ID: 1062631970

View in Genome Browser
Species Human (GRCh38)
Location 9:137467126-137467148
Sequence GAGAAGGCACAGATGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 399}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062631970_1062631981 23 Left 1062631970 9:137467126-137467148 CCAACCTGCATCTGTGCCTTCTC 0: 1
1: 0
2: 5
3: 58
4: 399
Right 1062631981 9:137467172-137467194 GCTGCACTGGGAGGCTTCAGGGG 0: 1
1: 0
2: 0
3: 17
4: 234
1062631970_1062631976 11 Left 1062631970 9:137467126-137467148 CCAACCTGCATCTGTGCCTTCTC 0: 1
1: 0
2: 5
3: 58
4: 399
Right 1062631976 9:137467160-137467182 TTTGCCTCACAAGCTGCACTGGG 0: 1
1: 0
2: 0
3: 17
4: 172
1062631970_1062631980 22 Left 1062631970 9:137467126-137467148 CCAACCTGCATCTGTGCCTTCTC 0: 1
1: 0
2: 5
3: 58
4: 399
Right 1062631980 9:137467171-137467193 AGCTGCACTGGGAGGCTTCAGGG 0: 1
1: 0
2: 0
3: 16
4: 211
1062631970_1062631977 14 Left 1062631970 9:137467126-137467148 CCAACCTGCATCTGTGCCTTCTC 0: 1
1: 0
2: 5
3: 58
4: 399
Right 1062631977 9:137467163-137467185 GCCTCACAAGCTGCACTGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 149
1062631970_1062631979 21 Left 1062631970 9:137467126-137467148 CCAACCTGCATCTGTGCCTTCTC 0: 1
1: 0
2: 5
3: 58
4: 399
Right 1062631979 9:137467170-137467192 AAGCTGCACTGGGAGGCTTCAGG 0: 1
1: 0
2: 1
3: 32
4: 419
1062631970_1062631982 24 Left 1062631970 9:137467126-137467148 CCAACCTGCATCTGTGCCTTCTC 0: 1
1: 0
2: 5
3: 58
4: 399
Right 1062631982 9:137467173-137467195 CTGCACTGGGAGGCTTCAGGGGG 0: 1
1: 0
2: 0
3: 20
4: 275
1062631970_1062631975 10 Left 1062631970 9:137467126-137467148 CCAACCTGCATCTGTGCCTTCTC 0: 1
1: 0
2: 5
3: 58
4: 399
Right 1062631975 9:137467159-137467181 CTTTGCCTCACAAGCTGCACTGG 0: 1
1: 0
2: 0
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062631970 Original CRISPR GAGAAGGCACAGATGCAGGT TGG (reversed) Intronic
900384413 1:2403076-2403098 GAGAAGGTACAGAGGCAAGGAGG + Exonic
900645214 1:3705930-3705952 GAGAAGGCTGAGGTGCAGGAAGG + Intronic
900833805 1:4984844-4984866 CAGAACTCACAGATGCAGCTTGG - Intergenic
900928599 1:5721417-5721439 GGCAAGGCACAGATGCAGATTGG - Intergenic
901240220 1:7688578-7688600 GAGAAGACACAAGTGCTGGTTGG + Intronic
901414135 1:9105369-9105391 GCCAAGGCACAGCTGCAGGGAGG - Intronic
901525177 1:9816979-9817001 GAGAAAGTACAGATCAAGGTAGG + Intronic
901567720 1:10132465-10132487 AAGAAAGCACAGATGCAGGTAGG + Exonic
901659379 1:10789053-10789075 GAGAAGGCCCAGGTGGGGGTAGG - Intronic
901819092 1:11814709-11814731 GAAGAGGCACAGATTCAGCTTGG - Intronic
902603457 1:17555768-17555790 AAGCAAGAACAGATGCAGGTGGG - Intronic
902916492 1:19643221-19643243 TAGGAGGCGCAGATGCAGGCTGG + Exonic
903062495 1:20679513-20679535 GAGAAGGCAGAGAGGCAGGCAGG + Intronic
903183271 1:21615763-21615785 GACAAGTGACAGATGAAGGTAGG - Intronic
904038513 1:27571367-27571389 GACCAGGCACAGAGGCAGGCTGG + Intronic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
905319450 1:37105569-37105591 GAGTGGGCACAGATGCAAGGAGG + Intergenic
905357492 1:37394944-37394966 GAGAAAGCACAGAAGCAGCAAGG + Intergenic
905528427 1:38656945-38656967 GAGAAGGAGCAGATGCTGGCAGG + Intergenic
906056875 1:42924583-42924605 GCGACGGCACAGCTGCCGGTCGG - Intergenic
907850047 1:58247749-58247771 GAGAAGGGAGAGATGCAGGAAGG - Intronic
907886639 1:58598151-58598173 CAGAAGCCACAGAAGCAGGGAGG - Intergenic
909222101 1:72978434-72978456 GAGAAAGCACAGTTGCAGATTGG + Intergenic
909669636 1:78173605-78173627 TAGAAGGCACAGAGGCAGAATGG - Intergenic
909770265 1:79413563-79413585 GAGAAGACACAGAGACAGATAGG - Intergenic
911234890 1:95401850-95401872 GGGAAGACACAGATGGAGATGGG - Intergenic
911943340 1:104074247-104074269 AAGAAGGAACAGATGTGGGTGGG - Intergenic
912309971 1:108610341-108610363 ATGTGGGCACAGATGCAGGTAGG + Intronic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
912822450 1:112878886-112878908 GAGAAGGCTGAGAAGCAGGAAGG - Intergenic
912876693 1:113366913-113366935 GGGTAGGCACAGATGTAGGTGGG + Intergenic
912963985 1:114221162-114221184 TTACAGGCACAGATGCAGGTAGG - Intergenic
913699728 1:121362641-121362663 GAGATGGCCCAGAGGCAGGAGGG + Intronic
914926537 1:151893613-151893635 CATCAGGCACAGATGCAGGGGGG + Intronic
915113088 1:153577143-153577165 GAGAAGGCAAACAGGCAGGTAGG + Intergenic
