ID: 1062634736

View in Genome Browser
Species Human (GRCh38)
Location 9:137484861-137484883
Sequence CAGCCTCAGGACTGGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 2, 1: 0, 2: 9, 3: 78, 4: 570}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062634736_1062634750 15 Left 1062634736 9:137484861-137484883 CCGCCTCCCCAGTCCTGAGGCTG 0: 2
1: 0
2: 9
3: 78
4: 570
Right 1062634750 9:137484899-137484921 TCCCCAGTCCTGAGGCTGCCTGG 0: 3
1: 0
2: 3
3: 28
4: 381
1062634736_1062634746 7 Left 1062634736 9:137484861-137484883 CCGCCTCCCCAGTCCTGAGGCTG 0: 2
1: 0
2: 9
3: 78
4: 570
Right 1062634746 9:137484891-137484913 CTCCCGCCTCCCCAGTCCTGAGG 0: 2
1: 1
2: 3
3: 74
4: 828

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062634736 Original CRISPR CAGCCTCAGGACTGGGGAGG CGG (reversed) Intronic
900003447 1:28968-28990 AAGACGCAGGAGTGGGGAGGCGG + Intergenic
900101408 1:963697-963719 CAGCCTCTGGACTGGGGGTAAGG - Intronic
900502343 1:3012616-3012638 CTGCCACGGGCCTGGGGAGGCGG - Intergenic
900645325 1:3706361-3706383 CCGCCGCAGGCCCGGGGAGGGGG + Intronic
900645342 1:3706406-3706428 CCGCCGCAGGCCCGGGGAGGGGG + Intronic
900704722 1:4073212-4073234 CACTCTCAGGACAGGGGAGATGG + Intergenic
901037325 1:6344111-6344133 GAGCAGCAGGAGTGGGGAGGTGG + Intronic
901158183 1:7154707-7154729 CAGCCTCCGGGCTGGTGTGGGGG - Intronic
901207687 1:7506161-7506183 CAGCATGAGGACTTGGGAGCAGG + Intronic
901230977 1:7641598-7641620 CAGCCTCAAGGTTGGGGATGAGG + Intronic
901263110 1:7888325-7888347 CAGTCTGAGGGATGGGGAGGAGG - Intergenic
901686592 1:10946842-10946864 CACCCCAAGGCCTGGGGAGGGGG + Intronic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
902402135 1:16163847-16163869 CAGCCTCAGGCCAGGTGCGGTGG + Intergenic
902614400 1:17616006-17616028 CAGGCCGAGGCCTGGGGAGGCGG + Intronic
902810674 1:18886173-18886195 CAGACCTTGGACTGGGGAGGAGG - Intronic
903835594 1:26201345-26201367 CACCCCCAGGATTGTGGAGGAGG + Exonic
904000433 1:27335673-27335695 GAGTCACAGGCCTGGGGAGGAGG - Exonic
904455780 1:30647252-30647274 CAGTCTCAGGAGTGCTGAGGAGG + Intergenic
904650655 1:32003535-32003557 CAGGCTCAGGCCTGGGGCTGGGG - Intergenic
904832172 1:33312257-33312279 AGGGCTCAGCACTGGGGAGGTGG - Intronic
904940881 1:34164447-34164469 CAGACGCAGAAATGGGGAGGGGG + Intronic
905313634 1:37067504-37067526 CAGTGTCAGGACTGTGAAGGTGG - Intergenic
905390727 1:37634149-37634171 CAGGCTGCGGACTGGGGTGGGGG + Intronic
905482502 1:38271288-38271310 CAGCCTCAGGTGTGGGGATGGGG - Intergenic
906113389 1:43339197-43339219 CAGCCTCTGGACTGCAGAGAGGG - Intronic
906325870 1:44845347-44845369 GAGCCTCAGTCCTGGGGAAGAGG + Intergenic
907048114 1:51312413-51312435 CAGCCCCAGGACTGATCAGGTGG - Intronic
907801463 1:57769866-57769888 CAGCCTCAGGACACAGGAGAAGG - Intronic
910218094 1:84862940-84862962 CAGAATTAGAACTGGGGAGGTGG + Intronic
910452684 1:87362988-87363010 CAGTCTCAGGACTGGGCACATGG + Intergenic
910772763 1:90846583-90846605 TAGCTTCAGGAGTGGGGAGAGGG - Intergenic
912475251 1:109930532-109930554 CGGCATCAGGACAGGGAAGGTGG - Exonic
912624681 1:111197330-111197352 AAGGCTGAGGGCTGGGGAGGGGG + Intronic
913071975 1:115307464-115307486 CAACCTCAGCTCTGGTGAGGAGG + Intronic
913093649 1:115496704-115496726 CTGCTTCAGGACTGGAGAGATGG + Intergenic
913137077 1:115901940-115901962 CTACCTCAGGACTGGGCAGGGGG - Intergenic
913191086 1:116413584-116413606 AAGCCTCAGGGGTTGGGAGGAGG + Intergenic
915126716 1:153670701-153670723 CGGGCCCAGGAGTGGGGAGGGGG - Intronic
915137590 1:153744282-153744304 CAGACTCAGGACAGGGAAGCAGG - Intronic
915288532 1:154867982-154868004 CAGCCCCAAGACGGAGGAGGGGG - Intronic
915457666 1:156051433-156051455 CAGCCTCAGGACTGCTCAGGAGG - Intronic
915632150 1:157160991-157161013 CAGGCTCAGGACTGGGGACAGGG - Intergenic
915954452 1:160210723-160210745 CAGCCTGGGAACTGGGCAGGGGG + Intronic
916556115 1:165895721-165895743 TTGCCTCAGGACTGGCGGGGAGG + Intronic
917077465 1:171220263-171220285 AAGCCTCGGGGGTGGGGAGGGGG + Intergenic
920440859 1:205979547-205979569 CAACCCCTGAACTGGGGAGGGGG - Intronic
920510827 1:206550905-206550927 CAGCCTTAGGACTGGGTAGCAGG - Intronic
921430333 1:215058031-215058053 CAGCCCCAGGAATAGGGAGTGGG + Intronic
922594968 1:226806575-226806597 CAGCCTCTGGACTGGGAAACTGG - Intergenic
922701425 1:227763412-227763434 CAGCAGCAGGACAGGGCAGGAGG + Intronic
922738945 1:228005116-228005138 GAGCCTCATTTCTGGGGAGGTGG + Intergenic
923085004 1:230696551-230696573 CAGCCACAGGACGCTGGAGGAGG - Intergenic
923458705 1:234188329-234188351 CAGACTCAGTGCTGGTGAGGTGG + Intronic
1063384233 10:5606114-5606136 CAGGCCCAGGACTGGAGATGAGG + Intergenic
1064311015 10:14211918-14211940 ATGCCTCAGCACTGGGGAAGTGG + Intronic
1064351860 10:14584124-14584146 CAGCCTCAGGGCTGGGCATCAGG - Intronic
1064539332 10:16389590-16389612 CGGACTCAGGACTTCGGAGGTGG + Intergenic
1065187740 10:23185414-23185436 CAGACTCAGAAGTGGGGTGGTGG + Intergenic
1065669822 10:28103844-28103866 AAGCCATAGGAATGGGGAGGAGG + Intronic
1067030200 10:42874870-42874892 GAGCCTCTGGACTCGGGTGGGGG - Intergenic
1067528146 10:47050737-47050759 CAGCAGCAGGCCTGAGGAGGAGG - Intergenic
1068886448 10:62102813-62102835 GAAGCTCAGGACAGGGGAGGTGG + Intergenic
1069719810 10:70542137-70542159 GGGCCTCAGGACTGGGGCGAGGG - Intronic
1069827164 10:71261351-71261373 CAGCCTCAGGATTGGCCAGGTGG + Intronic
1069960611 10:72076957-72076979 CAGCATCTGCACTGAGGAGGAGG + Intronic
1070373698 10:75809134-75809156 CACACTCAGCTCTGGGGAGGTGG - Intronic
1071289272 10:84176884-84176906 CTGGCTGAGGACTGTGGAGGTGG + Intronic
1071299760 10:84247755-84247777 GAGCCTGTGGACTGGGGAGGGGG - Intronic
1072617547 10:97059709-97059731 CAGTCTGAGGGCTGGGCAGGAGG + Intronic
1073123608 10:101136333-101136355 CTCCCTCAGGGCCGGGGAGGGGG + Intronic
1073143933 10:101266802-101266824 GAGCCTCAGAACTGGGGATATGG - Intergenic
1073369430 10:102973889-102973911 CAGCCAGAGGTCTGGGGAGAGGG - Intronic
