ID: 1062634955

View in Genome Browser
Species Human (GRCh38)
Location 9:137485844-137485866
Sequence CCATGTCCTTGCCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 339}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062634955_1062634965 13 Left 1062634955 9:137485844-137485866 CCAGCACAGTGGCAAGGACATGG 0: 1
1: 0
2: 3
3: 34
4: 339
Right 1062634965 9:137485880-137485902 GGACTTGAGAGTCCCCCAGAGGG No data
1062634955_1062634964 12 Left 1062634955 9:137485844-137485866 CCAGCACAGTGGCAAGGACATGG 0: 1
1: 0
2: 3
3: 34
4: 339
Right 1062634964 9:137485879-137485901 GGGACTTGAGAGTCCCCCAGAGG No data
1062634955_1062634966 20 Left 1062634955 9:137485844-137485866 CCAGCACAGTGGCAAGGACATGG 0: 1
1: 0
2: 3
3: 34
4: 339
Right 1062634966 9:137485887-137485909 AGAGTCCCCCAGAGGGTCCCAGG No data
1062634955_1062634962 -8 Left 1062634955 9:137485844-137485866 CCAGCACAGTGGCAAGGACATGG 0: 1
1: 0
2: 3
3: 34
4: 339
Right 1062634962 9:137485859-137485881 GGACATGGACCAGGGGGTCTGGG No data
1062634955_1062634961 -9 Left 1062634955 9:137485844-137485866 CCAGCACAGTGGCAAGGACATGG 0: 1
1: 0
2: 3
3: 34
4: 339
Right 1062634961 9:137485858-137485880 AGGACATGGACCAGGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062634955 Original CRISPR CCATGTCCTTGCCACTGTGC TGG (reversed) Intronic
900515105 1:3078033-3078055 CTCTGTCCTTGCCTCTGTCCTGG + Intronic
901863282 1:12088291-12088313 CTATGTGCTGGCCACTGTGCTGG + Intronic
901879332 1:12184877-12184899 ACCTGTGCTGGCCACTGTGCGGG + Intronic
902099599 1:13975044-13975066 CCATGTTCTAGGCACTGTGCTGG + Intergenic
903283584 1:22263788-22263810 CCGTGTCCCTGCCCCTGTTCTGG - Intergenic
903539536 1:24089382-24089404 CCATCCCCTTGCCTCTGTGTAGG + Intronic
903652185 1:24929222-24929244 CGGTGTCCTTGCCCCTGTCCCGG + Intronic
903744133 1:25575241-25575263 CCATGCTCTTTCCACAGTGCTGG - Intergenic
903995375 1:27302182-27302204 CCATGTGCCAGGCACTGTGCTGG + Intronic
904192626 1:28758812-28758834 CCCTCTCCTCACCACTGTGCAGG - Intronic
904323574 1:29712305-29712327 CTATGTACTGGGCACTGTGCTGG + Intergenic
904593068 1:31626065-31626087 CTATGTGCTTGACCCTGTGCTGG + Intronic
906215066 1:44033867-44033889 CCATGCCCTTCCCACCCTGCAGG - Intergenic
906748689 1:48239742-48239764 CTATGTGCTAGGCACTGTGCTGG + Intronic
909809430 1:79913082-79913104 CTATGTGCTTGACACTCTGCTGG + Intergenic
910460786 1:87445993-87446015 ACATGACCTTTCCTCTGTGCTGG - Intergenic
910683046 1:89887469-89887491 CCCTGTCCTGGCCATTGTCCTGG + Intronic
910875109 1:91871393-91871415 CCCTGTCCTGGGCACTGTTCAGG + Intronic
911924625 1:103814136-103814158 CTCTGTGCTTGGCACTGTGCTGG + Intergenic
912479866 1:109974602-109974624 CCATGTCCTAGCCGATGAGCCGG - Intergenic
913474444 1:119223417-119223439 CTATGTGCTTAGCACTGTGCTGG + Intergenic
913617136 1:120572217-120572239 CCAGGTCCTTGAAAATGTGCTGG - Intergenic
913697453 1:121341287-121341309 CCATGTTCCAGGCACTGTGCTGG + Intronic
914462532 1:147898229-147898251 CTGTGTGCTTGGCACTGTGCTGG - Intergenic
914573140 1:148938697-148938719 CCAGGTCCTTGAAAATGTGCTGG + Intronic
914858450 1:151368798-151368820 CCATGCCCTGGTCACCGTGCTGG + Intronic
915282341 1:154831089-154831111 CCATGTGCCAGGCACTGTGCGGG + Intronic
915899489 1:159836046-159836068 TCTTTTCCTGGCCACTGTGCTGG - Exonic
916074998 1:161195540-161195562 CCATGTCATGGCCCCTGTGATGG - Exonic
916578935 1:166090647-166090669 CCATGTGCTTGGTACTGTCCTGG + Intronic
917457624 1:175199001-175199023 CCATAACCTCGGCACTGTGCTGG + Intergenic