915361663 1:155289633-155289655 GAGAAGGCAGAGGTGCTGGCTGG - Exonic
915658335 1:157380402-157380424 GGGAAGGCTCTTATGCAGGTGGG + Intergenic
916146093 1:161740743-161740765 TAGCAGGCCCAGATGCAGCTTGG + Intergenic
916755055 1:167761465-167761487 GAATGGGCACAGATGCAGGGAGG + Intronic
918870098 1:189960677-189960699 CAAAAGCCATAGATGCAGGTAGG - Intergenic
919852979 1:201686212-201686234 GAGGAGGGGCAGATGCAGTTGGG - Intronic
920585715 1:207158051-207158073 GAGAAAGCACATAGGCAAGTAGG + Intergenic
922014410 1:221630506-221630528 GAGGAGGGACAGAAGCAGGGAGG + Intergenic
922438130 1:225626490-225626512 TAGAAGGCACAAAGGCAGGAGGG - Intronic
923115753 1:230936028-230936050 GAGAAAGGGCAGCTGCAGGTGGG + Intronic
923208075 1:231777687-231777709 GAGAGGGCACACCTGCAGGGAGG - Intronic
923344889 1:233042207-233042229 AATATGGCACAGATGCAGGTAGG - Intronic
923666514 1:236003018-236003040 CAGGAAGCAGAGATGCAGGTGGG - Intronic
923666806 1:236005212-236005234 GAGAAGGCCCAGATATAGGCGGG + Intronic
924759678 1:246972124-246972146 GAGAAAGCACTGTAGCAGGTCGG + Intronic
1063239041 10:4149456-4149478 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239045 10:4149482-4149504 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239049 10:4149508-4149530 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239053 10:4149534-4149556 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239057 10:4149560-4149582 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1067342941 10:45419212-45419234 GTGAAGGCGCAGAGGCAGGGAGG + Intronic
1067461982 10:46465085-46465107 GCAAAGGCACAGAGGCAGGAAGG + Intronic
1067625213 10:47919513-47919535 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1070742323 10:78911222-78911244 GAGAAGGTAGAGAGACAGGTTGG - Intergenic
1070750208 10:78959642-78959664 GAGAAGGCTCTGATGGTGGTGGG + Intergenic
1070827510 10:79399737-79399759 GAGAAGGCAGCGCTGCAGGGCGG + Intronic
1071085584 10:81865219-81865241 CAGAAGGTACAGGTGCAGTTCGG + Intergenic
1071241481 10:83710707-83710729 GTGATGTCACAGATGCAGGTGGG + Intergenic
1071283949 10:84127031-84127053 GAAAGGGCAGAGATGCAGGTAGG - Intergenic
1071321752 10:84466952-84466974 GAGGAGGAAGAGATGCAGTTAGG - Intronic
1073120955 10:101122340-101122362 GAGAAGGCAAAGTTGCCCGTGGG + Intronic
1073190843 10:101649788-101649810 CGGAAGGCAGAGATGCAGGCTGG - Intronic
1074532224 10:114305549-114305571 GAGGGGACACAGATGCAGGAGGG + Intronic
1075626731 10:123969318-123969340 GAGGAGACACACATGCAGGCAGG - Intergenic
1075883152 10:125872200-125872222 GAGAAGACAAAGATGCAACTGGG - Intronic
1076890174 10:133279451-133279473 GAGCAAGCAAAGATGCATGTGGG - Exonic
1077052744 11:575144-575166 GAGCAGCGACAGATGGAGGTCGG - Intergenic
1077396571 11:2326660-2326682 GTGCAGCAACAGATGCAGGTGGG - Intergenic
1077551438 11:3202270-3202292 GGGAAGGGGCAGGTGCAGGTGGG - Intergenic
1079102853 11:17552374-17552396 AAGAAGCCACAGAACCAGGTGGG - Intronic
1079394670 11:20051346-20051368 CAGATGGCACAGATGCAAGGAGG - Intronic
1079768664 11:24429528-24429550 GAGAAAACAGAAATGCAGGTAGG - Intergenic
1080335093 11:31186464-31186486 GGCAAGGCACAGAGGTAGGTAGG - Intronic
1081710982 11:45215197-45215219 GAGAAGCCTCAGATCTAGGTGGG - Intronic
1081867830 11:46369311-46369333 GAGGAGGCAGAGAGGCAGGAGGG + Intronic
1082125625 11:48428414-48428436 GAGAAGTCACAGATGAAACTTGG - Intergenic
1082250798 11:49977796-49977818 GAGAAGTCACAGATGAAACTTGG + Intergenic
1082559240 11:54599444-54599466 GAGAAGTCACAGATGAAACTTGG - Intergenic
1082718965 11:56649854-56649876 GAGAATGCACAGACACAGGGAGG + Intergenic
1082953952 11:58848753-58848775 GAGAAGGTAGAGATGGAGATGGG + Intronic
1083105385 11:60353189-60353211 GAGAAGTGACAGATTCAGTTGGG - Intronic
1083857173 11:65398949-65398971 GAGAAGGCAAGGCTGCAGGAGGG + Intronic
1083986478 11:66219114-66219136 GAGAAAGACCAGAAGCAGGTGGG + Intronic
1084219467 11:67668280-67668302 GGGTGGGCACAGGTGCAGGTGGG + Intronic
1084656049 11:70519272-70519294 GAGAAGGCCCAGATACGGGCCGG + Intronic
1084779023 11:71396712-71396734 GGGAAGCCACAGAGGCAGGCTGG + Intergenic
1084881217 11:72172908-72172930 GAGAGGGCGCAGGTGCAAGTGGG + Intergenic
1085187960 11:74592477-74592499 GAGACGGCGCAGACGGAGGTAGG - Intronic
