 22:20568782-20568804 CACCCCTGGAGTCCTTGGGGTGG + Intronic
1181311903 22:21949473-21949495 AGCCCTGGGAGTGCCTGGAGGGG + Intronic
1182345249 22:29658639-29658661 TACTCTACTAGTGCCTGGGGTGG - Intronic
1183213204 22:36463730-36463752 CACCGTGGAAGGGCCTGGGGGGG + Intergenic
1183540714 22:38427844-38427866 CAGCCCAGGGGTGCCTGCGGCGG - Exonic
1184233613 22:43171461-43171483 CACCCTGTGAGTGCCAGGGCAGG - Intronic
1184642672 22:45880635-45880657 CACCCCATGAGTTCCGGGGGGGG + Intergenic
954155797 3:48684449-48684471 CCATCTAGGAGTGCCAGGGGTGG - Intronic
954304018 3:49716161-49716183 CACCCTACGGCTGCCTGGTGAGG + Exonic
956024562 3:64969287-64969309 CATCCTAGGAGTGAATTGGGGGG - Intergenic
960938948 3:122921228-122921250 CAGCCTGGGAGAGCCTCGGGTGG + Intronic
961473400 3:127132468-127132490 CACCCTATGTCTCCCTGGGGGGG - Intergenic
968910138 4:3473335-3473357 CACCCTTGGCGTCCCCGGGGAGG - Intronic
969664286 4:8548170-8548192 CACCCTGGGGCTGTCTGGGGTGG + Intergenic
969697226 4:8741650-8741672 CAGCCAAGGAGTGCCAAGGGTGG + Intergenic
978189919 4:105898870-105898892 CACCCTTAGAGTGCTTGGGGCGG + Intronic
987011807 5:13773975-13773997 GACCTCAGGAGAGCCTGGGGAGG + Intronic
987428673 5:17804332-17804354 CATCCTAGCAGGGACTGGGGAGG + Intergenic
993484655 5:88468092-88468114 CAGCTAAAGAGTGCCTGGGGTGG - Intergenic
993955627 5:94228950-94228972 CATCCTTGGAGTGGCTGGGTGGG - Intronic
998387552 5:141766525-141766547 CACCCTGGGAGGGCCTGAGATGG - Intergenic
1001092812 5:168753847-168753869 AACCTTGTGAGTGCCTGGGGTGG - Exonic
1002649170 5:180679286-180679308 TGCCCTTGGAGAGCCTGGGGTGG - Intergenic
1002668475 5:180845666-180845688 TACCCAAGGAGTTCCTGGGCTGG - Intergenic
1004140022 6:13009814-13009836 CAGACTAGGAGTTCATGGGGTGG - Intronic
1006132440 6:31877609-31877631 AACCCCAGCAGGGCCTGGGGAGG + Intronic
1006375943 6:33671642-33671664 CAGCCTGGGAGTGTCTGGGAGGG - Intronic
1007817452 6:44534630-44534652 CACCCTTTGGGTCCCTGGGGAGG + Intergenic
1014023517 6:116617731-116617753 CACCCTAGCACTGCCTGGGTTGG - Intronic
1016671246 6:146711375-146711397 CAGCAAAGGAGTGCATGGGGTGG - Intronic
1017946327 6:159099165-159099187 CACCCTGGGAGTGGGTGGCGAGG + Intergenic
1018111910 6:160544566-160544588 CATCCTGAGATTGCCTGGGGAGG - Intronic
1018724750 6:166603361-166603383 CAGCCTCAGAGTGCGTGGGGTGG + Intronic
1018924647 6:168197802-168197824 CACCCGAGCAGGGCCTGTGGGGG + Intergenic
1019176258 6:170160798-170160820 CACCCTTGGGGTGCATGGGCAGG + Intergenic
1019471031 7:1221118-1221140 CCCCCGAGGGGTCCCTGGGGAGG - Intergenic
1019799537 7:3077929-3077951 CACCCCAGGAGAAACTGGGGAGG - Intergenic
1019859004 7:3639336-3639358 GACCCTAAGAGGCCCTGGGGAGG + Intronic
1021808421 7:24379197-24379219 CCCCCTAGGTGTTACTGGGGTGG + Intergenic
1022471363 7:30683471-30683493 CACCCTCAGAGTGCCCAGGGCGG + Intronic
1024776937 7:52798643-52798665 CACACAGGGAGTGCTTGGGGTGG + Intergenic
1025142350 7:56476724-56476746 TACTCTAGGAGTTTCTGGGGAGG - Intergenic
1034265212 7:149777422-149777444 CCACATGGGAGTGCCTGGGGAGG - Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1041967035 8:63690061-63690083 CATCCTAAGGGTGACTGGGGGGG + Intergenic
1042229518 8:66542085-66542107 CACCCTGGGCGCTCCTGGGGCGG + Intergenic
1042850421 8:73211080-73211102 AACCCTAGGAGTCCCTGGGCTGG - Intergenic
1042963599 8:74328342-74328364 CACCCAAAGAGTGGCTGTGGAGG + Intronic
1043388056 8:79767669-79767691 CTCCCTGGGGGTTCCTGGGGAGG + Exonic
1044605323 8:94042887-94042909 GACCCCAGGAGTGGCTTGGGGGG - Intergenic
1044837861 8:96313614-96313636 CTTCCTGGGAGTGCATGGGGTGG + Intronic
1049466259 8:142752478-142752500 CACCCCAGGCTTGCCTGGCGGGG + Exonic
1049646349 8:143737559-143737581 CAACCTAGGGATGCCTGTGGAGG - Intergenic
1050491691 9:6195333-6195355 ATCCCTAGGAGCGACTGGGGAGG + Intergenic
1051416366 9:16845118-16845140 CATCCTGGCAGTGCCTGGGAAGG - Intronic
1053035824 9:34826146-34826168 GACCCTGGGAGAGCATGGGGAGG - Intergenic
1056470138 9:86897590-86897612 CAACCTAGGCTTGCCTGGTGTGG - Intergenic
1056835307 9:89950308-89950330 CTCACTAAGAGTGTCTGGGGAGG - Intergenic
1058705870 9:107637621-107637643 CGCCCTAGCACTGCCTGCGGTGG + Intergenic
1059434162 9:114266421-114266443 GACCCTCGGTGTGGCTGGGGCGG + Intronic
1061162491 9:128903199-128903221 GACCCTAGGAGGGCCTGCAGGGG + Intronic
1061422454 9:130479708-130479730 CACCCTAGGGGTCCCTGTGAAGG + Exonic
1062625118 9:137438987-137439009 CACCCTAGGAGTGCCTGGGGTGG - Intronic
1203525846 Un_GL000213v1:85936-85958 CAAGCTAGGGGTGCCAGGGGAGG + Intergenic
1185744128 X:2557996-2558018 CAACCTAGGGGTCCCTGGGTTGG + Intergenic
1186534184 X:10329939-10329961 CACCCTGGGAGTAGCTGGTGTGG - Intergenic
1188369023 X:29346365-29346387 CAGTGTAGGAGTGCCTGTGGAGG + Intronic
1195108649 X:101623909-101623931 GACCCTAGGAGGGACGGGGGTGG + Intronic
1198394412 X:136207702-136207724 CACCTCTGGAGGGCCTGGGGAGG + Intronic
1198618414 X:138481946-138481968 AGCCCTAGGAGTTCCTGGGCAGG + Intergenic
1200080459 X:153573638-153573660 CACACTCGGAGTGCCTGATGGGG - Intronic