917849632 1:179049925-179049947 CTATGTGCTTAACACTGTGCTGG + Intronic
918060098 1:181053616-181053638 CATTGTCCTTGTCATTGTGCTGG + Exonic
918098103 1:181350848-181350870 CCATTTACTAGGCACTGTGCTGG + Intergenic
920651278 1:207839157-207839179 CCATGTACTAGGCACTGGGCTGG + Intergenic
920841568 1:209559729-209559751 CCATGTGCTAGATACTGTGCAGG + Intergenic
922408008 1:225338942-225338964 CTGTGTCCTCCCCACTGTGCAGG + Intronic
922425647 1:225490218-225490240 CCATGTCTTTGCCACCTTGTTGG - Exonic
923223884 1:231921308-231921330 CCATGTGCTCTTCACTGTGCTGG - Intronic
923355491 1:233151092-233151114 CTATGTCCTAGACACTGTTCTGG - Intronic
924020373 1:239774800-239774822 CAATGTCCTTTCCTCTGTGAAGG - Intronic
924459149 1:244243058-244243080 CCAGGTCCCAGCCACTGTGACGG - Intergenic
924553071 1:245096464-245096486 CCATGTGCCAGACACTGTGCTGG + Intronic
924672552 1:246144191-246144213 CCATGTCCCTGGCACTCTTCAGG + Intronic
1063384349 10:5606730-5606752 ACGTGTCCTCGCCACTGGGCAGG + Intergenic
1065064557 10:21947637-21947659 TCATGGACTTTCCACTGTGCTGG + Intronic
1065783577 10:29192751-29192773 CAATCTCCTTGCCACAGTGAGGG - Intergenic
1065854977 10:29822793-29822815 CCACGTCCCTGCCAGTATGCTGG - Intergenic
1067078728 10:43202410-43202432 CCATGCCCTAGGCCCTGTGCTGG - Intronic
1067192205 10:44081213-44081235 GCCTGTCCTGGCCACTTTGCTGG - Intergenic
1067237290 10:44461650-44461672 CCATGTCCGTTCCACCGTTCTGG - Intergenic
1068934276 10:62621017-62621039 CCACGTGCCTGGCACTGTGCTGG + Intronic
1070430382 10:76332065-76332087 TCATCTCCTTGCTACTTTGCAGG + Intronic
1072278926 10:93848493-93848515 ACATGTGCCTGCCACTGTGCTGG - Intergenic
1073792421 10:106954148-106954170 GCATGTTCTTTCCACTGTGCAGG + Intronic
1074413309 10:113246175-113246197 CAGTGTCCTTGACACTGAGCTGG - Intergenic
1074462453 10:113650723-113650745 CCATGTGCCAGGCACTGTGCTGG - Intronic
1074831937 10:117255393-117255415 CCATGACCTTGGCATCGTGCTGG + Intronic
1075644836 10:124090747-124090769 CCATGTCTGAGCCACTGTCCTGG - Intronic
1075659131 10:124181327-124181349 CCATATCCTCCCCACTGTCCAGG + Intergenic
1075966662 10:126617701-126617723 CCATGTCCTTGTCTGTGTCCTGG + Intronic
1076009398 10:126975307-126975329 CCATGTCCATCTCACTCTGCAGG + Intronic
1076980977 11:204633-204655 CCTTGGCCTAGCCACTGGGCTGG - Exonic
1077032177 11:473523-473545 CCTTCTCCTGGCCACTGGGCGGG + Intronic
1078902444 11:15654114-15654136 CCATGTGCCAGGCACTGTGCTGG - Intergenic
1079085555 11:17442482-17442504 CTATGTGCTGGACACTGTGCTGG - Intronic
1079131637 11:17750187-17750209 CCATGTGCCAGCCACGGTGCTGG - Intronic
1080226383 11:29965797-29965819 CTATGTGTTTGCCACTGTGGTGG - Intergenic
1082960352 11:58913475-58913497 CTATGTACTCACCACTGTGCTGG - Intronic
1085051347 11:73381788-73381810 CCATGTCCCAGCCCCTGTACAGG - Intronic
1086038307 11:82443442-82443464 CCATGTTCTTGACACTGCTCTGG - Intergenic
1086171102 11:83837172-83837194 CTACTTCATTGCCACTGTGCAGG + Intronic
1086518330 11:87640645-87640667 CCATGTCCTTTCCACCATGGTGG + Intergenic
1087563227 11:99817894-99817916 TCATGTCCTTGACTCTTTGCTGG - Intronic
1087896497 11:103592169-103592191 TCATGTGCTAGACACTGTGCGGG - Intergenic
1087900997 11:103640894-103640916 CCATGTTCTAGACTCTGTGCTGG + Intergenic
1088358455 11:108967320-108967342 TGATGTGCCTGCCACTGTGCTGG + Intergenic
1091047434 11:132336978-132337000 CCCTCACCTTGCCTCTGTGCGGG - Intergenic
1091965994 12:4742451-4742473 CCATGTGCTAGCCACTGGGCAGG + Intronic
1095508939 12:42928245-42928267 CCATGTGCTAGACACTGTGCTGG + Intergenic