1085687657 11:78638841-78638863 GTGGAGGGACAGGTGCAGGTGGG + Intergenic
1088747997 11:112820575-112820597 GAGAAGCAGCAGATGCAGGAAGG + Intergenic
1090540143 11:127692926-127692948 GAGAAGACACTGATGCAATTCGG - Intergenic
1093898833 12:24606751-24606773 GAGCTGGCACAGATGAGGGTGGG + Intergenic
1096575980 12:52553090-52553112 GACAAAGCTCAGATGCAGGAGGG + Exonic
1097172454 12:57124730-57124752 GAGAAGGCACTGAGGCAGAGAGG + Intronic
1098197464 12:68017131-68017153 CAGAAGGAACAGCAGCAGGTAGG + Intergenic
1099037618 12:77609017-77609039 TAGAAGGCAGAGAATCAGGTAGG - Intergenic
1099320905 12:81147463-81147485 GAGAAGGCACAGCACTAGGTGGG + Intronic
1100021038 12:90069936-90069958 GAGAAGGCACAGAACCAACTTGG - Intergenic
1100176063 12:92032192-92032214 ATGAAGGCACAGAAGCTGGTTGG + Intronic
1100724418 12:97393907-97393929 GAGAAGGCCCAGATTCAGTTGGG + Intergenic
1101033402 12:100681519-100681541 GACAAGGCACAGAAGCGGGTAGG - Intergenic
1101926195 12:108973259-108973281 GGGAGGGCACAGATTCAGTTTGG + Intronic
1103418486 12:120760870-120760892 GAGAAGGCTGAGAAGCAAGTTGG - Intergenic
1104280482 12:127372161-127372183 GAGAGGGGCCAGATGCAGCTGGG - Intergenic
1105562301 13:21505329-21505351 CAGAAGGCACTGATGCAGGGCGG + Intronic
1105634376 13:22203227-22203249 GAGTAGGCTCAGGTACAGGTGGG - Intergenic
1107052763 13:36069657-36069679 GTGAAGGCAAGGATCCAGGTGGG - Intronic
1107128522 13:36870425-36870447 GTGAAGGCAGAGATGCTGGAGGG - Intronic
1107553686 13:41499353-41499375 GAGAAGGCACAGAACCAGCTTGG - Intergenic
1109474034 13:62854816-62854838 AAGAAGGTACAGATACATGTGGG + Intergenic
1109641071 13:65192377-65192399 GAGAACGCACAGACACAGGAAGG + Intergenic
1110184448 13:72656867-72656889 GAAAAGGTACAGCTGTAGGTGGG + Intergenic
1110193732 13:72761654-72761676 GAAAAGCCACTGATGCACGTTGG + Exonic
1110704874 13:78594050-78594072 GAGAAGGGAAAGATGGAGGTAGG + Intergenic
1111162101 13:84408082-84408104 AAGAAGCCACTGATGCAGGTGGG + Intergenic
1113394476 13:109933775-109933797 GGGATGGCAGAGATGCAGGATGG + Intergenic
1115631680 14:35251920-35251942 GGGGAGGCACAGGTGCAGGCGGG + Intronic
1118723268 14:68609049-68609071 GAGAAGGAACAGGTGAAGGGAGG - Intronic
1118865710 14:69702011-69702033 GTGAGGGCACAGCTGCAGGGTGG + Intronic
1119261544 14:73240859-73240881 TAGAAGCCACAGAGGCAGCTGGG + Intronic
1119948578 14:78720623-78720645 GAGAGTGGACAGATGCAGGATGG - Intronic
1120943743 14:89974447-89974469 CAGAATGCACAGATGCATGCTGG + Intronic
1121742851 14:96266255-96266277 AAGTAGGCCCAGAGGCAGGTGGG + Intronic
1123011269 14:105350658-105350680 GAGAAGGCTGAGGGGCAGGTGGG - Intronic
1124913577 15:33946826-33946848 GAGAAGTCACAGATGTAGTGCGG + Intronic
1127302307 15:57666789-57666811 CAGAGGGCACATGTGCAGGTTGG - Intronic
1127964934 15:63916379-63916401 GAGATGGCACAGATGGGGGTTGG - Intronic
1128082890 15:64866775-64866797 GAGGAGGCACAGAAGTTGGTGGG - Exonic
1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG + Intergenic
1131133648 15:89916195-89916217 GAGTTGGCACAGAGGGAGGTAGG - Intergenic
1131282522 15:91033009-91033031 GAGAAGGCACAGAGGTTGGCAGG + Intergenic
1132432351 15:101772194-101772216 GACAAGGAAGAGATGAAGGTAGG - Intergenic
1132476613 16:142382-142404 GAGATGGGACAGATGGGGGTGGG + Intergenic
1132502751 16:291860-291882 GTGAAGGCCCAGAGGCAGGTTGG - Intronic
1132677820 16:1127863-1127885 GAGAAGGCACAGGTGCGTGTGGG + Intergenic
1133033698 16:3023369-3023391 GAGATGGCAGAGAGGCAGGCTGG + Intronic
1133859097 16:9577098-9577120 GAGAACACACAGATGCAGAGAGG - Intergenic
1134255053 16:12603583-12603605 GAGAAGGCACTGAGGCAGGAAGG + Intergenic
1135814709 16:25621961-25621983 GCAAAGGCCCAGATGCAGGAAGG - Intergenic
1136010569 16:27360883-27360905 GAGAAGGCAGACATGGAGCTAGG - Intronic
1136136427 16:28259243-28259265 GAGAAGGCACAGGTGGCGGGCGG + Intergenic
1138472869 16:57252076-57252098 GGGAAGGCAGAGCTGAAGGTGGG - Intronic
1138947763 16:61872874-61872896 CAGAAGGCACAGAAGCAAGAAGG + Intronic
1139941432 16:70608580-70608602 GAGGAGGCACAGATCAAGGGTGG + Intronic
1140049050 16:71463303-71463325 AAGAAGCCACAGAGGCAAGTGGG - Intronic
1140201220 16:72896363-72896385 GGGAAGGCACAGAGACAGATGGG - Intronic
1140468134 16:75198340-75198362 GATTAGGTACAGATGCAGGCTGG + Intergenic
