ID: 1062635175

View in Genome Browser
Species Human (GRCh38)
Location 9:137486873-137486895
Sequence GGGGGTCACCAGCAGCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062635175_1062635183 9 Left 1062635175 9:137486873-137486895 CCTGAGAGCTGCTGGTGACCCCC 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1062635183 9:137486905-137486927 AGCTCTCTTCCTGGCCCCAAGGG No data
1062635175_1062635188 25 Left 1062635175 9:137486873-137486895 CCTGAGAGCTGCTGGTGACCCCC 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1062635188 9:137486921-137486943 CCAAGGGTCCTGACCTCCTCAGG No data
1062635175_1062635180 0 Left 1062635175 9:137486873-137486895 CCTGAGAGCTGCTGGTGACCCCC 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1062635180 9:137486896-137486918 ACACCACACAGCTCTCTTCCTGG No data
1062635175_1062635182 8 Left 1062635175 9:137486873-137486895 CCTGAGAGCTGCTGGTGACCCCC 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1062635182 9:137486904-137486926 CAGCTCTCTTCCTGGCCCCAAGG No data
1062635175_1062635189 26 Left 1062635175 9:137486873-137486895 CCTGAGAGCTGCTGGTGACCCCC 0: 1
1: 0
2: 1
3: 22
4: 246
Right 1062635189 9:137486922-137486944 CAAGGGTCCTGACCTCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062635175 Original CRISPR GGGGGTCACCAGCAGCTCTC AGG (reversed) Intronic
901930972 1:12595888-12595910 GGGGGACCCCAGCAGCGCCCCGG - Intronic
902268445 1:15286023-15286045 GGTGGTTACCAGCGGCTCTGAGG + Intronic
902469459 1:16638427-16638449 GGTGGTAACCAGCAGGACTCAGG + Intergenic
902978347 1:20105621-20105643 GTGGGCAACCAGCAGCCCTCTGG + Intergenic
903291719 1:22318426-22318448 AGGGGCCTCCAGCAGCTCTGAGG + Intergenic
905314567 1:37073690-37073712 GGGGCTCACCAGCCTCTCTCAGG + Intergenic
906919472 1:50048358-50048380 TGGGGTCGCCAGGAGCCCTCAGG - Intronic
907283772 1:53367690-53367712 GGGTTCCCCCAGCAGCTCTCAGG - Intergenic
907388775 1:54142815-54142837 GGGGCTCCCCAGCAGCCCCCTGG + Intronic
907751110 1:57263977-57263999 GGAGGGCTCCAGGAGCTCTCAGG - Intronic
908984447 1:69999959-69999981 GGGTGGCAGCAGCAGCTTTCTGG - Intronic
910002239 1:82354763-82354785 GGGGGTCACAAGCTGCTCAGTGG + Intergenic
911847661 1:102774885-102774907 AGGGGCAACCAGCAGCCCTCAGG - Intergenic
913131325 1:115839886-115839908 GGGAGTCACATGCAGCTCTCTGG - Exonic
914914030 1:151807350-151807372 GGTGGTCCCCACCAGCTCTTTGG - Exonic
915927856 1:160037914-160037936 TGGGGTTACCAGCTGCTCTAGGG - Exonic
920495668 1:206453408-206453430 GGTGGTCCCCAGCTGCTCTATGG + Intronic
922422035 1:225466635-225466657 GTGGGCAACCAGCAGCCCTCAGG - Intergenic
922478365 1:225922209-225922231 TGGTGTCACCATCAGCTCTGTGG - Exonic
923712122 1:236395841-236395863 GGCGGTCAGCAGCCGCTCGCGGG - Intronic
924615145 1:245606200-245606222 GGTGGTCCCCAGCAACTCTGCGG - Intronic