1095708457 12:45262966-45262988 CCATGTACTTGCCCCTCTACAGG - Intronic
1097923123 12:65098545-65098567 CTATGTCCTGGGCATTGTGCTGG + Intronic
1100408786 12:94294334-94294356 CTATGTTCTGGGCACTGTGCTGG - Intronic
1100802083 12:98242672-98242694 CCTTGTATGTGCCACTGTGCTGG - Intergenic
1101572423 12:105966114-105966136 ACAGGTCCAGGCCACTGTGCAGG - Intergenic
1101933312 12:109033715-109033737 CCAGATCCCTGGCACTGTGCTGG + Intronic
1103179888 12:118901394-118901416 CCACGTGCCTGACACTGTGCTGG + Intergenic
1103550973 12:121737213-121737235 CCATGTCCCGTCCACTGTGATGG - Intronic
1103787058 12:123440552-123440574 CCAACTCCTGGCCACTGTGATGG - Intergenic
1104044859 12:125154534-125154556 CCATATGCTTGGCACTGTTCCGG + Intergenic
1104954956 12:132459825-132459847 CCCTGGCCTTGCCACCATGCCGG + Intergenic
1105327981 13:19387534-19387556 GCAGGTGCTGGCCACTGTGCTGG - Intergenic
1105585558 13:21739607-21739629 TCTTGTCCATGGCACTGTGCTGG - Intergenic
1105818243 13:24056598-24056620 CTATGTGCTAGACACTGTGCTGG - Intronic
1105863926 13:24442155-24442177 GCAGGTGCTGGCCACTGTGCTGG + Intronic
1106388255 13:29309145-29309167 CCATGTCTTTGCTATTGTGAAGG - Intronic
1107824081 13:44311948-44311970 CCATGTGCTGGCCACCGTGCTGG + Intergenic
1107962649 13:45572241-45572263 CCATGTCATGGCAGCTGTGCTGG + Intronic
1108228993 13:48318406-48318428 CCAGGTCCTCGTCACTGTCCAGG + Intronic
1108708324 13:53010134-53010156 CCATGTTCTGGGCACTGTGGGGG - Intergenic
1109786257 13:67179123-67179145 CTATGTCCTAGGCACTGTGTTGG + Intronic
1110076450 13:71250479-71250501 CTATGTGCTTGGCATTGTGCTGG - Intergenic
1110752620 13:79132660-79132682 CTATGTGCCAGCCACTGTGCTGG + Intergenic
1111858588 13:93671791-93671813 CAATGTCCTAGGCAGTGTGCTGG - Intronic
1112800549 13:103105107-103105129 ACAGGTACATGCCACTGTGCCGG - Intergenic
1113492096 13:110700199-110700221 TCATGTCCTTGACACTGTCAAGG - Intronic
1115775582 14:36711221-36711243 TCCTGTCCTGGTCACTGTGCTGG - Intronic
1116647854 14:47552427-47552449 CTATGTCCTTTCCATTGTTCAGG + Intronic
1116795219 14:49383046-49383068 CTATGTGCTAGGCACTGTGCTGG + Intergenic
1118029132 14:61802484-61802506 CCCTGTCCATGGCACTGGGCAGG - Intergenic
1119405471 14:74396047-74396069 CCATACCCTTCCCACTGTGCAGG - Intergenic
1119953314 14:78768684-78768706 CTATGTACTTAGCACTGTGCCGG - Intronic
1121618925 14:95332661-95332683 CTATGTACCAGCCACTGTGCTGG + Intergenic
1122215622 14:100202012-100202034 CTGTGTGCTTGGCACTGTGCTGG - Intergenic
1123488291 15:20760321-20760343 GCACTTCCTTTCCACTGTGCAGG + Intergenic
1123544789 15:21329394-21329416 GCACTTCCTTTCCACTGTGCAGG + Intergenic
1124666025 15:31593591-31593613 CCATGTCCTGGCCCCTAGGCTGG - Intronic
1126026189 15:44448253-44448275 CCGTGACCTTGCCTGTGTGCTGG + Intronic
1126100201 15:45114120-45114142 CCTTGGTCTCGCCACTGTGCAGG + Exonic
1126479292 15:49100023-49100045 ACATGGCCTTTCCTCTGTGCTGG + Intergenic
1128302959 15:66578704-66578726 CCAGGTCCTTGGCTCTGGGCTGG - Intergenic
1128358141 15:66942844-66942866 CCATGCGCCTGGCACTGTGCTGG + Intergenic
1128426652 15:67548089-67548111 GCATGCCATTGCCACTGAGCAGG + Intronic
1128633737 15:69289467-69289489 GCATGTCCTTGCCACAGGGGCGG - Intergenic
1129413411 15:75361917-75361939 CCATGGCCTCTCCACTGGGCAGG + Exonic
1129542750 15:76364329-76364351 CCTCGTCCTTGACACTTTGCTGG - Intronic
1129675716 15:77631773-77631795 CCATCTCCTTTTCACTGGGCAGG + Intronic
1129695706 15:77739620-77739642 CCAGGCCCCTGCCACTGTGACGG + Intronic
1130886826 15:88100139-88100161 CCATGTGCTGGCCCCAGTGCTGG + Intronic