1075390759 10:122089601-122089623 CAGCCAAAGGCCTAGGGAGGCGG - Intronic
1075791027 10:125084559-125084581 GAACCTCAGGGCTGGGGAGGTGG - Intronic
1076361678 10:129894072-129894094 CAGGAACAGGACTGGGGAGCAGG - Intronic
1076601675 10:131660765-131660787 CAACCTCAGGACCAGGGCGGAGG + Intergenic
1076618595 10:131772510-131772532 CAGCCTCAGCCCTGGGCAGGAGG + Intergenic
1076686166 10:132199391-132199413 GAGCCTCAGGCCTGGGCGGGGGG + Intronic
1076722512 10:132398917-132398939 AAGCCTCAGGACTGGGGGTCGGG - Intronic
1076722540 10:132399009-132399031 AAGCCTCAGGACTGGGGCTGGGG - Intronic
1076869636 10:133187038-133187060 GAGCATCAGGACTGGGGACACGG - Intronic
1077118509 11:896244-896266 CAGCCTCATGTCTGGGGTGGAGG - Intronic
1077118530 11:896323-896345 CACCCTCATGTCTGGGGTGGAGG - Intronic
1077118567 11:896481-896503 CAGCCTCATGTCTGGGGTGGAGG - Intronic
1077118577 11:896519-896541 CAGCCTCACGTCTGGGGTGGAGG - Intronic
1077118587 11:896557-896579 CAGCCTCACGTCTGGGGTGGAGG - Intronic
1077118618 11:896674-896696 CAGCCTCATGTCTGGGGTGGAGG - Intronic
1077118628 11:896712-896734 CAGCCTCACGTCTGGGGTGGAGG - Intronic
1077118637 11:896750-896772 CAGCCACACGTCTGGGGTGGAGG - Intronic
1077118759 11:897250-897272 CAGCCTCGTGTCTGGGGTGGAGG - Intronic
1077217071 11:1399370-1399392 CAGCCTCAGGACAGCCGAGGAGG + Intronic
1077286447 11:1768054-1768076 CAGCCACAGGACGGGGGTCGTGG + Intergenic
1077476694 11:2793824-2793846 CAGCCCCATGGCTGGGCAGGGGG + Intronic
1077525073 11:3059297-3059319 ACGCAGCAGGACTGGGGAGGCGG - Intergenic
1077660528 11:4064663-4064685 CAGCCTCAGAACTTGGGAAGAGG + Intronic
1077669684 11:4146038-4146060 CTTCCTCAGGAGTTGGGAGGAGG + Intergenic
1078533611 11:12156137-12156159 CAGCCTCAGGGCTGGAGTGCTGG - Intronic
1078599153 11:12715378-12715400 AAGCCTGGGGACTGGGGAGGAGG + Intronic
1079076509 11:17388292-17388314 CAGCCTCAGGCCGGGCGCGGTGG + Exonic
1079184875 11:18227742-18227764 CAGCCTCAGGATTGGGAAAGGGG - Intronic
1081621167 11:44619959-44619981 CTGCATCAGGCCTGGGGAAGGGG - Exonic
1081805057 11:45885873-45885895 CAGCCCCAGGAACGGGGAGGCGG - Exonic
1082874399 11:57973103-57973125 CAGCGTCAGGGCTGGGGTGGAGG - Intergenic
1083149228 11:60781448-60781470 CAGGCTCAGAGCTGGGGACGTGG - Intergenic
1083561918 11:63679880-63679902 CAGCCTCATGAAGCGGGAGGTGG - Intergenic
1083869226 11:65476995-65477017 CAGGCCCAGGCCTGGGCAGGTGG + Intergenic
1083892193 11:65601123-65601145 GAGTCTCAGGACTGGGGCTGCGG - Intronic
1084047070 11:66575241-66575263 CAGCCTGGGGAGCGGGGAGGAGG - Intergenic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084257702 11:67954411-67954433 CAACCCCAAGACTGGGCAGGGGG + Intergenic
1084404002 11:68960653-68960675 CGGCCTCAGGCCTGGGCAGGAGG + Intergenic
1084534995 11:69751295-69751317 CAGCCTGTGGGCTGGTGAGGAGG + Intergenic
1084546436 11:69817357-69817379 CAGCCTGCGCACTGGGAAGGCGG - Intronic
1084961912 11:72721303-72721325 CAGCACCAGTCCTGGGGAGGAGG + Intronic
1085418779 11:76337803-76337825 CAGAATCAGGACTGGGGAAAAGG - Intergenic
1086103824 11:83128798-83128820 CAGCCTAAAGCCTGGGGATGTGG - Intergenic
1086855485 11:91860520-91860542 CAACCTGAGGAGAGGGGAGGGGG - Intergenic
1087147265 11:94824653-94824675 GAGCCTTAGGTCTGGGGAGAGGG + Intronic
1087834806 11:102862469-102862491 CAGCCACAAGACTGGAGAGAAGG - Intergenic
1088771226 11:113037816-113037838 AAGCCTAAGGACTACGGAGGAGG - Intronic
1088849207 11:113691199-113691221 CATCCCCAGGTGTGGGGAGGGGG - Intronic
1089494682 11:118902188-118902210 CAGCCTCACGCCTGAGCAGGTGG - Exonic
1090045771 11:123331655-123331677 CAGAAACAGGACTTGGGAGGAGG - Intergenic
1091219317 11:133920790-133920812 CAGCAGCAGCCCTGGGGAGGTGG - Exonic
1091548210 12:1518630-1518652 CAGCCCCAGAACCAGGGAGGGGG - Intergenic
1091600563 12:1915426-1915448 CAGCCTCAGGCCAGGGCCGGAGG + Intronic
1091723652 12:2830955-2830977 AAGGCTCAGGGCTGGGGGGGTGG - Intronic
1092008401 12:5088488-5088510 CAGCCACAGGTGTGTGGAGGAGG - Intergenic
1092427934 12:8389207-8389229 CAACCCCAAGACTGGGCAGGGGG + Intergenic
1092429209 12:8396220-8396242 CAACCCCAAGACTGGGCAGGGGG + Intergenic
1092751550 12:11724027-11724049 CACCCTCAGGTCAGGGGTGGGGG - Intronic
1093184641 12:16005969-16005991 TGGCCACAGGAATGGGGAGGGGG - Intronic
1093997026 12:25653950-25653972 CAGCCTGAGGTCTGGGCAGTGGG + Intergenic
1095349335 12:41189670-41189692 CAGCCTCAGGAGTTGAGAGATGG + Intronic
1096278895 12:50234724-50234746 CAGCCTCAGGCCTGGTGCAGTGG + Intronic
1096408181 12:51358809-51358831 GAGCCTCGGCACTGGGGAGTGGG - Intronic
1096500620 12:52062121-52062143 GCACCTCAGGGCTGGGGAGGGGG - Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096541995 12:52313236-52313258 GAGACTCAGGAATTGGGAGGTGG + Intergenic
1096628579 12:52910759-52910781 AATCCTCAGGGCTGGGGTGGGGG - Intronic
1096774241 12:53954735-53954757 CACCCCCAGGATTGGGGAAGGGG + Intergenic
1097233745 12:57526629-57526651 CATCCGAAGGACTGGGGATGGGG + Exonic
1097831951 12:64234526-64234548 CAGCCTCAAGACTGGGTAAGTGG - Intergenic
1101108570 12:101463381-101463403 CAGCCTCCGAAGTGAGGAGGAGG - Intergenic
1101230494 12:102736477-102736499 CAGCCTCACCAATGGGGAGGGGG - Intergenic
1101860703 12:108480196-108480218 AAGCCAGAGGACTGGGGAGTGGG - Intergenic
1102627555 12:114247523-114247545 CAGGTTCAGGGCTGGGGATGGGG + Intergenic
1102676921 12:114665422-114665444 CAGCCTCTGGAATCGGGGGGCGG - Intergenic
1102745334 12:115244414-115244436 CAGCACCAGGGCTGGGGAGCAGG + Intergenic
1102746138 12:115250749-115250771 ATGTCTCTGGACTGGGGAGGCGG + Intergenic
1103886627 12:124207329-124207351 CAACCTCAGTTCTGGGGATGGGG - Intronic
1103899100 12:124294359-124294381 GATCCTCAGGAGTGGGGTGGGGG + Intronic
1104792758 12:131494095-131494117 CAGGCTCAGGACGGCAGAGGGGG - Intergenic
1104844704 12:131840931-131840953 CAGCCGCAGGGTTGGGGATGGGG - Intronic
1105890678 13:24680549-24680571 CAGCCGCTGCACCGGGGAGGTGG - Exonic