1063929888 10:11018235-11018257 GGGCGTCGCCCGCAGCTCCCGGG + Intronic
1064098899 10:12446250-12446272 GTGGGAAACCAGCAGCCCTCGGG - Intronic
1070276864 10:75015778-75015800 TGGGGTCACCAGCTGCTTTTAGG - Intronic
1070536694 10:77384007-77384029 GTGCGTCACCATCAGCTCTCTGG + Intronic
1070610250 10:77927298-77927320 GGGGGTCTCCAGCAGCTTGTGGG - Intergenic
1070750283 10:78960009-78960031 GGGGGCCCACAGCAGCTCTGGGG + Intergenic
1070834316 10:79438381-79438403 GGTGGACACCAGCCGGTCTCAGG + Intronic
1071466019 10:85940420-85940442 GAGGGTTGCCAGCAGCTCTGGGG - Intronic
1072932109 10:99674475-99674497 GGTAGTTACCAGCAGCTCGCTGG - Intronic
1074035940 10:109738372-109738394 GGAGGTCACCTGCAGCTCATGGG + Intergenic
1074876634 10:117618680-117618702 ATGGGCAACCAGCAGCTCTCAGG + Intergenic
1074946531 10:118285732-118285754 GAGGGACAACAGCAGCTTTCTGG - Intergenic
1075141864 10:119844871-119844893 GTGGTTCACCAGGAGCTCTTAGG + Intronic
1075397576 10:122139021-122139043 GGTCATCACCAGCAGCTCTGCGG - Intronic
1075567109 10:123512780-123512802 GGGGCTCACCAGATGCTCTTCGG + Intergenic
1075888883 10:125928186-125928208 ATGGGTAACCAGCAGCCCTCGGG - Intronic
1076385500 10:130052240-130052262 GGGGGTCACATGCTGCTCTATGG + Intergenic
1076403182 10:130196485-130196507 GGGGGTCACCAGCAGGATACTGG - Intergenic
1076625025 10:131816418-131816440 GGGGGTGACCAGCTGCTGTTGGG - Intergenic
1077313267 11:1902806-1902828 ATGGGCAACCAGCAGCTCTCGGG - Intergenic
1077413001 11:2412127-2412149 GGGTGTCACCTGCAGGTCTGTGG - Exonic
1080871747 11:36242629-36242651 GGGGGTCACCATGAGTACTCAGG - Intergenic
1083045487 11:59731346-59731368 GGGACTCACTAGCAGCTCCCAGG - Intronic
1087732903 11:101798564-101798586 GGGAGCCACCAGCATCACTCAGG - Intronic
1088102532 11:106171028-106171050 AAGGGTAACCAGCAGCCCTCGGG + Intergenic
1091301527 11:134510912-134510934 GGGCGTCTCCAGCATCTGTCAGG - Intergenic
1091875725 12:3931492-3931514 GGGCTCCACCTGCAGCTCTCAGG + Intergenic
1093072934 12:14725086-14725108 GGGGGTCACAAGGTGCTCACTGG + Intergenic
1093585398 12:20829739-20829761 ATGGGTAACCAGCAGCCCTCGGG - Intronic
1096337288 12:50765909-50765931 AGGGGTAACCAGCAGCCCTTGGG + Intronic
1096592575 12:52670827-52670849 GGAGGTCACCAGTAGATCTGGGG + Intergenic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101504243 12:105331203-105331225 GGGGCTCACCTGCAGCTGGCGGG + Intronic
1101867586 12:108532318-108532340 GGGTGTCACCATGAGCTCTAAGG + Exonic
1102410713 12:112715847-112715869 ATGGGTAACCAGCAGCCCTCAGG - Intronic
1105886236 13:24644550-24644572 ATGGGTAACCAGCAGCCCTCGGG + Intergenic
1106304430 13:28496689-28496711 GGGAGTGACAAGCAGCTCTCAGG - Intergenic
1106482185 13:30144986-30145008 AGAGGGCACCAGCAGCTCTCTGG - Intergenic
1106567843 13:30901945-30901967 TGGGGACATCAGCAGCTCACAGG - Intergenic
1106659611 13:31784849-31784871 GGGGGACAGCAGCAGGGCTCAGG - Intronic