1202953134 15_KI270727v1_random:56665-56687 GCACTTCCTTTCCACTGTGCAGG + Intergenic
1132802460 16:1761118-1761140 CTGTGTCCTTGCCTCTGTGCAGG - Intronic
1132846484 16:2003211-2003233 CCATGGCCTTGCATCTGTCCTGG - Intronic
1133379278 16:5316380-5316402 CCATGTTCTGGGCAGTGTGCTGG - Intergenic
1134640902 16:15828495-15828517 CCCTGTCCCTGGCACTGTGCGGG - Intronic
1135268678 16:21050261-21050283 TCATGTGCTGGACACTGTGCTGG - Intronic
1136021834 16:27445414-27445436 CCATGTGCTGGACACTGTGGAGG + Intronic
1136412896 16:30087100-30087122 CCCTGGCCTTGCCACTGGGAAGG - Intronic
1136424725 16:30162078-30162100 CCATGTGTTGGCCACTGTGCTGG + Intergenic
1137497970 16:48985495-48985517 CCATGTTCTAGGCACTGTTCTGG + Intergenic
1137809788 16:51342085-51342107 CCATGTTCTAGGCACTGTTCTGG - Intergenic
1138081319 16:54093815-54093837 CCATGTCCTTGCCACGTGCCTGG - Intronic
1138521699 16:57574965-57574987 CCATGACACTGTCACTGTGCTGG + Exonic
1139738840 16:69017316-69017338 CTATGTGTCTGCCACTGTGCTGG - Intronic
1141096745 16:81168337-81168359 CTATGTGCTGGGCACTGTGCAGG - Intergenic
1141607066 16:85159959-85159981 ACATGTGCTTGCCACTGTGTCGG + Intergenic
1141672338 16:85498853-85498875 CAATGGCCCTGCCACTCTGCAGG - Intergenic
1141776155 16:86123808-86123830 CCATGTCCTAGCCAGTGACCTGG - Intergenic
1142148078 16:88500856-88500878 CCAGGTCCTGGGCACAGTGCTGG + Intronic
1143283994 17:5775421-5775443 CTATGTGCCTGCCCCTGTGCTGG - Intronic
1144117501 17:12112640-12112662 CCATGTCCTTGTCACTATCCTGG - Intronic
1146407600 17:32552622-32552644 CTATGTCCTAGGTACTGTGCTGG + Intronic
1146904280 17:36608221-36608243 CCTTGTCCTTGTGTCTGTGCAGG + Exonic
1147157451 17:38551326-38551348 TGATGTCCTTGGCACTGTACTGG + Exonic
1147578525 17:41616127-41616149 CTATGTGCCTGGCACTGTGCTGG + Intergenic
1147857392 17:43492590-43492612 CCATGTGCATGGCACTGTACTGG + Intronic
1148990858 17:51666144-51666166 CCATGTGCCAGGCACTGTGCTGG + Intronic
1149830188 17:59865132-59865154 ACATATACGTGCCACTGTGCTGG + Intronic
1151039450 17:70841624-70841646 CCATGTTCTTGACACCCTGCAGG + Intergenic
1151458665 17:74241827-74241849 CCATGCCCTTTACCCTGTGCTGG - Intronic
1151834274 17:76573055-76573077 CCTTGTCCATGCCCGTGTGCTGG + Intronic
1152460674 17:80440685-80440707 CCATGTCCTTCCCACGATGGCGG + Intergenic
1153724417 18:7940612-7940634 CCATGGCCGCACCACTGTGCCGG - Intronic
1153760730 18:8329532-8329554 CCATGTACTTTCCAAAGTGCTGG + Intronic
1153779918 18:8485398-8485420 CCTGGTCCATGCCACTGTGATGG - Intergenic
1153890121 18:9505783-9505805 CCATATCCTTGCCAGTGTTAGGG + Intronic
1154445936 18:14435587-14435609 GCACTTCCTTTCCACTGTGCAGG + Intergenic
1156836307 18:41559342-41559364 CTATGTGCCTACCACTGTGCTGG + Intergenic
1156866295 18:41892427-41892449 CTATGTTCCAGCCACTGTGCTGG + Intergenic
1157283101 18:46358963-46358985 CTTTGTCCATGCCACTGTGTGGG + Intronic
1160392313 18:78543480-78543502 CCTTGTTCTTCCCACTGTGCTGG + Intergenic
1161262401 19:3345213-3345235 CCATGTGCCGGCCACTGTGCAGG - Intergenic
1163532010 19:17855506-17855528 CCCTGCCCTTCCCTCTGTGCTGG - Intergenic
1163623124 19:18372614-18372636 CTGTGTCCCTGGCACTGTGCTGG - Intergenic
1164876354 19:31693449-31693471 TCATTTCCCTGCCACTGGGCTGG + Intergenic
1165277567 19:34768184-34768206 CCATATGCTTGGCACTGAGCTGG + Intronic
1166040494 19:40199562-40199584 CCATGTGGCTGCCACTGTGCAGG + Intronic
1166804521 19:45477360-45477382 CCATGTCCCTGGCCCTGTTCTGG - Intronic
1167589210 19:50394158-50394180 CCATGTTCCAGCCACTGTGACGG + Intronic
1168210763 19:54888336-54888358 CCAGGGCCTTGCCACCGGGCAGG + Intronic