1106371308 13:29136497-29136519 CAGCCTCTGGGCAGGGGAGAAGG + Intronic
1107111685 13:36704764-36704786 CACCCTCAGGCCTTGGGAAGGGG - Intergenic
1107351668 13:39520970-39520992 CAGCCTCAGTTCTGGGAAGAAGG + Intronic
1107741831 13:43458801-43458823 AAGCTTCAAGAATGGGGAGGGGG - Intronic
1108575662 13:51788420-51788442 CAACCTCATCACTGGGGAGAAGG + Intronic
1108673233 13:52712627-52712649 CATGCTCAGGCCTGTGGAGGGGG + Intronic
1110695168 13:78479233-78479255 CAGCCTCAGGTCGGGCGTGGTGG - Intergenic
1110881513 13:80577937-80577959 CAGACTCAGGGCTGTTGAGGGGG + Intergenic
1111215153 13:85132032-85132054 CAGCATCAGAAATGTGGAGGAGG + Intergenic
1112796076 13:103058006-103058028 CAGACTGAGGGCTGGGGAGGGGG + Intronic
1113385290 13:109842788-109842810 CAGGCCCAGGAGTGGGGATGGGG - Intergenic
1113416222 13:110130749-110130771 CAGCCTCAGGGCTGCAGAGAGGG + Intergenic
1113620107 13:111756494-111756516 GACCCCCAGGAGTGGGGAGGAGG + Intergenic
1113962152 13:114132241-114132263 CAGCCCGAGGCCCGGGGAGGCGG + Intronic
1115664869 14:35534947-35534969 CAGGCCCAGGACAGGGGATGTGG - Exonic
1117546375 14:56797673-56797695 CAGGCTCTGGAATGGGGAAGCGG - Intergenic
1118850681 14:69580840-69580862 CCTCCTCAAGACTGGGGAGCTGG - Intergenic
1118920996 14:70149878-70149900 CAGCCCCAGGACAGGGAAGAAGG - Intronic
1119889193 14:78170050-78170072 CATCCTCAGCAGTGGGGAAGTGG + Intergenic
1121021154 14:90580881-90580903 CAGCTTCAGGCCTGGGGGCGGGG + Intronic
1121124971 14:91400068-91400090 CAGACACAGGCCTGGGGAGCAGG - Intronic
1121225753 14:92320752-92320774 CAGTCTCAGCCCAGGGGAGGTGG - Intergenic
1121457631 14:94048790-94048812 CAGATACAGGAGTGGGGAGGGGG + Exonic
1121505402 14:94473223-94473245 CAGCCTCAGAACTGGGGTGGTGG + Intronic
1121609781 14:95269874-95269896 CAGCCTGTGGATTGGGGTGGGGG - Intronic
1122349269 14:101078129-101078151 CCGGCTCAGGCCTGGGGGGGGGG + Intergenic
1122843338 14:104477264-104477286 CAGCTTCAGGTCTGGGACGGGGG - Intronic
1122982443 14:105197734-105197756 CTGCCCCAGGCCTCGGGAGGAGG - Intergenic
1123021425 14:105399476-105399498 CAGACTCAGGACTGGGTAAGCGG + Exonic
1124024990 15:25957764-25957786 CAGCCTCAGTGCTGCGCAGGGGG - Intergenic
1124140863 15:27076192-27076214 CTGCCAAAGGACTGGGGAGAAGG - Intronic
1124226691 15:27901302-27901324 CAGCAGCAGGGCTGGGGAGAAGG - Intronic
1124641156 15:31397390-31397412 CATTCTCAGGCCTGGGGCGGTGG + Intronic
1124658650 15:31527750-31527772 ATGCCTCAGGGCTGGAGAGGAGG - Intronic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1125462615 15:39920746-39920768 CTGCCTCAGCACTGGCGACGGGG + Exonic
1125508551 15:40281156-40281178 GAGCCTGAGGGCTGGGGAGGGGG + Intronic
1125511957 15:40296872-40296894 GATCCTCAGGGCTGGGCAGGGGG + Exonic
1125779704 15:42253646-42253668 CTGCCTCTGAACTGGGAAGGAGG + Intronic
1127656692 15:61062234-61062256 AAGCCACAGAACTGGGGAGACGG + Intronic
1128083930 15:64873200-64873222 CAGCCTCCTAGCTGGGGAGGCGG + Intronic
1128156391 15:65394447-65394469 CAGCCTGAGCAATGGGCAGGTGG - Exonic
1128324005 15:66711797-66711819 CAGCCTCAGGGCTGGAGGGCTGG + Intronic
1128328028 15:66737750-66737772 CAGCTTCAGGCCTGGGGAGGTGG + Intronic
1128557446 15:68641408-68641430 CACCCTGAGGACTGGGGAGCTGG + Intronic
1129700173 15:77763300-77763322 CAGCCTGGGGCCTGGAGAGGAGG + Intronic
1129829790 15:78661255-78661277 CATCCTCAGGGCGGGGCAGGGGG - Intronic
1130116961 15:81013775-81013797 CAGGCTGAGGACTGCGGAAGCGG - Intronic
1131175974 15:90210067-90210089 CAGGCTCAGGACTGCGGTAGTGG + Intronic
1131260700 15:90886047-90886069 CAGCCTCTAGACTGAGGAGCTGG - Intronic
1131399944 15:92116493-92116515 TAGCCTCAGAACTTGGGAGCTGG - Intronic
1132397228 15:101482766-101482788 CAGAATCAGGACTGAGCAGGTGG - Intronic
1132450054 15:101961972-101961994 AAGACGCAGGAGTGGGGAGGTGG - Intergenic
1132605146 16:790522-790544 CAGTCTCAGGTCGGGGGAGGAGG + Exonic
1132645311 16:996810-996832 CAGGGTCAGGGCTGGGGCGGGGG + Intergenic
1132702580 16:1228435-1228457 CAGGCTTAGGACAGGGAAGGGGG + Exonic
1132705746 16:1242433-1242455 CAGGCTTAGGACAGGGAAGGGGG - Exonic
1132755979 16:1485767-1485789 CATCCTGGGGAGTGGGGAGGTGG - Intergenic
1132863586 16:2083153-2083175 CAGCGTCAGGACAGGGGGAGAGG - Intronic
1132873203 16:2124643-2124665 CAGCATCTGGTCTGGGGAGTGGG - Intronic
1132931792 16:2462432-2462454 CAGGCTCAGTGCTGTGGAGGTGG + Exonic
1133206697 16:4238359-4238381 CAGCCTATGGACTCAGGAGGGGG - Intronic
1133229806 16:4361133-4361155 CAGGCTCAGGAATGGGGCTGGGG - Intronic
1133316541 16:4888060-4888082 CGGCCTCGGGACTGAGGTGGAGG - Intronic
1133370314 16:5241160-5241182 CAACCCCAAGACTGGGCAGGGGG - Intergenic
1134044150 16:11089031-11089053 CAGCCTCCGTTCAGGGGAGGGGG + Intronic
1134446871 16:14337657-14337679 GTGCCTCAGGACCTGGGAGGAGG + Intergenic
1134756845 16:16674636-16674658 CAGCTTTGGGAGTGGGGAGGTGG + Intergenic
1134989223 16:18684527-18684549 CAGCTTTGGGAGTGGGGAGGTGG - Intergenic
1135496733 16:22958412-22958434 CAGACAGAGGAGTGGGGAGGAGG - Intergenic
1135522285 16:23186746-23186768 CAGATTTAGAACTGGGGAGGGGG - Intronic
1138103338 16:54272249-54272271 CAGCCCCAGGAAATGGGAGGAGG - Intergenic
1138118909 16:54382446-54382468 CAGGCTCTGGGCTGGAGAGGTGG - Intergenic
1138301004 16:55929877-55929899 CAGCCTCAGAACTGAAGTGGGGG - Intronic
1138347316 16:56328048-56328070 GTGCCTCAGGACTGGGGGAGGGG - Intronic
1138414737 16:56865151-56865173 CTGCGTCTGCACTGGGGAGGAGG - Intergenic
1139332115 16:66201436-66201458 GAGCCTCAGGACAGGAGAGAGGG - Intergenic
1139529865 16:67537769-67537791 GAGCCTCAGGAAAGAGGAGGGGG + Intronic
1139553929 16:67694071-67694093 CAGCCTCAGAGCTCGGGAGGTGG - Intronic
1139601062 16:67987515-67987537 CAGAATAAGGACTGGGAAGGTGG + Exonic
1139671001 16:68492527-68492549 CAGCCACAGGGTTGGGGTGGGGG + Intergenic
1139703775 16:68726295-68726317 CAGCCACAGGTCAGGGGAGCAGG - Intergenic
1139847224 16:69929578-69929600 CAGCTCCAGCACTGGGCAGGTGG + Intronic
1140125061 16:72111861-72111883 CAGCCTCACCTCTGGGGAGGAGG - Intronic