1107086302 13:36431444-36431466 GGGGGTCGGTGGCAGCTCTCCGG - Intergenic
1110938053 13:81317607-81317629 GGGGGTCACCTGCACCCCTCCGG - Intergenic
1113314808 13:109167259-109167281 TGGGCTCACCAGCATCTCACAGG + Intronic
1113358962 13:109610666-109610688 TGGGGCTTCCAGCAGCTCTCGGG - Intergenic
1113419540 13:110159930-110159952 GGGGGTCACCAGAGGCTGGCAGG + Intronic
1114080905 14:19200854-19200876 GGAGGCCCCCAGCAGCTCACTGG - Intergenic
1114764576 14:25356349-25356371 AGGGGCAACCAGCAGCTCTCTGG + Intergenic
1118947759 14:70403703-70403725 ATGGGCAACCAGCAGCTCTCAGG + Intronic
1119543240 14:75454153-75454175 GGACGTCACCAGCTCCTCTCGGG - Intronic
1119705882 14:76782262-76782284 TGGGGACAGCAGCAGCCCTCTGG + Exonic
1122141064 14:99663316-99663338 GTGGGCAACCAGCAGCCCTCGGG - Intronic
1122316392 14:100828130-100828152 GGGGGTGCCCAACAGGTCTCAGG - Intergenic
1122342081 14:101035051-101035073 TGGTGGCATCAGCAGCTCTCTGG + Intergenic
1122827657 14:104378587-104378609 GGGGGTCTCCAGCATCCCCCAGG - Intergenic
1123053420 14:105558792-105558814 GGGGGTCCCGAGCCGGTCTCTGG + Intergenic
1123077997 14:105679206-105679228 GGGGGTCCCGAGCCGGTCTCTGG + Intergenic
1202869708 14_GL000225v1_random:150462-150484 ATGGGTAACCAGCAGCCCTCGGG + Intergenic
1124001614 15:25765114-25765136 GGGGAGCACCAGCAGCCCTGTGG + Intronic
1126624229 15:50670701-50670723 GTGGGCAACCAGCAGCCCTCAGG + Intronic
1128290675 15:66476237-66476259 GAGGGTCCCCAGCAGCTGGCTGG - Intronic
1130980999 15:88811771-88811793 GGGGGTGAACAGCAGCCCCCTGG + Intronic
1131394746 15:92077447-92077469 GAGGGTCACCAGCTCCTCTGAGG - Intronic
1132338840 15:101065528-101065550 GGTGGTCAACAGCGGCTCTGAGG + Exonic
1132546529 16:535817-535839 GGGGGGCACATGCAGCTCACGGG + Intronic
1132744021 16:1429302-1429324 TGGGGTCACCTGCAGGTCCCAGG - Intergenic
1133228502 16:4354882-4354904 GGGGGTCAGCAGCATGTCCCTGG - Exonic
1133652196 16:7822884-7822906 ATGGGCAACCAGCAGCTCTCAGG + Intergenic
1133655374 16:7857348-7857370 AGGGGCAACCAGGAGCTCTCGGG - Intergenic
1133962448 16:10506193-10506215 GGGGGCAACCAGCAGCCATCAGG + Intergenic
1134058243 16:11183314-11183336 GGGGGTTTCCAGCAGCTGGCTGG - Intergenic
1134236934 16:12473911-12473933 ATGGGCAACCAGCAGCTCTCGGG + Intronic
1138511420 16:57510629-57510651 CAGGGTCACCAGGAGCTCTGGGG - Intergenic
1140016973 16:71196938-71196960 ATGGGTAACCAGCAGCCCTCAGG + Intronic
1140350076 16:74253754-74253776 GGAGGTCTCCAGCAGCCCTAAGG + Intergenic
1140641426 16:76977830-76977852 GTGGGCCACCAGCAGCCCTCAGG + Intergenic
1141502736 16:84455026-84455048 TGGGGTCACCAGCTTCTCCCTGG + Intronic
1142232049 16:88904624-88904646 GGAGGACACCACCAGCTCCCAGG - Intronic
1142364882 16:89644998-89645020 GAGAGTCACCAGCAGCTCTTGGG - Exonic
1142489758 17:270508-270530 GGAGGTGACCAGCAGCCCACTGG - Intronic
1143166047 17:4897730-4897752 GGGGGTCACCAGCCACTCCAGGG + Exonic