1141280017 16:82622940-82622962 CAAAGGGCACAGATGCAGGTTGG + Intergenic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142577886 17:921470-921492 GACAAGCCACAGATGCAGAGGGG - Intronic
1142946992 17:3438051-3438073 GAGAAGTCACAGAAGCAAGCAGG + Intergenic
1143171204 17:4931670-4931692 GAGAAGGCAGAGAGAAAGGTGGG + Intergenic
1143284962 17:5782019-5782041 GTGCAGGCACAGATGCAAGTGGG + Intronic
1143545311 17:7591802-7591824 GAGAAGGGAGGGGTGCAGGTTGG + Exonic
1143590321 17:7882232-7882254 GAGAGGGCACAGAGGCAGAGAGG + Intronic
1144235206 17:13254042-13254064 GAGAAGGGGCGGATGCAGGTAGG + Intergenic
1144586184 17:16489299-16489321 GAGCAGGCACAGAACCAGGGAGG - Intronic
1144661415 17:17073249-17073271 CAGAGGGGACTGATGCAGGTGGG - Intronic
1145722661 17:27088352-27088374 GAGAAGGAAGAGAGGGAGGTAGG - Intergenic
1147599658 17:41738068-41738090 GAGAAGACAGAGATGAAGTTAGG + Intergenic
1148441373 17:47713346-47713368 GAGACGGCTCAGGTGCAGGGCGG + Intergenic
1149136172 17:53367275-53367297 GAGATGGAACAGATGCAGAGAGG + Intergenic
1150387349 17:64772801-64772823 GAGAAGGCAAGGAGGCAGGGTGG + Intergenic
1151165517 17:72199815-72199837 TAGAAGGCACTCATGCTGGTTGG + Intergenic
1151235528 17:72717277-72717299 GAGAAGACGCCGATGGAGGTAGG + Intronic
1151589272 17:75032793-75032815 GAGAAGGCATCCCTGCAGGTTGG + Intronic
1151750896 17:76037004-76037026 GAGAAGGAAAAGGTGCAGTTGGG + Intergenic
1152018893 17:77770326-77770348 GAGAAGGGACAGAGGGAGGGAGG - Intergenic
1152181365 17:78823690-78823712 GAGAAGGCAAAGAGGCAGGCAGG + Intronic
1152900462 17:82938093-82938115 GAGCAGACACAGCTGCAGGAGGG - Exonic
1153671263 18:7414713-7414735 GAGAAGCCAGAGAAGCGGGTGGG + Intergenic
1153839313 18:8991666-8991688 CAGAAGGCACAGTTCCAGGGTGG - Intergenic
1154291805 18:13115287-13115309 GAGAAGTGACAGAGGCAGCTTGG + Intronic
1155337345 18:24778063-24778085 GAGAAGACCCTGATGAAGGTGGG - Intergenic
1155373898 18:25135362-25135384 GAGAAGGAAAACAAGCAGGTTGG - Intronic
1155791119 18:29971837-29971859 AAGAAGACACAGAGGCAGGCTGG - Intergenic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156228984 18:35135841-35135863 GAGATGGCACAGATGCCTGGTGG + Intronic
1157110341 18:44814681-44814703 GAGAAGAGATAGATGCAGGCTGG + Intronic
1157562446 18:48658055-48658077 GAGAAGTCAGAGAAGCAGGAAGG - Intronic
1158958535 18:62566483-62566505 GAGAAGGAACAGAGACAGGGAGG - Intronic
1161384391 19:3983283-3983305 GAGATGGCACTGATGGAGGGAGG + Exonic
1161778937 19:6279072-6279094 GAGAAGGCTCAGGTCCAGGTAGG + Intronic
1163005684 19:14395555-14395577 GAGAGGGCACAGGTGCCGATGGG - Intronic
1164245216 19:23422268-23422290 GAGAAGGAGCACAGGCAGGTGGG - Intergenic
1164308848 19:24029276-24029298 GAGAAGGAGCACAGGCAGGTGGG + Intergenic
1166691809 19:44826201-44826223 GAGAAGGAAGAGAGGCAGGGAGG + Intergenic
1166777561 19:45322189-45322211 GAGAGGGCACTGAGGCAGGGTGG + Intronic
1168106933 19:54171518-54171540 GAGGAGGCAAAGATGAAGGAAGG + Intronic
925907698 2:8549033-8549055 GAGCAGGCACAGCTGCAGGGAGG + Intergenic
926006102 2:9374505-9374527 GACAAGGCAGAGAGGCGGGTGGG + Intronic
926188035 2:10707010-10707032 GAGTGGGCACGGATGCAGGGAGG + Intergenic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
926686199 2:15699606-15699628 GAGAAGGCACGGACACAGGGAGG - Intronic
927305100 2:21562240-21562262 GAGAAGCCAGAGATGGAGGAAGG + Intergenic
927523447 2:23716837-23716859 GTGAGGGCACAGTTGGAGGTGGG - Intergenic
928378920 2:30801787-30801809 GAGATGGCCCAGACGCAGGGAGG + Intronic
929214599 2:39398490-39398512 GAGAAGGGACAGATGGGGATGGG + Intronic
929396633 2:41531239-41531261 GAGAAAGCACACAAGGAGGTTGG + Intergenic
930111150 2:47679838-47679860 GTCATGGCACTGATGCAGGTAGG + Intergenic
930153205 2:48078867-48078889 GAAAAGGCACAGAGACAGGCCGG - Intergenic
931052011 2:58426440-58426462 GAGAAGGTACATATCAAGGTGGG + Intergenic
931258864 2:60599328-60599350 GAGAGGGCCCAGGTGCAGGCAGG + Intergenic
932692071 2:73921577-73921599 GAGAAGGCACAGGAGGAGGCGGG + Intergenic
932916607 2:75865900-75865922 GAGGAGGCAAAGGTGGAGGTGGG - Intergenic
932956198 2:76353715-76353737 GAGAAGGTGAAGATGCAGGTAGG + Intergenic
934768923 2:96895718-96895740 TAGATGGCACAGAAGCAGGGTGG + Intronic
935085784 2:99843362-99843384 GAGGAGGCTCAGAGGCAGCTGGG - Intronic
935091802 2:99901736-99901758 GAGAAAGAGCAGATGCAGGGAGG - Intronic