1140229927 16:73109070-73109092 CAGCCTGAGGACTTGAGAGATGG + Intergenic
1140258139 16:73354585-73354607 CAGACGCTGGACTGGGGAGGAGG - Intergenic
1141528638 16:84629980-84630002 GCGCCTCAGGAATGGGGAGACGG - Intergenic
1141683402 16:85556754-85556776 AAACCCCAGGACTGGGGGGGGGG - Intergenic
1142136552 16:88454249-88454271 GAGCCGCAGGACAGGGGAGGGGG + Intronic
1142240784 16:88943932-88943954 CACACTCAGGGCTCGGGAGGGGG + Intronic
1142608521 17:1095580-1095602 CTGCAGCAGGACTGGGGAGGAGG - Intronic
1142767002 17:2070460-2070482 CAGGCACAGGGCTGGGGAAGTGG + Intronic
1142788314 17:2243044-2243066 CAGTGGCAGGACGGGGGAGGTGG + Intronic
1143684799 17:8505018-8505040 CAGCCTCAGGCCCCAGGAGGAGG - Intronic
1143726486 17:8850439-8850461 CATCTGCAGAACTGGGGAGGGGG - Intronic
1143977987 17:10844428-10844450 CAGCCCCAGGGTTGGGGTGGAGG + Intergenic
1144096411 17:11904328-11904350 GAGCCACAAGAGTGGGGAGGGGG + Intronic
1144340818 17:14309330-14309352 CAGCCTAGGGGCGGGGGAGGCGG - Intronic
1144495292 17:15741785-15741807 TAGCCTCAGCCCTGGGGAGGAGG - Intronic
1144638932 17:16927098-16927120 CGGCCTCAGCCCTGGGGAGGAGG + Intergenic
1145208004 17:20994882-20994904 CAGCCTCAGCCCAGGGGAGGAGG - Intergenic
1145214867 17:21043407-21043429 CTTCCAGAGGACTGGGGAGGCGG + Intronic
1145370230 17:22301285-22301307 CAGCCTCAGGAGTTGCGTGGGGG + Intergenic
1145875864 17:28318046-28318068 CAGCCTCAGGTCATGGGAGGAGG - Intergenic
1146013802 17:29216730-29216752 GAGCCTCAGTACTGGAGACGGGG + Intergenic
1146464689 17:33077018-33077040 GAGCCTCTGGGCTGGGGAGATGG - Intronic
1146673258 17:34756467-34756489 CAGGCTCAGCACTGGGGGGTGGG - Intergenic
1146720598 17:35120902-35120924 CAGCTTCAGGGGTGGGGAGGGGG - Intronic
1147387498 17:40090928-40090950 CAGCCACAGGGAGGGGGAGGAGG - Intronic
1147599787 17:41738677-41738699 CAGGGTCAGGCCAGGGGAGGGGG - Intergenic
1147632198 17:41939316-41939338 CACCCTCAGTCCTGGGCAGGTGG - Intronic
1147971186 17:44219762-44219784 CAGCCGCCGGAGCGGGGAGGAGG + Intronic
1148382607 17:47210530-47210552 CAGCCTTAGGACAGGGCTGGGGG + Intronic
1148444741 17:47730789-47730811 CAGCCCCAGGGCCCGGGAGGAGG + Intergenic
1148683315 17:49486883-49486905 GAGCCCCAGGTCTGGGGAGGAGG - Intergenic
1148701250 17:49588253-49588275 CATCCACAGGAATGGGGAGAGGG + Intergenic
1148741804 17:49897357-49897379 CTGCCTGAGGGCTGGGGAGAAGG - Intergenic
1149442948 17:56690569-56690591 CAGCCTCTGGACTCAGGAAGCGG - Intergenic
1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG + Intronic
1149727836 17:58914584-58914606 CACACTCAAGACTGGGGATGGGG - Intronic
1151425713 17:74029840-74029862 CATCCTCAGAACTGTGGGGGTGG + Intergenic
1151550868 17:74821842-74821864 GCCCCTCAGCACTGGGGAGGGGG + Intronic
1151727734 17:75894365-75894387 CAGCATCGGTACTGTGGAGGTGG - Intronic
1151887468 17:76931727-76931749 GAGCCACAGGAATGAGGAGGCGG + Intronic
1151989138 17:77563060-77563082 CAGCCTCACGCCTGGAGAGCTGG + Intergenic
1152108226 17:78342769-78342791 CTGCATCAGGCCTGGGGAGGGGG + Intergenic
1152184030 17:78843002-78843024 CACCCTCAGGTCTGCGGGGGTGG + Intergenic
1152260927 17:79266697-79266719 CAACCTCAGGAGAGGGGAGGGGG + Intronic
1152450746 17:80377984-80378006 CAGACTCAGCACTGTGGACGTGG + Intronic
1152514563 17:80815805-80815827 CATCCTCCCGACTGGCGAGGTGG + Intronic
1152514577 17:80815877-80815899 CATCCTCCCGACTGGCGAGGTGG + Intronic
1152514591 17:80815949-80815971 CATCCTCCCGACTGGCGAGGTGG + Intronic
1152615885 17:81337598-81337620 CATCCTCAGGAGTGGGGGTGGGG + Intergenic
1152628838 17:81400553-81400575 CAGCCTGCGGCCCGGGGAGGAGG + Intronic
1152640532 17:81447465-81447487 CTGCTCCAGGACTTGGGAGGAGG - Exonic
1153514250 18:5890528-5890550 CAGCCGCAGGGGTGGCGAGGGGG + Exonic
1154349225 18:13569184-13569206 AGGCCCCAGGAGTGGGGAGGAGG - Intronic
1155422189 18:25667512-25667534 AAGCCACAGGACTGGTGAGTGGG - Intergenic
1156487862 18:37477973-37477995 CAGCCCCAGCCCTGGGGAGCAGG + Intronic
1157061452 18:44295871-44295893 CAGCATCATGACTGGGCAGACGG + Intergenic
1157563668 18:48665199-48665221 CAGCCTCAGGCCGGGCGCGGTGG - Intronic
1157596373 18:48866430-48866452 GTGACTCAGGGCTGGGGAGGGGG + Intergenic
1157642805 18:49234501-49234523 AAGCCACAGGATAGGGGAGGAGG - Intronic
1160007906 18:75081781-75081803 CAGTCTCAGGGGTGGGGACGGGG - Intergenic
1160635200 19:70576-70598 AAGACGCAGGAGTGGGGAGGCGG + Intergenic
1160944135 19:1633352-1633374 AAGCCTCTGGACTTGGGAGTTGG - Intronic
1160976783 19:1796678-1796700 CGGCCTCAGAGATGGGGAGGTGG + Intronic
1160987255 19:1844785-1844807 CAGTCCCAGGCCTGGGGAAGGGG - Intronic
1161480444 19:4507773-4507795 GGCCCTCAGGACTGGGGACGGGG + Intronic
1162132693 19:8536754-8536776 CAGCCTGGGGACTGGGGGGAGGG + Intronic
1162176433 19:8833037-8833059 CTGCACCAGGCCTGGGGAGGGGG + Intronic
1162340049 19:10086695-10086717 CAGCCTAAGGTGTGGGGGGGCGG - Intronic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1162789509 19:13055613-13055635 CAGCCTCAGGGCTGGGGGAGGGG + Intronic
1163004787 19:14390276-14390298 TACCCTTAAGACTGGGGAGGGGG + Intronic
1163012559 19:14434578-14434600 CATCAGCAGGACTGGGAAGGCGG - Intronic
1163070876 19:14840104-14840126 AAGCCCCAGGTCTGGGGTGGTGG + Intergenic
1163384297 19:16989896-16989918 CTCCCTGAGGATTGGGGAGGGGG - Intronic
1163612339 19:18308036-18308058 CAGCCCCAGGGATGGGGAAGGGG + Intronic
1163613996 19:18315959-18315981 CAGCCTCAGCACAGGGGCGGTGG - Intronic
1164635151 19:29786248-29786270 CAGGCTCGGCAATGGGGAGGTGG + Intergenic
1164650169 19:29885731-29885753 CAGGCTCAGGAGCTGGGAGGGGG - Intergenic
1164809886 19:31147481-31147503 CAACCTCAGGACTGGGCCTGGGG + Intergenic
1165136562 19:33673496-33673518 GAGCCTCAGAACTGGGGGTGGGG - Intronic
1165159187 19:33805833-33805855 CACCCTGGGCACTGGGGAGGTGG + Intronic
1165351830 19:35279837-35279859 CCATCTCAGGAGTGGGGAGGGGG + Intergenic
1165907696 19:39203769-39203791 CAGCCTCGGGGCTTGGGTGGTGG + Intronic