1147907064 17:43830265-43830287 AGGGGTCAGGAGCAGCTCTATGG + Intronic
1149296097 17:55264070-55264092 GGGGGTCGCACGCAGATCTCGGG + Intergenic
1150210548 17:63438976-63438998 GGGGGGCAGCAGCAGTGCTCTGG - Intronic
1151044317 17:70901452-70901474 GGGGCTCACTAGAACCTCTCAGG + Intergenic
1152438463 17:80290095-80290117 GGGAGGCACCAGCAGGTGTCTGG - Intronic
1152741009 17:82018316-82018338 GGGGCTGACCTGCACCTCTCTGG + Intergenic
1152928617 17:83099147-83099169 GGGTCTCACCAGCTCCTCTCAGG - Intergenic
1155303862 18:24459701-24459723 GGGGGTCCTCTGCAGATCTCTGG + Intergenic
1155582675 18:27328022-27328044 GGAAGGCACCAGCAACTCTCTGG - Intergenic
1156237068 18:35216200-35216222 GGGGGTCACAAGGTGCTCACTGG - Intergenic
1157441857 18:47717624-47717646 AGGTGTCACCAATAGCTCTCAGG + Intergenic
1157773619 18:50373366-50373388 GGGGGTCACCAGGTGCTCAGTGG - Intergenic
1160230266 18:77043531-77043553 CAGGGTCACCAGCAGGTCCCCGG - Intronic
1160745948 19:710635-710657 GGGGGGCAGCAGCTCCTCTCTGG - Intronic
1160865198 19:1253159-1253181 TGGGGACTCCAGCTGCTCTCGGG + Intronic
1160928491 19:1558589-1558611 GAGGGTCTCCAGTTGCTCTCTGG - Intronic
1161010197 19:1956135-1956157 GGTGGTGACCATCACCTCTCAGG - Intronic
1161338935 19:3730255-3730277 GGGGGACACCAGTCTCTCTCTGG - Intronic
1161838630 19:6665063-6665085 ACGGGCCACCAGCAGCTCCCGGG - Exonic
1162305288 19:9869265-9869287 TGATGTCACCAGCATCTCTCCGG + Intronic
1163296746 19:16417692-16417714 AGGAGGCACCAGCAGTTCTCGGG + Intronic
1166319329 19:42006621-42006643 TGGGGCCACCAGAACCTCTCAGG - Intronic
1166636885 19:44458451-44458473 GCAGCTCACCCGCAGCTCTCGGG - Intergenic
1166819887 19:45571552-45571574 GGAGGTCACCAGCAGCAGCCTGG + Intronic
925503334 2:4531727-4531749 GGGTGTCACCAGCTGCACTCAGG - Intergenic
926018828 2:9476673-9476695 GGGGGTCACAAGGTGCTCTGTGG + Intronic
926634796 2:15167451-15167473 GTGGGTCACGAGCACCTCTGAGG + Intronic
927198523 2:20564376-20564398 GCTGGTCACCAGCAGCCCTGAGG - Intronic
928280203 2:29939679-29939701 GAGGGGCAGCAGCAGCTCTCTGG + Intergenic
930694467 2:54397269-54397291 GGGGGTCACCAGTATCACACTGG + Intergenic
931930102 2:67122289-67122311 GAGGGTCCTCTGCAGCTCTCGGG + Intergenic
933614534 2:84470400-84470422 ATGGGCAACCAGCAGCTCTCAGG - Intergenic
937076137 2:119108292-119108314 GGAGGTCCCCAGCAGCTGGCAGG + Intergenic
938701087 2:133880719-133880741 GGGGATCCCTAGCAGCTCTTGGG + Intergenic
944591433 2:201221484-201221506 GGGGGTCACAAGGTGCTCACTGG - Exonic
945491930 2:210466276-210466298 GGGGGTCATAAGGACCTCTCAGG + Intronic
948615587 2:239196730-239196752 GGTGGCCACCTCCAGCTCTCAGG + Intronic
948661700 2:239511049-239511071 GGGGGCCTTCTGCAGCTCTCTGG + Intergenic
1170740168 20:19049217-19049239 GGCTGTCAGCAGCAGCGCTCAGG + Intergenic
1170876593 20:20255409-20255431 GGGGGTCACTAGCAGCTGACAGG + Intronic