935765071 2:106359008-106359030 GAGAAGGGCCAGAGGCAGGAGGG - Intergenic
936505570 2:113102956-113102978 GACAAGGCACAGAAGGAGCTGGG + Intergenic
937816867 2:126260353-126260375 GAGAGGAGCCAGATGCAGGTCGG + Intergenic
939999414 2:148951835-148951857 GAGAAAGGACAGATGGGGGTGGG + Intronic
940044938 2:149400004-149400026 GACAACCCACAGATGCAGGGTGG + Intronic
940853239 2:158707784-158707806 TAGAAGTCACAGATTCAGGATGG - Intergenic
941658542 2:168170658-168170680 AAGAAGGCAGAGAGGAAGGTTGG + Intronic
943566059 2:189518059-189518081 GAGAAGGCAAAGATAAAGTTAGG - Intergenic
944309598 2:198218659-198218681 GAGAAGGCACTGAAGCATGAAGG + Intronic
944359035 2:198829869-198829891 GAGAAGACATGGATGCAGGGAGG + Intergenic
944534474 2:200695761-200695783 GCAAAGGCACAGCTGCAGATGGG - Intergenic
944659250 2:201907207-201907229 GAGAAAGCACTGTTGCAGGCCGG + Intergenic
945039807 2:205734130-205734152 GAGAAGGTAGGGATGCCGGTAGG - Intronic
945703880 2:213204772-213204794 GAGAAAGCAAAGATACAGATTGG - Intergenic
945725818 2:213471247-213471269 GAGAAGGTACGGAGGCAGGAGGG + Intronic
946332459 2:219018132-219018154 GAGAATGAAAATATGCAGGTGGG - Intronic
946372713 2:219290422-219290444 GAGGAGGCGCAGAAGCAGGTGGG + Intronic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
947796326 2:232896316-232896338 GAGAAGGCACAGACAGAGATGGG + Intronic
947909008 2:233789637-233789659 GGGAAGGCACCGATGGAGCTTGG - Intronic
948770597 2:240249667-240249689 GAGAAGACACAGACGGAGGCAGG - Intergenic
948863058 2:240762203-240762225 GAGGTGGCCCACATGCAGGTGGG - Intronic
1168993123 20:2111850-2111872 GAGTGGGCACAGGAGCAGGTGGG - Intronic
1169087458 20:2836195-2836217 GAGGAGGCAAAGAAGAAGGTGGG + Exonic
1169484272 20:6013499-6013521 GAGAATGAATGGATGCAGGTAGG + Intronic
1169620020 20:7495477-7495499 GAGGGGGTACATATGCAGGTTGG - Intergenic
1170155506 20:13265571-13265593 GGGAAGGCACAGATGAATTTGGG - Intronic
1170348141 20:15409829-15409851 GAGAAGGCACTGATGTACATGGG + Intronic
1172436080 20:34929816-34929838 GAGAAGGAACAGCTGTAGGTAGG - Intronic
1172624388 20:36338895-36338917 GCAAAGGCACCGAGGCAGGTGGG + Intronic
1173262781 20:41451478-41451500 GAAAAGGCACAGACAGAGGTGGG + Intronic
1173375624 20:42480184-42480206 AATAAGGCACAGACACAGGTAGG - Intronic
1174090092 20:48039783-48039805 GAGAAGCCAGAGAGGCAGGGAGG + Intergenic
1174198726 20:48791994-48792016 CAGAAGGCACAGATTGGGGTTGG + Intronic
1176286650 21:5022341-5022363 GAGGCGGGACAGAGGCAGGTCGG - Intergenic
1177454747 21:21322301-21322323 GAGAAGGGAAAGAGGGAGGTGGG + Intronic
1178978429 21:37240779-37240801 GAGAAGGCCCAGGTCCTGGTAGG + Intronic
1179476352 21:41648668-41648690 GATAAGGCACAGCAGCAGGGTGG + Intergenic
1179570744 21:42277496-42277518 GAGCAGGGACAGATGCAGGTGGG + Intronic
1179642593 21:42757198-42757220 GAGACAGTACAGATGTAGGTTGG - Intronic
1179870531 21:44241134-44241156 GAGGCGGGACAGAGGCAGGTCGG + Intergenic
1180051878 21:45335266-45335288 GAGGGGGCACAGATCCAGGGAGG - Intergenic
1180051923 21:45335379-45335401 GAGGGGGCACAGATCCAGGGAGG - Intergenic
1180920183 22:19517607-19517629 GAGAAGGCCCAGGTCAAGGTGGG + Intronic
1181746194 22:24956488-24956510 GAGAAGCAACAGAGGAAGGTGGG + Intronic
1183508851 22:38223506-38223528 GGGAAGGCACAGAGGAAGGGGGG + Intronic
1184206455 22:43007042-43007064 GAGAAGTCAGGGATGCAGATGGG - Intronic
1184519868 22:44986933-44986955 GGGAAAGGGCAGATGCAGGTGGG + Intronic
949253388 3:2015265-2015287 AAGAAGGGAGAGATGCAGGCTGG + Intergenic
950618071 3:14178395-14178417 GAGGAGGCCCAGAGGCAGGGCGG - Exonic
950900145 3:16490298-16490320 AAGAAGGAACAAATCCAGGTGGG + Intronic
951864610 3:27294264-27294286 GTGCAGGCACAGCTGCAGGCTGG - Intronic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
952959097 3:38578687-38578709 GAGAAGGCACAAGTGCTGGACGG + Intronic
953083694 3:39646083-39646105 GATAAGGAAGAGATGGAGGTTGG - Intergenic
953360377 3:42290581-42290603 GAGAAAGGACAGATGCAGGCAGG - Intergenic
954452168 3:50577560-50577582 GAGAATGCTCAGAGGTAGGTGGG + Exonic
954900842 3:54018318-54018340 GAGAATGCATGGATGCATGTTGG + Intergenic
955058149 3:55474294-55474316 GAGAAGACAGAGATGCGGGGCGG + Intronic
955447485 3:59029537-59029559 GAGGAAGCAAAGAAGCAGGTTGG + Intronic
956168824 3:66416881-66416903 GACAAGGGACAGAGGCAGGAAGG - Intronic