1166271114 19:41714700-41714722 CAGACACAGGACTGGGGGGGAGG - Intronic
1166306945 19:41940515-41940537 CAGATTCAGGAAAGGGGAGGGGG + Intergenic
1166361838 19:42255702-42255724 CAGCATCGGAAATGGGGAGGCGG + Intergenic
1166780677 19:45340960-45340982 GAGCCCCAGGACGGGGCAGGGGG - Intronic
1167259771 19:48451818-48451840 TAGCGTCAGCCCTGGGGAGGAGG + Intronic
1167459395 19:49616233-49616255 CAGCCTCAGGGCTGCAGGGGTGG + Intronic
1167463492 19:49638446-49638468 CTCCCTCAGGAATGGGGAGGAGG + Intronic
1167499466 19:49837002-49837024 ATCCCTCAGGACTGGGCAGGAGG + Intronic
1167578258 19:50328069-50328091 GAGACTCAGGATTGGGGAAGAGG + Intronic
1167788881 19:51658731-51658753 CAGCTACAGGATTGGGGAAGTGG - Intergenic
1167946485 19:52992902-52992924 CCTCCTCGGGACGGGGGAGGCGG + Intergenic
1168080012 19:54003188-54003210 CAGGCTCAGGGAGGGGGAGGCGG + Intronic
1168129630 19:54310073-54310095 CCCACTCAGGACAGGGGAGGAGG - Intronic
1168306507 19:55438828-55438850 CAGGCTCAGGGCTGGGTAAGTGG + Intronic
926495088 2:13576229-13576251 TAGCCTGAGGACAGGGGTGGTGG - Intergenic
926872779 2:17441401-17441423 CAGACTCAGGGCTGTTGAGGGGG - Intergenic
927125804 2:20011976-20011998 CAGCCTGAGGACTGTGGGAGGGG + Intronic
927204386 2:20597954-20597976 CAGGCTCAGCCCTGGTGAGGAGG + Intronic
927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG + Intergenic
927911003 2:26899681-26899703 CAGCCCCTGGATTGGGAAGGGGG - Intronic
927993164 2:27462426-27462448 CAGGCTCTGGACTGGAGGGGAGG + Intronic
928483224 2:31704695-31704717 CAGCCTCAGGACATCAGAGGAGG - Intergenic
928904951 2:36357736-36357758 CAGCCTCGTTTCTGGGGAGGCGG + Intronic
929122019 2:38491189-38491211 ACTGCTCAGGACTGGGGAGGAGG - Intergenic
929310189 2:40415199-40415221 AAGTCTCAGGGCTGGAGAGGTGG + Intronic
929449785 2:42028972-42028994 AGGCCTCAGGAGAGGGGAGGTGG + Intergenic
931562433 2:63576712-63576734 TAGCCTCAGGATTGGGGGGCTGG - Intronic
931638873 2:64363959-64363981 CAGCCTCAGGAAATGGCAGGTGG + Intergenic
931643244 2:64399739-64399761 CAGCATCAGGAGTGTAGAGGAGG + Intergenic
931667783 2:64622744-64622766 CAGCCTCAGGGGAGTGGAGGGGG + Intergenic
932495054 2:72142097-72142119 CCGCCTCAGGAATGCGGTGGGGG - Intronic
932564139 2:72895005-72895027 AGACCTCAGGACTGGGGAGTGGG - Intergenic
932837405 2:75050457-75050479 CAGCCTCTGGATGGGGAAGGAGG - Intronic
932864294 2:75325352-75325374 CAGCCTCATGTGTGGGAAGGGGG + Intergenic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
934128055 2:88917601-88917623 CAGACTCAGATCTGGGGTGGAGG + Intergenic
934769534 2:96899067-96899089 CAGCCTGAAGACCTGGGAGGAGG + Intronic
934810051 2:97270014-97270036 CAGCCTGAGGACACTGGAGGAGG - Intergenic
934827641 2:97437925-97437947 CAGCCTGAGGACACTGGAGGAGG + Intergenic
936038269 2:109129445-109129467 CAGCATCAGGACTGGGGAGCCGG - Intronic
936388961 2:112055073-112055095 CGGGCTCGGGACTGTGGAGGCGG - Intergenic
936502865 2:113080193-113080215 CAGCCTCAGAAATGGGCAGGGGG - Intergenic
936566280 2:113584467-113584489 AAGACGCAGGAGTGGGGAGGCGG - Intergenic
937100375 2:119263884-119263906 CAGCAGGAGGCCTGGGGAGGAGG + Exonic
937368345 2:121281151-121281173 CAGCTTCACGGCTGGGGACGTGG + Exonic
937869698 2:126778304-126778326 CAGCCACATGAGTTGGGAGGGGG - Intergenic
937915836 2:127098314-127098336 CCGCCACAGGACTGGGTTGGGGG - Intronic
937924947 2:127160867-127160889 CAGTCTGAGGACAGGAGAGGAGG - Intergenic
937942409 2:127296284-127296306 CACCCTCAGAACTGAGGAGGTGG - Intergenic
938157794 2:128956379-128956401 CAGCAGCAGGCCTGGGGATGGGG - Intergenic
938224698 2:129605929-129605951 CAGCCTCAGCTCTGGAGAAGGGG - Intergenic
938598301 2:132811622-132811644 CAGACTCAGGGCTGTTGAGGGGG - Intronic
938757248 2:134392071-134392093 CTGCCTGAGAAATGGGGAGGAGG + Intronic
939069437 2:137521312-137521334 CAGCCTTTGTAGTGGGGAGGGGG + Intronic
940403099 2:153268894-153268916 CAGCCTCAGGACTGGTGCCTTGG - Intergenic
940690773 2:156917829-156917851 AAGTCTCAGAAATGGGGAGGGGG - Intergenic
941029246 2:160493211-160493233 CAGGGTCAGGCCTGGGGAGGGGG - Intronic
945764529 2:213958398-213958420 CACCTTGAGGACTTGGGAGGAGG + Intronic
946135514 2:217643805-217643827 CAGCCCCAAGGCTGGGGAGATGG + Intronic
946156736 2:217811934-217811956 CAGCCTCAGGAAAGAGAAGGCGG - Intronic
946225469 2:218261957-218261979 CAGCCTCAGGCCTGGGGGTGTGG + Intronic
947162469 2:227228206-227228228 CAGCTTCAGGGCGGGGCAGGCGG + Intronic
947264686 2:228265576-228265598 CATCTTCACGACTGTGGAGGGGG - Intergenic
947813624 2:233021599-233021621 CTGTCTCAGAACTGGGGAGAGGG + Intergenic
948329871 2:237156433-237156455 CAGACGCTGGAGTGGGGAGGTGG - Intergenic
948479770 2:238241834-238241856 CAGCCCCACTACTGGGCAGGTGG - Intergenic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
948627032 2:239275719-239275741 CAGCCTGAGGGGTGGGGAGTGGG - Intronic
948909995 2:240998229-240998251 CATGCTCAGGGCTGGGAAGGGGG + Intergenic
949028462 2:241777164-241777186 CAGCACCAGGCCTGGGCAGGAGG - Intronic
949041474 2:241851807-241851829 CTGCCTGGGGGCTGGGGAGGTGG + Intronic
949066377 2:241993245-241993267 CAGCCTCAGGAGCTGGGAGATGG - Intergenic
1168939182 20:1694690-1694712 GGGCATCAGGACTTGGGAGGAGG - Intergenic
1169675818 20:8153439-8153461 CAGCCTGAGTACTTGAGAGGTGG + Intronic
1171332815 20:24356466-24356488 GAGCCTCAGGTCTGAGGGGGTGG - Intergenic
1171971766 20:31569315-31569337 CAGCTCCAGGACAGGGCAGGGGG + Exonic
1172010403 20:31843013-31843035 CAGTCTCAGAGCTGGGGTGGAGG - Intergenic
1172107921 20:32527705-32527727 CAGCCCCAGGCCTTGGCAGGAGG - Intronic
1172801997 20:37582297-37582319 CACCCTCAGGCCTGGAGATGGGG + Intergenic
1173021643 20:39272472-39272494 CAACCTTGGGGCTGGGGAGGAGG - Intergenic
1174085768 20:48006227-48006249 GAGGCGCAGGACTGGGGATGGGG + Intergenic
1174130450 20:48340456-48340478 CAGGCGCAGGACTGGGGATGTGG - Intergenic
1174597511 20:51695782-51695804 CAACCTCAGGAGTTGGGACGAGG - Intronic
1175939874 20:62532982-62533004 CACCTTCAGGCCTGGGGATGGGG - Intergenic