925982076 2:9185043-9185065 CCATGCACTCCCCACTGTGCTGG - Intergenic
926194003 2:10750551-10750573 CCTTGTCCTAGCCTCTGTGAAGG - Intronic
927433536 2:23047575-23047597 CCAGGCCCTTTCCACTTTGCTGG - Intergenic
927695126 2:25234629-25234651 CCATGTGCCAGGCACTGTGCTGG + Intronic
928859469 2:35839462-35839484 CCTTGTCCTTGCAATGGTGCAGG + Intergenic
929833639 2:45373872-45373894 ACATGTCCTTGCAACTGTTAGGG - Intergenic
931721379 2:65069881-65069903 TCCTTTCCTTGCTACTGTGCAGG + Intronic
931770485 2:65492927-65492949 CTCTGCCCTTTCCACTGTGCAGG + Intergenic
932793603 2:74676104-74676126 CAATGTCCTTGCCTCTCTGCTGG + Intronic
932856207 2:75236356-75236378 CCATGTCATTGCTATTGTGAAGG + Intergenic
934601955 2:95664423-95664445 CCATGTCCTTGCCACTCTGGTGG + Intergenic
935569715 2:104646342-104646364 CCATGTGCCTGCTACTGTTCTGG + Intergenic
935940120 2:108229243-108229265 CCATTTCCTTGAGACTGGGCTGG - Intergenic
936020132 2:108988462-108988484 CCATATCCTGGCCTCTGTGTTGG - Intronic
936025909 2:109031184-109031206 CCATTTCCTTTTCACCGTGCTGG + Intergenic
936075588 2:109399708-109399730 CCCTGTGCATGCCACTGTGAGGG - Intronic
936535314 2:113306578-113306600 CCATGTCCTTGCCACTCTGGTGG + Intergenic
938142496 2:128808197-128808219 GCAGGTGCCTGCCACTGTGCTGG + Intergenic
938368942 2:130756650-130756672 CCATCTCCTTGCCCCTGGGCAGG + Intronic
939319419 2:140597934-140597956 CCATGTCCCTACCACTGTACAGG - Intronic
939522560 2:143248687-143248709 CCATGTGTTAGCCACAGTGCTGG + Intronic
941111333 2:161421485-161421507 CCATATACTTTCCACTGTGCTGG - Intronic
941848846 2:170159013-170159035 CAATGTGACTGCCACTGTGCTGG - Intergenic
944315913 2:198285594-198285616 CCAGTGCCTTCCCACTGTGCTGG - Intronic
945831060 2:214785438-214785460 TCATGTGCTCACCACTGTGCTGG - Intronic
946541647 2:220690399-220690421 CCATGTGCCTGGCACTGTGTAGG - Intergenic
948630231 2:239297657-239297679 GCAAGTCCTTGGCACTGTGATGG - Intronic
948755459 2:240157217-240157239 CCAGGTCCTGCCCACTATGCTGG + Intergenic
1169017855 20:2306218-2306240 CTCTTTCCTTACCACTGTGCTGG + Intronic
1169642334 20:7767974-7767996 CCTTGTCCTTGCATCTGGGCAGG + Intergenic
1173497719 20:43531315-43531337 CCTTGTCCTTTCCTCTGTTCAGG + Intronic
1173826663 20:46052026-46052048 CCACGTGCCAGCCACTGTGCTGG + Intronic
1174572562 20:51512464-51512486 CCATGTGCCAGGCACTGTGCTGG - Intronic
1176181964 20:63753686-63753708 CCATGTACTTGCTGCTGTGCAGG + Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1176450042 21:6854270-6854292 GCACTTCCTTTCCACTGTGCAGG - Intergenic
1176828211 21:13719288-13719310 GCACTTCCTTTCCACTGTGCAGG - Intergenic
1178460458 21:32797634-32797656 CTATGTGCTAGGCACTGTGCGGG - Intronic
1180762863 22:18222612-18222634 CCAGGTCCTTGTCACTGTCCAGG - Intergenic
1180772783 22:18401935-18401957 CCAGGTCCTTGTCACTGTCCAGG + Intergenic
1180804162 22:18651551-18651573 CCAGGTCCTTGTCACTGTCCAGG + Intergenic
1180806612 22:18717926-18717948 CCAGGTCCTTGTCACTGTCCAGG - Intergenic
1181170822 22:21008895-21008917 CCATGTACTTGCCATGGTGAGGG + Intergenic
1181217558 22:21343708-21343730 CCAGGTCCTTGTCACTGTCCAGG - Intergenic
1181256695 22:21567598-21567620 CTGTGTGCTTCCCACTGTGCTGG - Intronic
1181937309 22:26448176-26448198 CCAGGTCCTTCTCCCTGTGCTGG + Intronic
1184376523 22:44117133-44117155 CCATGCCCCTGCCACGGGGCGGG - Intronic
1185110758 22:48898913-48898935 CCAAGTCCTTGCCACTGCCTGGG + Intergenic
1203234618 22_KI270731v1_random:142923-142945 CCAGGTCCTTGTCACTGTCCAGG + Intergenic