958752865 3:98213288-98213310 GAGAATGCACACCTGCGGGTGGG + Intergenic
959765099 3:110016916-110016938 GTGTAGGTACAGATGCTGGTAGG - Intergenic
960812313 3:121636677-121636699 GAGAAGACAAAGATGGAAGTAGG + Intronic
961434372 3:126906463-126906485 CACGAGGCACAGATGCAGGGAGG - Intronic
962388075 3:134949037-134949059 GAGCAGGGAGAGATGCTGGTGGG + Intronic
962739527 3:138352877-138352899 GAGAAGTCACAGATGCAGCCTGG - Intronic
962878270 3:139552704-139552726 GAGAAGGAAGAAATGCAGGTAGG - Intergenic
963083699 3:141417569-141417591 AAGAAGGCAAAGAGACAGGTGGG - Intronic
963907328 3:150783365-150783387 GACCAGGTACAGATGCAGGGAGG + Intergenic
964696997 3:159520170-159520192 GAGAATGCAAAGACGGAGGTAGG + Intronic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
966983504 3:185159132-185159154 GAGAAGGCACTGAGGCAGGCAGG - Intergenic
967295699 3:187962707-187962729 ATGTGGGCACAGATGCAGGTGGG + Intergenic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
968062322 3:195735086-195735108 GAGATGGGGAAGATGCAGGTGGG - Intronic
969086871 4:4663139-4663161 GAAAAGTTCCAGATGCAGGTTGG - Intergenic
969124997 4:4940573-4940595 CAGGAGGCAGAGAGGCAGGTGGG + Intergenic
969157358 4:5223109-5223131 AAGAAGGCCCAGGTGCAGCTTGG + Intronic
969530056 4:7725564-7725586 TAGAAGTCACAGAGGCAGGTAGG + Intronic
969676391 4:8616647-8616669 GAGAAGGCTCAGATGCTGTCTGG + Intronic
974046539 4:56903444-56903466 GTTAGGGCACAGATGGAGGTAGG - Intergenic
974375479 4:61070859-61070881 GAGAAGGTAGAGATGAAGGAAGG + Intergenic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975611049 4:76203707-76203729 ATGAAGGAACAGATGCAGGCTGG + Intronic
976428674 4:84936811-84936833 GAAAGGGTACAGATTCAGGTGGG - Intronic
978330632 4:107609345-107609367 GAGATGGCACCCATGGAGGTGGG - Intronic
979577427 4:122310708-122310730 GAGAAGCAGCAGATGCAGGAAGG - Intronic
980999478 4:139814759-139814781 CACAAAGCTCAGATGCAGGTAGG - Intronic
981353359 4:143757960-143757982 GAGAACGCATGGATGCAGGGAGG + Intergenic
981766122 4:148252029-148252051 AAGAAGGAAGAGATGCAGTTGGG - Intronic
983963658 4:173784822-173784844 GAGAAGACATGGATGCAGGGAGG - Intergenic
984594975 4:181656520-181656542 GAGAAGCCGCGGATGCAGATGGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985513624 5:325652-325674 GAGCAGGGACAGATGCCGGTGGG - Intronic
986875134 5:12098094-12098116 GAGAAGGCATGGACGCAGGGAGG - Intergenic
987686642 5:21212890-21212912 GAGAAAGAAGAGATGAAGGTAGG + Intergenic
987750965 5:22038328-22038350 GAGAGGGCACAGCTGCAACTGGG - Intronic
988037920 5:25851855-25851877 GAGAAGACGCAGCTGCACGTGGG - Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
991548995 5:67816149-67816171 GAGAAGGCACAAAGGCCTGTGGG + Intergenic
992037814 5:72798301-72798323 GAAAAGGCAGAGATGCAGGGTGG + Intergenic
992184000 5:74225932-74225954 AAGAAGGCACAGAGGAAGGGAGG - Intergenic
992237054 5:74720721-74720743 GACAAGGCACCGCTGCAGGATGG + Exonic
993859573 5:93118794-93118816 GAGAAGGGACACATGGAGTTTGG + Intergenic
994056122 5:95417989-95418011 GTGAAACCACAGATGAAGGTGGG - Intronic
995153410 5:108879436-108879458 GAGAACACACAGATACAGGGAGG - Intronic
995556175 5:113331354-113331376 GAGAAGGAACAGCTGCTGGGAGG - Intronic
997051183 5:130382510-130382532 AAGAAGGATCAGATGCAGGAAGG + Intergenic
997264061 5:132484667-132484689 GAGGAGGCAGAAATGCATGTTGG + Intronic
997516105 5:134491064-134491086 TGGAGGGCACAGATGCGGGTGGG - Intergenic
997870397 5:137500956-137500978 GGGAGTGCAGAGATGCAGGTGGG - Intronic
998251233 5:140554461-140554483 AAGTGGCCACAGATGCAGGTGGG - Intronic
998371114 5:141661991-141662013 GGGAAGGCAGAGATCCTGGTTGG + Intronic
998794125 5:145799497-145799519 GAAAAGGCACACAGGCAAGTGGG + Intronic
999342772 5:150787171-150787193 GAGAAGGCAAAAATCCAGGGAGG - Intronic
999702205 5:154238505-154238527 GAGAAGGAGAAGATGCACGTGGG - Intronic
1000244648 5:159439315-159439337 GAGAAGGAATAGCAGCAGGTAGG + Intergenic
1000527149 5:162371452-162371474 GAGTTGGCACAGTTGGAGGTAGG + Intergenic
1001187638 5:169590808-169590830 GACAAGGCACAGAAGCAGTAAGG + Intronic
1001314476 5:170632681-170632703 GAGAAGGCACAGCAGGAGGCTGG - Intronic
1001530642 5:172459123-172459145 GACAAGGCACAGTGGCAGCTGGG - Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1003250601 6:4426473-4426495 GATAAGGCAGAGGTGCAGCTTGG - Intergenic