1176039317 20:63056063-63056085 CAGCCTCAGGACAGGGCTGGGGG + Intergenic
1176239119 20:64067818-64067840 CAGCCTCAGGACTGCAGAGATGG + Intronic
1176285427 21:5016688-5016710 CAGCCCCCGGCCGGGGGAGGCGG + Intergenic
1176309468 21:5142060-5142082 CAGCCTCAGGCCTGTTGGGGAGG - Intronic
1176382999 21:6122732-6122754 CTCCCTCAGCACTGGGGTGGAGG + Exonic
1176512002 21:7755710-7755732 TACCCTCAGGCCTGGTGAGGAGG - Intronic
1176666272 21:9690238-9690260 CAGCGCCAGGATTGGGCAGGAGG - Intergenic
1178646115 21:34386236-34386258 TACCCTCAGGCCTGGTGAGGAGG - Intronic
1178842153 21:36146395-36146417 CAGCATCAGGACTGTGGAGGAGG + Exonic
1178895062 21:36551076-36551098 CAGCCACCAGAGTGGGGAGGGGG + Intronic
1179294832 21:40052471-40052493 CAGCCTCATCACTGGTGAGGGGG - Intronic
1179740470 21:43415507-43415529 CTCCCTCAGCACTGGGGTGGAGG - Exonic
1179847592 21:44119973-44119995 CAGCCTCAGGCCTGTTGGGGAGG + Intronic
1179871754 21:44246787-44246809 CAGCCCCCGGCCGGGGGAGGCGG - Intronic
1179925910 21:44533939-44533961 CAGGCTCAGGACGGGGCTGGGGG + Intronic
1179992344 21:44954559-44954581 TTTCCTCAGGACTGCGGAGGTGG + Intronic
1180065208 21:45408926-45408948 CAGCCCCAGGCCTGCAGAGGAGG + Intronic
1180623950 22:17181602-17181624 CAGCCTCAGGGCAGGGGTTGGGG + Intronic
1180834435 22:18922781-18922803 AAGCCACAGGAGTGGGGAAGGGG + Intronic
1181030283 22:20146203-20146225 GGGCCTGAGGGCTGGGGAGGGGG - Intronic
1181065373 22:20303320-20303342 AAGCCACAGGAGTGGGGAAGGGG - Intergenic
1181465774 22:23109875-23109897 CAGCCTCAGGAACTGAGAGGTGG - Intronic
1181468091 22:23121181-23121203 CAGCCTCAGGTCTGGGGATGGGG - Intronic
1181513009 22:23397170-23397192 GGGCCTGAGGGCTGGGGAGGAGG + Intergenic
1181681473 22:24498603-24498625 CAGCCTCAGGGCTGGCTAGGCGG + Intronic
1182098009 22:27638889-27638911 CACCCACAGGCCTGAGGAGGAGG + Intergenic
1182359486 22:29738253-29738275 GAGCCTCAGGAAGGGGAAGGCGG + Intronic
1182755037 22:32672722-32672744 CAGCCTGTGAGCTGGGGAGGCGG + Intronic
1183947628 22:41335708-41335730 CAGGCTCAGGTGTGGGAAGGAGG + Intronic
1184129362 22:42508649-42508671 CAGCCTATGGACTGGGAAAGGGG + Intergenic
1184139561 22:42570742-42570764 CAGCCTATGGACTGGGAAAGGGG + Intronic
1184462751 22:44648636-44648658 CAGCCTGAGGTCTGGGGCCGAGG - Intergenic
1184559454 22:45253538-45253560 CAGCATCAGCCCTGCGGAGGTGG + Intergenic
1185032066 22:48449451-48449473 CAGCCACAGAACTCGGGAGAGGG + Intergenic
1185161820 22:49234594-49234616 CTCCCTCAGGCCTGGGGAGCAGG + Intergenic
1185274562 22:49944724-49944746 CAGCCTGAGGTCTGGGGTGGAGG - Intergenic
1203284524 22_KI270734v1_random:148080-148102 AAGCCACAGGAGTGGGGAAGGGG + Intergenic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
950112193 3:10426430-10426452 CAGGCTGAAGACTGGGGAGCTGG + Intronic
950226123 3:11235849-11235871 CAGCCAAAGGACTGGGAAAGAGG - Intronic
950720174 3:14876999-14877021 CAGCCTCAGGCAGGGGCAGGTGG + Intronic
950856370 3:16109487-16109509 AAGCAGCATGACTGGGGAGGTGG - Intergenic
953033578 3:39193028-39193050 CAGGCTCAGAACAGAGGAGGAGG - Intergenic
953383103 3:42489030-42489052 CAACTTGAGGACTGGGGAGTTGG + Intergenic
953416660 3:42724419-42724441 CAGCCTCAGGTCTGGAGAGGGGG - Intronic
954004955 3:47583345-47583367 CAGTTTCAGAACTGGGCAGGTGG - Intergenic
954106131 3:48410699-48410721 CAGCCTCTCATCTGGGGAGGGGG - Intronic
954385307 3:50241039-50241061 CTGCCTGAGGGCAGGGGAGGGGG - Intronic
954681332 3:52347566-52347588 CAACCTCAGCACAGGGGTGGGGG + Intronic
958449715 3:94258807-94258829 CAGCTTAAGGCCTGGTGAGGAGG + Intergenic
958480816 3:94643602-94643624 CAGACTCAGGGCTGTGGTGGAGG - Intergenic
961455721 3:127023000-127023022 CAGCCTCAGAAGGAGGGAGGAGG - Intronic
961462998 3:127064761-127064783 CACCCTCAGGACGGGGGCAGGGG + Intergenic
961517203 3:127445337-127445359 CAGCCCCAGGACTGGGAACTGGG + Intergenic
961872927 3:130001726-130001748 CAACCCCAAGACTGGGCAGGGGG + Intergenic
962169241 3:133083185-133083207 CAGGCTGAGGAGTGGGGCGGCGG - Intronic
962749684 3:138424675-138424697 GAGCCTCAGTGCTGGGGAGTGGG + Intergenic
967318983 3:188177275-188177297 CAGACCCAGGCCTGGGAAGGAGG + Intronic
967402178 3:189075604-189075626 CAGACTCAGAACTGGGGATAGGG - Intronic
968123498 3:196142394-196142416 CACACACAGGCCTGGGGAGGGGG - Intergenic
968451573 4:678491-678513 CAGCCTCAGGCCTGGGTAGCTGG - Intronic
968617647 4:1586436-1586458 CAGCTTCATGGCTGGGGGGGTGG - Intergenic
968913351 4:3486588-3486610 CAGCCCTGGGAGTGGGGAGGTGG + Intronic
968940221 4:3633804-3633826 CAGCCTCAGACCCAGGGAGGTGG - Intergenic
969016229 4:4106208-4106230 CAACCCCAAGACTGGGCAGGGGG + Intergenic
969050324 4:4368518-4368540 CAGCCCTGGGAGTGGGGAGGTGG - Intronic
969084041 4:4642014-4642036 CAGCCGCTGGACCGGGGTGGGGG - Intergenic
969503545 4:7569901-7569923 CATCCACAGGGGTGGGGAGGAGG - Intronic
969533547 4:7742098-7742120 TGGCCTCTGGAGTGGGGAGGGGG - Exonic
969737714 4:9002114-9002136 CAACCCCAAGACTGGGCAGGGGG - Intergenic
969796917 4:9533675-9533697 CAACCCCAAGACTGGGCAGGGGG - Intergenic
969994821 4:11301356-11301378 CAGGTCCAGGACTGGGGAAGAGG - Intergenic
972631485 4:40845960-40845982 CAGCTTCAGGGGTGGGTAGGTGG + Intronic
972958562 4:44422876-44422898 CAGCCTCAGGATGGTAGAGGTGG + Intronic
972992670 4:44841080-44841102 CAGTCTCAGGACAGTGTAGGGGG + Intergenic
973650611 4:52993983-52994005 CAGCCTCAGGGCTGGGAGGAGGG - Intronic
973782370 4:54300572-54300594 CAGACTCAGGGCTGTTGAGGTGG + Intergenic
977409053 4:96637972-96637994 CAACTGCAGGAGTGGGGAGGGGG + Intergenic
978127163 4:105147824-105147846 CAGGCGCAGGCCCGGGGAGGGGG + Intronic
978437991 4:108706590-108706612 CAGACTCAGGACTGTGGACTTGG - Intergenic
978528921 4:109694794-109694816 CATCCACATGATTGGGGAGGAGG + Intronic
978534988 4:109751241-109751263 CATCCTAAGAACTGGGGTGGGGG + Intronic
978739812 4:112123866-112123888 GAACCCCAGGTCTGGGGAGGGGG - Intergenic
979710549 4:123773792-123773814 CAGCTTCAGGGCTGCTGAGGTGG + Intergenic