1171364818 20:24616593-24616615 GGGGAGCAGCAGCAGCTCCCAGG + Intronic
1173302670 20:41817806-41817828 GGGGGTATCCAGCAGGTCTTTGG - Intergenic
1173577677 20:44123575-44123597 GGGGTATACCAGCAGCTCACGGG + Intronic
1175628268 20:60508491-60508513 GTGGGGCACCAGCAGCCTTCTGG - Intergenic
1176072002 20:63232003-63232025 GTGGGCAACCAGCAGCCCTCAGG - Intergenic
1176146397 20:63567407-63567429 GGTGGTCACCACCACCTCCCAGG - Exonic
1176413389 21:6461045-6461067 GGGTGTCATCAGCATCTCCCTGG - Intergenic
1177536486 21:22434531-22434553 ATGGGCAACCAGCAGCTCTCGGG - Intergenic
1178666244 21:34549546-34549568 GAGGGTCACCAGCACCACTCTGG - Intronic
1178859850 21:36279539-36279561 CAGGGCCACCAGCAGCCCTCTGG - Intronic
1179688886 21:43069368-43069390 GGGTGTCATCAGCATCTCCCTGG - Intronic
1179929631 21:44558627-44558649 GGGGGCTCACAGCAGCTCTCTGG + Exonic
1179931495 21:44573855-44573877 GGGGGCTCGCAGCAGCTCTCTGG - Exonic
1179932672 21:44580490-44580512 GGGGGCTCACAGCAGCTCTCTGG + Exonic
1179934253 21:44592351-44592373 GGGGGCTCACAGCAGCTCTCTGG + Exonic
1179935381 21:44600733-44600755 GGGGGCTCGCAGCAGCTCTCTGG - Exonic
1179939175 21:44627238-44627260 GGGGGCTCACAGCAGCTCTCTGG - Exonic
1179942020 21:44646525-44646547 GGGGGCTCACAGCAGCTCTCTGG - Exonic
1179948615 21:44697298-44697320 GGGGGCTCACAGCAGCTCTCTGG - Exonic
1179949579 21:44702262-44702284 GGGGGCTCGCAGCAGCTCTCCGG - Intronic
1179957265 21:44748673-44748695 GCAGGGCATCAGCAGCTCTCAGG + Intergenic
1180245212 21:46542717-46542739 GGGGTTCACGGGCAGCTGTCAGG + Intronic
1180674604 22:17578597-17578619 TGGTGTCAGGAGCAGCTCTCCGG - Intronic
1181555772 22:23670961-23670983 GGGGGTGCCCAGCAGCCCTGGGG + Intergenic
1182087819 22:27573672-27573694 GGGGGTCACCGGCAGTATTCGGG + Intergenic
1183000199 22:34850635-34850657 ATGGGCAACCAGCAGCTCTCGGG + Intergenic
1183690266 22:39384252-39384274 GAGGATCACCAGCAGCTGGCTGG - Exonic
950183538 3:10931455-10931477 GGGGGTCAGGAGCAGGTCTGAGG - Intronic
950956236 3:17056142-17056164 AGGGGTCACGAGTAACTCTCAGG + Intronic
952377143 3:32777353-32777375 ATGGGCAACCAGCAGCTCTCAGG + Intergenic
954299979 3:49695785-49695807 GGTGGTAACCAGCAGGACTCAGG - Intronic
956907416 3:73781214-73781236 ATGGGTAACCAGCAGCTCTCAGG + Intergenic
959161831 3:102733251-102733273 GTGGGCAACCAGCAGCCCTCAGG + Intergenic
961001110 3:123374693-123374715 GGGGGGCAGCAGCATCTGTCTGG + Intronic
961362021 3:126374001-126374023 CGGGGTCACCAGCTGTTCTCTGG + Intergenic
961864042 3:129940669-129940691 GGGGTTCACCTGCATCACTCTGG + Intergenic
963672732 3:148272130-148272152 ATGGGTAACCAGCAGCCCTCAGG - Intergenic
968064904 3:195753246-195753268 GGAGGTCAGCAGCAGCGCGCAGG + Intronic
969114089 4:4860432-4860454 GGAGGCCACCAGGAGCCCTCGGG - Intronic
975528367 4:75375595-75375617 GTGGGTAACCAGCAGCCCTCAGG + Intergenic
976150322 4:82084835-82084857 GGGGGTCACCTTCAGGCCTCAGG + Intergenic