1003350058 6:5308242-5308264 GTGAAGTCACAGAAGCAGGAAGG + Intronic
1005200219 6:23336238-23336260 GGGAAGTCACAGATGAATGTGGG + Intergenic
1005367712 6:25095924-25095946 GGGGAGGCACAGATACAAGTTGG + Intergenic
1006168762 6:32081269-32081291 GAGAAGGCGAAGATGGAGGGAGG + Intronic
1006365032 6:33610269-33610291 GAAAAGGCCCAGAGGCAGGAAGG - Intergenic
1007194038 6:40044485-40044507 AAGAAACCACAGATGCTGGTTGG + Intergenic
1007254431 6:40518866-40518888 GAGCAGGCTCAGAAGCAAGTCGG + Intronic
1007726740 6:43921347-43921369 GAGAAGGCACAGAGGCGGGCAGG + Intergenic
1008141221 6:47834670-47834692 GAGAAGGGACAGAAGCGGTTAGG - Intergenic
1008666572 6:53722800-53722822 GACATGGCACAGATGCAGAGAGG + Intergenic
1009341639 6:62561943-62561965 GAGAAGGCAAGGGTGCAGGTGGG - Intergenic
1010551731 6:77231704-77231726 GAGAAGACCCTGATGCAGGAAGG + Intergenic
1010562398 6:77366919-77366941 AAGAAGTCACAGCTGAAGGTAGG + Intergenic
1010722550 6:79300274-79300296 GAGAAACAACAGATGCAGGAAGG - Intergenic
1010748245 6:79588527-79588549 GAGAAGCAGCAGATGCAGGAAGG - Intergenic
1011146204 6:84220022-84220044 GATAATGCACAGAGGCAGGGAGG + Intronic
1011383802 6:86771913-86771935 GGCAAGGCACAGATGCAGGCTGG + Intergenic
1012072581 6:94641477-94641499 GACAAGGCACAGAGTCAGATAGG + Intergenic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1012981135 6:105831234-105831256 GAGAAGGGACAGCTGGAGGAGGG + Intergenic
1013029085 6:106313072-106313094 GAGAAGGCAGAGGTGGAGGTGGG + Intronic
1013296414 6:108761809-108761831 GGGTAGGCACAGATGGAGGTGGG - Intergenic
1013647978 6:112163958-112163980 GTGTGGGCACAGATGCAGGCGGG + Intronic
1013727637 6:113119197-113119219 TCAAAGGTACAGATGCAGGTTGG - Intergenic
1014918532 6:127183814-127183836 GAGAATGCACTAATACAGGTGGG - Intronic
1015864306 6:137712132-137712154 GAGATGCCACAAATGCAGGAGGG + Intergenic
1016221126 6:141670934-141670956 TAAAAGGCACAGTTGCAAGTTGG + Intergenic
1016410780 6:143781260-143781282 GAGAAGGGCCAAATGCAGTTAGG - Intronic
1017602662 6:156100535-156100557 TCGAAGGCACAGAGGCAGGAAGG - Intergenic
1017798352 6:157868777-157868799 GAGAAGGAACAAAAGCAGATAGG + Intronic
1018302046 6:162413827-162413849 GAGAAAGCACAGACACAGGCAGG + Intronic
1018460805 6:163996725-163996747 GAGAAGGCACAGGCCCAAGTGGG - Intergenic
1018662978 6:166105432-166105454 GAGCAGACACAGGTGGAGGTAGG + Intergenic
1019180273 6:170182557-170182579 GAGAATCCACACCTGCAGGTGGG + Intergenic
1019213460 6:170424414-170424436 GAGAAGCCACAGCTGCTGGGTGG - Intergenic
1020643018 7:10779651-10779673 GAGAAGGCTCAGGTGAAGATGGG - Intergenic
1023845075 7:44115988-44116010 GAGAAGGAACAGATGCTAGGTGG + Intronic
1024665795 7:51545713-51545735 GAGAAGGCACACCTCCAGGGAGG + Intergenic
1026095572 7:67343760-67343782 GAGCAGGTGCAGATGCAGATCGG - Intergenic
1026844359 7:73689630-73689652 GCAGAGGCACAGATGCCGGTGGG + Intronic
1027234560 7:76290449-76290471 GAGAAGGCAATGAGGCAGGCTGG - Intergenic
1028340797 7:89717680-89717702 GAAAAGGGGCTGATGCAGGTAGG - Intergenic
1030413324 7:109210149-109210171 GAGAAACAACAGATGCTGGTGGG - Intergenic
1031162329 7:118183370-118183392 GAGAAAGGACCGATGCAGGAAGG - Intergenic
1032188976 7:129751967-129751989 GAGAGGGCCCAGCTGCACGTTGG + Intronic
1032538606 7:132685077-132685099 GAGAAGGCAAGGAGCCAGGTGGG - Intronic
1032554395 7:132816654-132816676 GAGGAGGCACAGCAGCAGCTGGG - Intronic
1033509729 7:142047905-142047927 CATAAGTCACAGGTGCAGGTTGG - Intronic
1033708050 7:143907395-143907417 GAGAAGACACTGGTGGAGGTAGG + Intergenic
1034410985 7:150942129-150942151 GAGCAGGAACAGAAGCAGGAGGG - Intergenic
1034658817 7:152751351-152751373 GAGCAGGCACAGATGCAGGGAGG - Intergenic
1034966252 7:155393005-155393027 GAACAGGAAGAGATGCAGGTTGG - Intronic
1035046262 7:155969276-155969298 CAGAAGGCACGGATGCAGGTGGG + Intergenic
1035053767 7:156020022-156020044 TAACAGGCACAGAGGCAGGTAGG + Intergenic
1035657635 8:1322773-1322795 GAGAAGGCCCTGATGCAGGGGGG - Intergenic
1036034422 8:5003743-5003765 CACAGGGCACAGAAGCAGGTTGG + Intergenic
1036756616 8:11475410-11475432 GAGAAGGCCCAGCTGGGGGTGGG - Intergenic
1037838987 8:22230910-22230932 GAGGTGGCACACATGCATGTTGG - Intronic
1038906806 8:31913606-31913628 GAGAAGACAAAGATGCAAATAGG + Intronic