980358405 4:131742736-131742758 CAGCCTCAGGCCTGCGGGGACGG + Intergenic
982120439 4:152138005-152138027 CTGCCTGAGGAATGGGTAGGTGG + Intergenic
982157231 4:152535289-152535311 CGCCCTCGGGACTGGGGCGGGGG + Exonic
984608306 4:181809858-181809880 CAGCCTCTGGAATGGAGAAGAGG + Intergenic
985397539 4:189559955-189559977 CTTGCTGAGGACTGGGGAGGAGG - Intergenic
985408749 4:189662098-189662120 CAGCGCCAGGATTGGGCAGGAGG + Intergenic
985890521 5:2711933-2711955 CAGACACAGGCCCGGGGAGGAGG - Intergenic
985996794 5:3601404-3601426 CAGCAGCAGGAGCGGGGAGGGGG - Intergenic
986054599 5:4123763-4123785 CAGTCTCAGGACTGAGCAGGAGG + Intergenic
986223180 5:5788673-5788695 CACCCTCACGACTGGTGAGTGGG - Intergenic
986320949 5:6632743-6632765 CTTCCTCAGGGCTGGGAAGGAGG - Exonic
989141666 5:38207655-38207677 CTGTCCCAGGACTGGGGATGTGG - Intergenic
989633998 5:43515198-43515220 CAGCCTCCGGAGTGGAGGGGCGG - Intergenic
991262525 5:64682799-64682821 CAGCAACAGGTCTGTGGAGGTGG - Intergenic
994296000 5:98089330-98089352 CAGCCTCTGGAGGGAGGAGGGGG - Intergenic
994883602 5:105529440-105529462 CAGACTCAGGACTGTTGGGGAGG - Intergenic
995396923 5:111696894-111696916 CAGCCACAGTACTGGGGACTAGG + Intronic
996010721 5:118478983-118479005 CAGACTCGGGACTGTTGAGGGGG + Intergenic
996642280 5:125770560-125770582 GAGCTCCAGGGCTGGGGAGGTGG + Intergenic
996766791 5:127042281-127042303 CACCTTCAGGACTTGGGAGGAGG - Intergenic
997399315 5:133590391-133590413 GAGATTCAGAACTGGGGAGGTGG + Intronic
997596050 5:135108080-135108102 CAGCATCAGGAGTGGAGTGGAGG - Intronic
997635379 5:135400187-135400209 CAGCCTGAGGACTGGGGGGTGGG - Intergenic
998060517 5:139115164-139115186 CAACCACAGACCTGGGGAGGGGG + Intronic
998151534 5:139760165-139760187 CAGGCCCAGGACTGGGGTAGGGG - Intergenic
1001425273 5:171618516-171618538 CAGCCCCAGGAAAGGGGAGGAGG - Intergenic
1001444177 5:171770433-171770455 CAGCCTGAGGTCTACGGAGGGGG - Intergenic
1001683446 5:173575581-173575603 CAGCATGGGGACTGGGCAGGAGG - Intergenic
1002061051 5:176626422-176626444 CAGCCACAGGACTGGTGAAGAGG - Exonic
1002586598 5:180252669-180252691 CACACTGAGGACTGGGGAGACGG + Intronic
1003540962 6:7017673-7017695 CAGCCCAGGGAGTGGGGAGGAGG + Intergenic
1004690643 6:17989343-17989365 CAGCAGCAGGAATGGAGAGGAGG - Intergenic
1005885989 6:30098199-30098221 CAGGATCAGGTCTGGGAAGGGGG + Intergenic
1006416977 6:33910497-33910519 CAGCCTCAGGCCTGTGGAGAGGG + Intergenic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1007251629 6:40499251-40499273 CATCATCAGGGCTGGGGAGATGG - Intronic
1007368861 6:41413272-41413294 CAGCAGCAGAACTGGGAAGGGGG - Intergenic
1007479710 6:42142153-42142175 CAGCCGCCGGGCAGGGGAGGAGG - Intronic
1007496839 6:42266001-42266023 CAGCTCCAGGAGTGGGGCGGTGG - Intronic
1007509232 6:42362779-42362801 CAGCTTCTGGAATGGGGCGGAGG - Intronic
1007750865 6:44070638-44070660 CATCCTCAGAGCTGGGGGGGAGG - Intergenic
1007777055 6:44229803-44229825 CAGGCTGGGGGCTGGGGAGGGGG - Intronic
1011726627 6:90216293-90216315 CAGCCGCTGGAATGGGGAGGAGG + Intronic
1015938974 6:138430639-138430661 CAGCCCCACGACGGGAGAGGAGG - Exonic
1018026473 6:159810328-159810350 CAGCTTCAGTAATGGGGAGAGGG - Intronic
1018179091 6:161205013-161205035 CAGCCTCACCACTGGGGACTGGG + Intronic
1018233128 6:161695110-161695132 CAGCCCCAGGACTGTGGACTAGG + Intronic
1018811860 6:167304227-167304249 CAGCCCCAGCCCTGGGCAGGTGG - Intronic
1018900514 6:168049680-168049702 CAGGCTCAGGAGAGGAGAGGAGG + Intergenic
1019006674 6:168803582-168803604 CAGCCTGTGGACTGGAAAGGCGG + Intergenic
1019478425 7:1255164-1255186 CCGCCCCAGGGCAGGGGAGGAGG - Intergenic
1019630583 7:2046829-2046851 GAGCCTCAGGTCTAAGGAGGAGG + Intronic
1020008015 7:4792458-4792480 CAGCCTCAGGACTATGGAGGGGG + Intronic
1020097507 7:5377071-5377093 GAGGTTCAGGACTTGGGAGGTGG - Intronic
1020274694 7:6616987-6617009 GAGGCTCAGGACTGGGGAGTTGG - Intronic
1020318726 7:6925117-6925139 CAGCCTGGGGACAGCGGAGGTGG + Intergenic
1021538671 7:21732944-21732966 CAGTCTCAGGCCTGGGCAGTGGG + Intronic
1021723843 7:23531500-23531522 AAGCCTCAGGGGTGGGGAGAAGG + Intronic
1021751857 7:23808894-23808916 TAGCCACAGGACTGGGAAGAGGG - Intronic
1022089168 7:27096538-27096560 CAGCCTCAGAACAGAGGAGGTGG - Intergenic
1022272644 7:28825047-28825069 TAGCCTCAGGACTGAGAATGTGG + Exonic
1022377021 7:29823809-29823831 CAGAAGCAGGACTGGGGTGGGGG - Intronic
1023938865 7:44757597-44757619 CAGCCTGAGGGCCTGGGAGGAGG + Intronic
1024109469 7:46130763-46130785 ATGCCACAGGAGTGGGGAGGAGG - Intergenic
1024993562 7:55254665-55254687 CGGCCTCAGGACTGGGAACGAGG - Intronic
1026193816 7:68154642-68154664 CAGCCTCGCTACTGGGCAGGAGG - Intergenic
1026628599 7:72018321-72018343 GAGACTCAGGACTGGGGGGTAGG - Intronic
1027219846 7:76206833-76206855 CAGCCTCTGCAGTGGGCAGGAGG - Intronic
1028465884 7:91151181-91151203 CAGCCTAAAGACTGGGGTGTGGG - Intronic
1028775651 7:94673251-94673273 CAGATCCAGAACTGGGGAGGAGG - Intergenic
1028995280 7:97093291-97093313 CAGGGACAGGCCTGGGGAGGTGG - Intergenic
1029074901 7:97927880-97927902 CAACCCCAAGACTGGGCAGGGGG + Intergenic
1029232043 7:99078518-99078540 CAGCCTGGGGGATGGGGAGGAGG - Intronic
1029248615 7:99220374-99220396 CAGCCCCAGGGCTGGGGAGCAGG - Intergenic
1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG + Exonic
1029540579 7:101180005-101180027 GGGCCTGGGGACTGGGGAGGGGG - Intronic
1029584302 7:101460493-101460515 CAGCCTCAGGCCAGGCGCGGTGG + Intronic
1029627250 7:101727723-101727745 CAGCCTCTGGCCCTGGGAGGAGG + Intergenic
1029640424 7:101816441-101816463 CCGCCGCGGGACCGGGGAGGGGG + Intronic
1032884556 7:136123740-136123762 GGTCCTCAGGACTGGGTAGGGGG + Intergenic
1033589308 7:142796916-142796938 AAGCCCCGGAACTGGGGAGGGGG + Intergenic
1033827037 7:145204234-145204256 CAGCTTCAGGCCTGGCGTGGTGG + Intergenic