949216186 3:1570857-1570879 CCATGATCTTGCCACTGCACTGG - Intergenic
949979345 3:9491764-9491786 ACAGGTGCATGCCACTGTGCTGG - Intergenic
950115609 3:10448787-10448809 CCAATTCCCTGCCACTGGGCTGG - Intronic
950363142 3:12463964-12463986 CCAGGTCCCTGGCACAGTGCTGG + Intergenic
952300466 3:32100231-32100253 CTATGTGCTGGTCACTGTGCTGG - Intergenic
952546215 3:34422370-34422392 CCATGTGCCTGGCACTGTGATGG - Intergenic
954077942 3:48194937-48194959 CCCTGTCCTTCCCAAAGTGCTGG + Intergenic
954207796 3:49073396-49073418 CCAGGCACCTGCCACTGTGCCGG - Intronic
954710081 3:52501314-52501336 CCCTGTCCTTGCCTGTGTCCAGG + Intronic
954885091 3:53866143-53866165 CCTTGGCCTTGCCAAAGTGCTGG - Intergenic
955143737 3:56295282-56295304 GCAGTTCCTTGCCACTGTGGTGG - Intronic
956640883 3:71414339-71414361 CCAAGTGCTTTCCAATGTGCAGG - Intronic
961625326 3:128258323-128258345 CCCTGTCCTTCCCACGGTGCTGG - Intronic
961640939 3:128364521-128364543 CCATGGTCTTTCCACTGTCCTGG - Intronic
961834188 3:129643051-129643073 CAACGTCCCTGTCACTGTGCTGG + Intergenic
962379806 3:134888813-134888835 CCATGTGCTGGGCACTGTTCTGG + Intronic
962701170 3:138000861-138000883 CGAGGTCCTAGCCACTGGGCAGG - Intronic
962828466 3:139119741-139119763 CTATGTGCTTGGCCCTGTGCTGG + Intronic
962967109 3:140365538-140365560 CCATGTCCTTCCCACAGCCCAGG + Intronic
964527963 3:157635603-157635625 CTATGTTCTAGGCACTGTGCTGG - Intronic
965064949 3:163836116-163836138 ACAGGTACATGCCACTGTGCTGG - Intergenic
965851681 3:173034115-173034137 CCATGTTCCAGCCACTGTTCAGG + Intronic
966635550 3:182129570-182129592 CCATATCCTAGCAACTGAGCAGG - Intergenic
967022672 3:185536206-185536228 CCATGTGCTGGGCACTGTGAGGG - Intronic
967189575 3:186973873-186973895 CTGTGTGCTTGCCTCTGTGCTGG + Intronic
967896928 3:194403171-194403193 CCATGCCTTTGAAACTGTGCAGG + Exonic
968078396 3:195829784-195829806 CCGTGTTCTTGGCACTGCGCTGG + Intergenic
968515920 4:1015577-1015599 CCAGGTCATTGCCCCTGTGTGGG + Intronic
968718299 4:2178280-2178302 CCATGTACTGGGCACTGAGCTGG - Intronic
969175175 4:5393279-5393301 CCATGTGCCTGGCCCTGTGCTGG + Intronic
969244457 4:5923510-5923532 CCATCTGCTTGCACCTGTGCTGG - Intronic
969689545 4:8696606-8696628 CCATGTCCTTGGCATTGAGCAGG + Intergenic
970172020 4:13299717-13299739 CAATGTCCCAGACACTGTGCTGG - Intergenic
972816830 4:42655076-42655098 CTATGGCCCTGACACTGTGCTGG + Intronic
974345959 4:60681747-60681769 CTATGTCTCTGCAACTGTGCAGG + Intergenic
976263799 4:83171445-83171467 CCACATCCTTGCCACTGTCTTGG + Intergenic
976545070 4:86326095-86326117 CAATGTCATTGCCTCTGTGAAGG - Intronic
977722940 4:100262124-100262146 ATTTGTCCTTGCCAATGTGCTGG - Intergenic
979841952 4:125452618-125452640 CCATCACCTTGCCACAGTGGTGG + Exonic
980905012 4:138939802-138939824 CCATGACCTTGACAGTGTTCTGG - Intergenic
982346507 4:154366291-154366313 CAATGTTCTTGCCACTGACCAGG - Exonic
984526628 4:180866239-180866261 CCACCCCCTTGCCACTCTGCAGG - Intergenic
984825887 4:183924352-183924374 CCATGTCCTAGTCTCTGTGGGGG - Intronic
984860090 4:184230245-184230267 CCTGGTCCTAGCCACGGTGCTGG - Intergenic
985392508 4:189504935-189504957 CCATGTCCTTGTCCCTGGGTTGG - Intergenic
985508403 5:298390-298412 TCATGTCCTTGTAAATGTGCTGG - Intronic
987494077 5:18620106-18620128 CCATTTCCTGGCCATTGTGATGG - Intergenic
987546146 5:19312718-19312740 CAATGTCCTTCCCACTGTTAAGG + Intergenic
991484757 5:67123445-67123467 CTATGTGCCTGGCACTGTGCTGG + Intronic
991643776 5:68780011-68780033 TTATGAACTTGCCACTGTGCTGG - Intergenic