1039770398 8:40680585-40680607 TAGAAGGCAGACAGGCAGGTAGG - Intronic
1041347986 8:56921067-56921089 GACAAGGCACAGATGAGGGTCGG + Intergenic
1041599823 8:59703844-59703866 GAGAAGTCACTGATGATGGTGGG - Intergenic
1041985431 8:63917129-63917151 GAGAAGTCACTGAGGCAGGAAGG - Intergenic
1042104956 8:65316284-65316306 GTGAAGGTACACATGCAGGCAGG + Intergenic
1043586833 8:81779629-81779651 GAGGAGGAGCAGATGTAGGTGGG + Intergenic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1045516670 8:102865824-102865846 GAGAAGGCACAGAAGTGGGTGGG + Intronic
1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG + Intergenic
1046707079 8:117466833-117466855 GAGAAAGCACAGAGGCAGTTGGG - Intergenic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1048236446 8:132695465-132695487 GAGTAGGAACAGATGCCCGTAGG + Intronic
1049645684 8:143734638-143734660 GAGAAATCTCATATGCAGGTGGG - Intergenic
1049785288 8:144447902-144447924 GAGAAGACAAAGGAGCAGGTCGG + Intergenic
1049819185 8:144624173-144624195 TGGCAGGCACAGGTGCAGGTGGG - Intergenic
1051457869 9:17281487-17281509 GAGAACACACGGATACAGGTAGG - Intronic
1052764290 9:32625173-32625195 GAGAGGGTACAGATGCTGGCAGG - Intergenic
1052866887 9:33469424-33469446 GAGAAGGCACAGAGGCACGGAGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053364389 9:37512331-37512353 GAGAAGGGATAGAAGCTGGTGGG - Exonic
1053414432 9:37938141-37938163 GAGGCTGCACAGATGCAGGTAGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054869943 9:70039949-70039971 GAAAAGGCACAGACACATGTAGG - Intergenic
1055030100 9:71765629-71765651 GAGAAGGAACAGTTGGGGGTGGG - Intronic
1056407364 9:86287469-86287491 TAAAAGGCACAGATGGGGGTGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056856342 9:90132811-90132833 TAGCAGGCACTGATGCAGATAGG - Intergenic
1057001490 9:91513907-91513929 GGGAAGGGACAGATTGAGGTGGG + Intergenic
1057413975 9:94845236-94845258 GACAAGACACAGAGTCAGGTGGG + Intronic
1057447722 9:95129639-95129661 GAGAAGGAACAGATTTTGGTAGG - Intronic
1057576112 9:96244121-96244143 CAGAAGCCACAGCAGCAGGTGGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058588137 9:106532352-106532374 GAGAAGGCACAGATGTGGCAAGG - Intergenic
1059557511 9:115296113-115296135 GAGAAGACACAGAAGCTGTTAGG - Intronic
1059887978 9:118768249-118768271 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1060947630 9:127579461-127579483 GAGAAGGCCCAGAGGAAGATGGG + Intergenic
1061059759 9:128244607-128244629 GAGGAGGCACAGATGGATGGGGG - Intronic
1062052928 9:134456817-134456839 GGGAAGGCACAGCTGGAGCTCGG - Intergenic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1062657346 9:137611106-137611128 GAGCAGGCACAGAGGAGGGTGGG - Intronic
1062722580 9:138052061-138052083 GAGAAGCCACAGATGCAGACAGG - Intronic
1185872473 X:3675448-3675470 GAGAAGGAAGAGATGGAGGAGGG - Intronic
1185882136 X:3750925-3750947 GAGAAGGAACTGATACAGGTGGG - Intergenic
1185961919 X:4553747-4553769 GAGAATGCTCAAATGCAGATTGG + Intergenic
1186078193 X:5903260-5903282 TAGAAGGCATAGAAGTAGGTGGG + Exonic
1186783212 X:12934132-12934154 GAGTGGGGAAAGATGCAGGTAGG + Intergenic
1187118073 X:16373926-16373948 TAGAAGGCACAGAATAAGGTTGG - Intergenic
1187285088 X:17897428-17897450 GGGAAGGCACAGTTGCAGGTAGG - Intergenic
1188324412 X:28783256-28783278 AATAAGGCACAGATGCATTTTGG + Intronic
1188340395 X:28993593-28993615 GAGAAGGCAAAGATTGAAGTAGG + Intronic
1188867492 X:35331516-35331538 GAGAAAGCACAGACACAGGATGG - Intergenic
1190546115 X:51529308-51529330 GGGAAGGGAGAAATGCAGGTGGG + Intergenic
1192148865 X:68699553-68699575 GAGAAGACACAGGTGCACTTGGG - Intronic
1193338409 X:80317929-80317951 GCTAAGGCACAGAGGGAGGTGGG + Intergenic
1194480308 X:94414273-94414295 GAGAGGCCATAGATACAGGTTGG + Intergenic
1194943319 X:100039356-100039378 TAGAAGGTACGTATGCAGGTGGG - Intergenic
1195614834 X:106903871-106903893 GAGCAGGCCCAGATGCTTGTTGG + Intronic
1197223990 X:123938717-123938739 AAGAAGGGAAAGAAGCAGGTTGG + Intergenic
1199290167 X:146096199-146096221 GAGAAGGGACAAATGCCGGTTGG + Intergenic
1200782836 Y:7232281-7232303 GAGAAGGAACTGATACAGGTGGG + Intergenic
1201517149 Y:14830314-14830336 TAGAAGGCATAGAAGTAGGTGGG - Exonic
1201909641 Y:19121023-19121045 AAGATGGCACAAATGCAGTTGGG + Intergenic