1034224689 7:149473633-149473655 CAGCGTTAGGTCTGGGGAGATGG - Exonic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034305527 7:150042428-150042450 CACCCTCATCACAGGGGAGGAGG - Intergenic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1034878704 7:154747760-154747782 CAGCCTCAGCAATGCGGAGACGG + Intronic
1034972849 7:155429955-155429977 CTGCTTCAGGACTTGGCAGGAGG + Intergenic
1035006181 7:155662789-155662811 CAGCCTCAACAATGGGTAGGTGG + Intronic
1035229772 7:157458011-157458033 CAGCCTCGGGGCTGGGAACGCGG - Intergenic
1036242813 8:7093375-7093397 CAACCCCAAGACTGGGCAGGGGG - Intergenic
1036307293 8:7611528-7611550 CAGTCCCAGGATGGGGGAGGAGG + Intergenic
1036359497 8:8066853-8066875 CAACCCCAAGACTGGGCAGGGGG - Intergenic
1036668519 8:10764262-10764284 CAGACACAGGGCTGGGAAGGTGG + Intronic
1036829916 8:12013769-12013791 CAACCCCAAGACTGGGCAGGGGG + Intronic
1036891459 8:12600099-12600121 CAACCCCAAGACTGGGCAGGGGG + Intergenic
1036892814 8:12607431-12607453 CAGTCCCAGGATGGGGGAGGAGG - Intergenic
1037766247 8:21774184-21774206 CTGCCTGGGCACTGGGGAGGGGG - Intronic
1037895554 8:22651369-22651391 GAGCCTCACGGCTGGGGAGCAGG - Intronic
1037990366 8:23317421-23317443 CTGGATCAGGACTGGGGAGTGGG - Intronic
1038039841 8:23715237-23715259 CAGCCTCTTGCCTAGGGAGGGGG + Intergenic
1038122316 8:24631287-24631309 CAGACCTAGGACTGTGGAGGAGG - Intergenic
1038258217 8:25970517-25970539 GAGCCTGAAGAGTGGGGAGGGGG - Intronic
1038660487 8:29492727-29492749 AAGCCTCAGAACCAGGGAGGTGG + Intergenic
1039967061 8:42291117-42291139 CAGCCTCAGAGATGGAGAGGTGG - Intronic
1040457146 8:47610217-47610239 CAGCTGCAGGAATGGGGTGGGGG - Intronic
1042175746 8:66035783-66035805 CAGCCTCATGTTTGGGCAGGAGG + Intronic
1042175916 8:66036921-66036943 CAATCTCAGGACTGGGTGGGAGG - Intronic
1043226983 8:77745678-77745700 CAGCCTGAGGTTTGGGGAGGGGG - Intergenic
1044858668 8:96500194-96500216 CAGCCTCAGGGAAGAGGAGGAGG - Intronic
1045516902 8:102867544-102867566 CAGCCTCAGGCCTGGTGTGATGG - Intronic
1045588551 8:103566234-103566256 CAGCTACAGGAATGGGGAAGGGG - Intronic
1049191916 8:141293061-141293083 CAGCCTCAGTAGGGGGGTGGGGG - Intronic
1049240878 8:141536883-141536905 CAGCCACAGGGCAGGTGAGGTGG + Intergenic
1049404097 8:142443935-142443957 AAGCCTCAGGACCTGGGTGGAGG + Intergenic
1049849496 8:144823226-144823248 CAGCCACAGGACTGGGGTTTTGG - Intergenic
1049886253 9:29082-29104 AAGACGCAGGAGTGGGGAGGCGG + Intergenic
1049986345 9:955153-955175 TGGCCTGAGGACTGGGGAGGAGG + Intronic
1051187847 9:14479464-14479486 AAGCCTCAGGGCTGGGGACATGG - Intergenic
1051235450 9:14993759-14993781 GAGCCTCCGGCCTGGGGAGGAGG + Intergenic
1053148401 9:35727569-35727591 GTGCCCCAGGAGTGGGGAGGGGG - Intronic
1054450536 9:65401493-65401515 CAGCCTCAGACCCAGGGAGGTGG + Intergenic
1054847250 9:69810199-69810221 GAGGCTCGGCACTGGGGAGGAGG + Intergenic
1055604702 9:77956639-77956661 GAGCCCCAGGAAGGGGGAGGAGG + Intronic
1055649927 9:78397297-78397319 GAGGCTCAGGGCTGGGGAGTGGG - Intergenic
1057032118 9:91783903-91783925 CATTCAGAGGACTGGGGAGGAGG - Intronic
1057739171 9:97697062-97697084 CAGTCTGGGGACCGGGGAGGCGG + Intronic
1057839574 9:98474857-98474879 TAGCCTCTGGACTTGGGATGAGG - Intronic
1057999308 9:99848880-99848902 CAGACTGGGGCCTGGGGAGGTGG + Intronic
1058704570 9:107627862-107627884 CAGCCTTGGCACTGGGGAGAGGG - Intergenic
1059708901 9:116849288-116849310 CAACCTCTGAACTGGGGAGAAGG - Intronic
1060821582 9:126664396-126664418 CAGCCCCAGGGATGGGGGGGAGG + Intronic
1060982551 9:127802303-127802325 GAGGCCCAGAACTGGGGAGGAGG - Intronic
1061052798 9:128205960-128205982 CAGGCCCAGGGCAGGGGAGGGGG + Intronic
1061054768 9:128216637-128216659 CTGCCTCACGTCTGGGGAAGTGG - Intronic
1061368521 9:130185157-130185179 CACCACCAGGACTGAGGAGGAGG - Intronic
1061423856 9:130487039-130487061 GAACCTGAGGCCTGGGGAGGGGG - Intronic
1061700036 9:132409055-132409077 CAGCATCTGGCCTGGTGAGGTGG + Intergenic
1062233772 9:135498431-135498453 CAGCATCACAAATGGGGAGGAGG - Intronic
1062235613 9:135506313-135506335 CTGCCCCAGGAGTGGGGAGAGGG + Intergenic
1062287085 9:135778098-135778120 GAGCCCCAGGATTGGGGTGGAGG + Intronic
1062318299 9:135978652-135978674 CTGCCTCAGGGCTGCTGAGGAGG - Intergenic
1062366203 9:136210351-136210373 CAGTCTCATGACTGGGGTAGTGG + Intronic
1062439525 9:136563491-136563513 CTGGCTCTGGACTGAGGAGGTGG - Intergenic
1062629542 9:137457686-137457708 CCGCCTCAGGGCTGGGCAGCAGG + Exonic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1203659827 Un_KI270753v1:31523-31545 CAGCGCCAGGATTGGGCAGGAGG + Intergenic
1203663133 Un_KI270754v1:1328-1350 CTTGCTGAGGACTGGGGAGGAGG + Intergenic
1186270284 X:7879284-7879306 CAACCTCAGCACTGTGGAGTGGG - Intergenic
1186283899 X:8023622-8023644 AAGCCTGAGAACTGGGTAGGAGG - Intergenic
1189010711 X:37043517-37043539 CAGCCTCACAGCTGGGGTGGTGG + Intergenic
1192152973 X:68723599-68723621 GAGCCACAGGAGTGGGGATGGGG - Intronic
1192549322 X:72041568-72041590 CAGCCTCAGGAGAGTGGAGGGGG + Intergenic
1195310057 X:103624147-103624169 CAGCCTGAGGCCTGGGAAGGAGG - Intronic
1196048309 X:111279098-111279120 TAGCCACAGGACTGGGGAAAAGG + Intergenic
1196512159 X:116524326-116524348 CAGCCAGTGGACTGGGAAGGTGG - Intergenic
1196678737 X:118448532-118448554 CAGCCCCAGGACTGGAGTGCTGG - Intronic
1196757107 X:119167576-119167598 AAGCCTCAGGGCTGGGGAGGAGG + Intergenic
1196989218 X:121309357-121309379 CAGCATGAGGCCTGGGCAGGAGG + Intergenic
1197967141 X:132077317-132077339 CAGCCTCAGGAAGGAGGTGGTGG - Exonic
1198428384 X:136542035-136542057 CGGCCTCAGGACTGGGGCTGGGG - Intronic
1198629358 X:138617684-138617706 TATCCTCAGGACTTGGGAGGTGG + Intergenic
1199793311 X:151174886-151174908 AAGCCGCAGGATTGGGGTGGGGG + Intergenic
1199982641 X:152929266-152929288 CAGCCTCTGCCCTGGGGTGGGGG + Intronic
1199996179 X:153028193-153028215 GAGCCTGAGGAGAGGGGAGGAGG + Intergenic
1200123021 X:153800186-153800208 CACCCCCAGGCCTTGGGAGGGGG + Intergenic
1200243079 X:154507901-154507923 CAGCCTCAGGGCACGGCAGGCGG + Intronic