992157164 5:73966949-73966971 ACATGTATTTGCCACTGTGGGGG - Intergenic
992392853 5:76345327-76345349 CCATGTGCATGGCACTGTGCTGG + Intronic
992873012 5:81025106-81025128 CCATCTCCTTGGCACTGGGTGGG + Intronic
992874525 5:81040611-81040633 CCATGGTCTTGGCCCTGTGCAGG - Intronic
994509347 5:100684258-100684280 CAATGACTTTTCCACTGTGCAGG + Intergenic
997986092 5:138502651-138502673 CCAGGTGTGTGCCACTGTGCCGG - Intergenic
998001746 5:138631118-138631140 CCATCTCCTGGCCACTGTCATGG - Intronic
998404198 5:141864521-141864543 CACTGTCCTTGTCAATGTGCTGG - Exonic
998477095 5:142431308-142431330 CCACGTGCTGGGCACTGTGCTGG + Intergenic
999417365 5:151410218-151410240 CCTTGAGCTGGCCACTGTGCTGG - Intergenic
999417641 5:151413111-151413133 CCTTGAGCTGGCCACTGTGCTGG - Intergenic
999638220 5:153644518-153644540 CCATGTCCCAGACACTCTGCTGG + Intronic
1000085642 5:157885437-157885459 CCATCTCCTTCCCACTTTGATGG - Intergenic
1001634275 5:173198502-173198524 CCTTGTCCTTGGCACAGGGCTGG + Intergenic
1001966472 5:175913452-175913474 CCTTGTCCTTTCCACTGTGTGGG - Intergenic
1002250475 5:177925752-177925774 CCTTGTCCTTTCCACTGTGTGGG + Intergenic
1004276501 6:14241056-14241078 TCATGTCCTGACCACTGGGCTGG + Intergenic
1008264803 6:49411823-49411845 CCTTGGCCTTGACACTGTGAAGG + Intergenic
1008473670 6:51912511-51912533 CCATGCCCTAGACACAGTGCTGG - Exonic
1009393809 6:63173489-63173511 TCATGTCCTTCCCTCTGTCCTGG - Intergenic
1009870792 6:69450347-69450369 CCCCTTCCTTGCCACTTTGCAGG - Intergenic
1012985122 6:105867403-105867425 CCATGTGCTGGCCCCTCTGCCGG - Intergenic
1014144390 6:117980580-117980602 CTATATCCTTGGCACTGTGTTGG + Intronic
1015719488 6:136226647-136226669 ACAGGTGCGTGCCACTGTGCTGG - Intergenic
1017488653 6:154925128-154925150 CCATGCCCTTGCTACAGAGCAGG - Intronic
1018327059 6:162682325-162682347 CCATGTCTTTGCTATTGTGAAGG - Intronic
1018630852 6:165821134-165821156 CCATGTCCTTCCAATTGAGCAGG - Intronic
1020444472 7:8254948-8254970 CCATGGCCTTGGCACTGCGCTGG + Intronic
1022220303 7:28307725-28307747 CAATGTGCCTGGCACTGTGCTGG + Intronic
1026084419 7:67251335-67251357 CCATGCTCATGCCACTGTACTGG - Intergenic
1026586430 7:71659800-71659822 CAAGGTCATTGCAACTGTGCTGG + Intronic
1026692664 7:72563006-72563028 CCATGCTCATGCCACTGTACTGG + Intronic
1027396655 7:77763015-77763037 TCAAGTCCTTGCCACTGAGTTGG - Intronic
1027706624 7:81542280-81542302 CTATGTCCCTGGCACTGTGAGGG + Intergenic
1028721950 7:94043172-94043194 CCTACTCCTTCCCACTGTGCAGG + Intergenic
1028775797 7:94674508-94674530 ACATGACCTTTCCTCTGTGCGGG - Intergenic
1028895488 7:96036599-96036621 CTATGTCCTAGGTACTGTGCAGG - Intronic
1029451954 7:100646450-100646472 CCATGTCCTTCCTTCTGTTCTGG - Intronic
1030495279 7:110290933-110290955 CTATGTGCATGGCACTGTGCTGG + Intergenic
1031377598 7:121047481-121047503 CCATGTGCTAATCACTGTGCTGG + Intronic
1031520973 7:122765390-122765412 CCATGTTCTGGGCACTGTTCTGG - Intronic
1034288868 7:149911436-149911458 CCATGTGCCAGTCACTGTGCCGG - Intergenic
1034495772 7:151421253-151421275 ACAGGTACATGCCACTGTGCTGG - Intergenic
1034662208 7:152781430-152781452 CCATGTGCCAGGCACTGTGCCGG + Intronic
1035270217 7:157715326-157715348 CAGTGTCCTTGCATCTGTGCTGG - Intronic
1036565225 8:9932728-9932750 CTATGTCCTTCCCTCTGAGCAGG - Intergenic
1036712717 8:11091872-11091894 CGATGACCTTGGCATTGTGCTGG - Intronic
1037681008 8:21097389-21097411 CTATTTCCCAGCCACTGTGCTGG + Intergenic
1038155364 8:24984221-24984243 CAATGTGCTGGGCACTGTGCTGG - Intergenic
1041326219 8:56668070-56668092 CCATATGCTAGCTACTGTGCTGG + Intergenic
1042801284 8:72720668-72720690 CTATGTGCTAGTCACTGTGCTGG - Intronic
1044596331 8:93962415-93962437 ACAGGTGCCTGCCACTGTGCCGG + Intergenic
1045109964 8:98931028-98931050 CCATGTTTCTGCCACTGAGCTGG + Intronic
1045219115 8:100179593-100179615 CTTTGTCCTTGTCACTGTGTTGG + Intronic
1045706587 8:104930476-104930498 CCAAGTGCTGGACACTGTGCTGG - Intronic
1045922892 8:107553263-107553285 CCATCTCATTTCCACTGAGCAGG - Intergenic
1046767287 8:118083634-118083656 CTATGTCCTGGGGACTGTGCTGG - Intronic
1048540218 8:135335278-135335300 CCATGTACCAGGCACTGTGCTGG - Intergenic
1048777626 8:137964906-137964928 CCACGTGCAAGCCACTGTGCTGG + Intergenic
1050042193 9:1507715-1507737 CCATTTCTTGGCCCCTGTGCTGG + Intergenic
1050633956 9:7590307-7590329 CTATATGCTGGCCACTGTGCTGG + Intergenic
1051280070 9:15434057-15434079 CAATGTGCTAGGCACTGTGCTGG + Intronic
1052112278 9:24601258-24601280 GTCTGTCCATGCCACTGTGCTGG - Intergenic
1056183895 9:84112541-84112563 CCATGTCATTGCAAATGAGCAGG + Intergenic
1057142385 9:92735300-92735322 CCGAGGCCATGCCACTGTGCAGG - Intronic
1057872422 9:98728473-98728495 CCATGTGCCAGGCACTGTGCTGG + Intergenic
1059793970 9:117670763-117670785 CCATGTACTAGGCACTGTACTGG + Intergenic
1059899224 9:118904246-118904268 CCATATCATAGCCACTGTGTAGG - Intergenic
1060791193 9:126486799-126486821 CCAAGTCCTCCCCACTGTGACGG + Intronic
1061486965 9:130924899-130924921 GCCGGTCCTTGCCGCTGTGCTGG - Intronic
1061620634 9:131809360-131809382 CCATGTCCCTGACACTGTGCAGG - Intergenic
1061740638 9:132702787-132702809 ACAAGTGCATGCCACTGTGCCGG + Intergenic
1061942422 9:133890928-133890950 GCAGGTCCTTGCCAGTTTGCAGG - Intronic
1062231910 9:135486568-135486590 CCAGGTCCTCGTCACTGTCCAGG - Exonic
1062563583 9:137152699-137152721 CCATGTCCCTTCCCCTGGGCTGG - Intronic
1062634955 9:137485844-137485866 CCATGTCCTTGCCACTGTGCTGG - Intronic
1203519140 Un_GL000213v1:30247-30269 GCACTTCCTTTCCACTGTGCAGG + Intergenic
1185738479 X:2511671-2511693 CCAAGTCCTTGTCAGTGTCCTGG + Intergenic
1186543243 X:10422444-10422466 CAATGTCCCAGCCACTGTGCAGG - Intergenic
1186873721 X:13797179-13797201 CCATGTGCAAGCCACTGTGGTGG + Intronic
1187042996 X:15616748-15616770 CCATGTCCTTGCCCTTGGTCAGG - Intergenic
1187189449 X:17019683-17019705 CCAGGTGCTTGCCACCATGCTGG - Intronic
1187730987 X:22254434-22254456 CTATGTCCTAGGCACTCTGCTGG + Intergenic
1188030479 X:25258112-25258134 CTATGTGCCTGCCATTGTGCTGG - Intergenic
1189356713 X:40315179-40315201 CCATCTCCTAGCCACTGTAGTGG - Intergenic
1189361866 X:40359314-40359336 CGATATCCTGGCAACTGTGCTGG + Intergenic
1189578886 X:42384660-42384682 CCAAATGCTTGCCAATGTGCAGG + Intergenic
1190056629 X:47185048-47185070 CCATGTCCTTGGCAATCTGGGGG - Exonic
1190266182 X:48828417-48828439 CCATGTCCTTGCCACACAGTAGG + Intergenic
1190430776 X:50376050-50376072 CCATCTCATTGCCACTGTCTTGG + Exonic
1190778768 X:53577391-53577413 CTATGTGCCTGCCCCTGTGCTGG - Intronic
1192442706 X:71186447-71186469 AGATGTTCTTGCAACTGTGCAGG + Intergenic
1192578949 X:72264901-72264923 CCATGGCCTTTCCAAAGTGCTGG + Intronic
1192805543 X:74505518-74505540 CCATGTTCCTGCCTCTGAGCAGG - Intronic
1195964321 X:110416569-110416591 CCATTACCTTGACTCTGTGCTGG + Intronic
1198935054 X:141895995-141896017 CCATGTCCCTACCACTCTTCTGG - Intronic
1199571900 X:149274603-149274625 ACATTCCCTTGCCACTGTCCTGG - Intergenic
1199929940 X:152507681-152507703 CCATGTCCCTCCCACAGTGGAGG + Intergenic
1202603870 Y:26622078-26622100 GCAGGTGCTGGCCACTGTGCTGG + Intergenic