977468162 4:97408107-97408129 GAGGGTCACCAGTAGCTCCAGGG + Intronic
978259541 4:106738165-106738187 TGTGGTCACCAGGAGCTGTCAGG + Intergenic
979378173 4:119974008-119974030 GGTGGTTACCAGCAGCTGACAGG + Intergenic
980928032 4:139158170-139158192 GGGGGTCACCAGGTGCTCAGTGG + Intronic
985880662 5:2636644-2636666 GGGGGTTAGCAGCAGGTCTGGGG - Intergenic
987915312 5:24205214-24205236 GGGGCTTGCCAGGAGCTCTCTGG + Intergenic
988007725 5:25439223-25439245 GGGTGTAACCAGCATCTATCTGG - Intergenic
990312855 5:54556035-54556057 GGGTACCACCAGCAGCTCTTTGG + Intergenic
992433658 5:76734267-76734289 GGCGGACACATGCAGCTCTCAGG - Exonic
993639103 5:90380828-90380850 TGGGGCGACCAGCAGCCCTCGGG - Intergenic
998093073 5:139382191-139382213 AGTGGTCAGCAGTAGCTCTCTGG - Intronic
998349888 5:141493671-141493693 GGGAGTCACCAGCACCATTCTGG - Intronic
998501673 5:142638101-142638123 GTGGGTCACCAGCTGTCCTCAGG - Intronic
999188642 5:149730887-149730909 GGGGGCCAGCAACAGCACTCTGG - Intronic
999253169 5:150194735-150194757 GGGGGTCATCAGCAGGTCTGGGG - Exonic
1000884974 5:166740234-166740256 GGGGGTCACAAGGTGCTCACTGG + Intergenic
1001050285 5:168408563-168408585 GTGGTCCAGCAGCAGCTCTCTGG + Exonic
1002342720 5:178527394-178527416 GGGGGTCAACCGCTGATCTCAGG - Intronic
1002633115 5:180594046-180594068 GTGGGTCCCCAGCAGCGCTTGGG + Intergenic
1003260942 6:4515658-4515680 GGAGCTCAGCAGCAGCTCTGGGG - Intergenic
1003664767 6:8100810-8100832 GTGGGTGAGCAGCAACTCTCTGG - Intronic
1003873970 6:10421189-10421211 AGGGCGCACCTGCAGCTCTCCGG + Intergenic
1004594934 6:17090638-17090660 GGGGATCCTCTGCAGCTCTCCGG + Intergenic
1005463911 6:26093345-26093367 TGGGGACACCAGCAGCTCCCTGG + Intronic
1007072111 6:39045451-39045473 GGGTGTCGGCACCAGCTCTCAGG + Intergenic
1007627692 6:43255514-43255536 GGGAGTCACCTGCAGCTCTCAGG - Intronic
1014944603 6:127482093-127482115 ATGGGTAACCAGCAGCCCTCAGG + Intronic
1016233095 6:141830180-141830202 GGGGGTCACAAGGTGCTCTGTGG - Intergenic
1018213824 6:161507550-161507572 GGCTGTCCCCAGCAGCTGTCTGG - Intronic
1018721085 6:166573055-166573077 CGGGGTGCCCAGAAGCTCTCGGG + Intronic
1019569701 7:1705135-1705157 GGGTGTGACCTGCAGCCCTCAGG - Intronic
1019918609 7:4149277-4149299 CTGGGGCACCAGGAGCTCTCTGG - Exonic
1021451033 7:20784320-20784342 GGGGGGCTGCAGCAGCTCTGGGG + Exonic
1023090700 7:36614936-36614958 GGAGGAACCCAGCAGCTCTCAGG + Intronic
1023764320 7:43496639-43496661 AGGGGTCACCATCTGCTCTTGGG - Intronic
1024256902 7:47546103-47546125 CGGGGTCCGCCGCAGCTCTCTGG - Intronic
1024949225 7:54840809-54840831 GAAGGTAAACAGCAGCTCTCTGG - Intergenic
1025041113 7:55646511-55646533 GGGGGTCACAAGCAGCCATCAGG - Intergenic
1025111231 7:56218035-56218057 ATGGGTAACCAGCAGCCCTCAGG + Intergenic
1026253762 7:68693020-68693042 ATGGGCAACCAGCAGCTCTCAGG + Intergenic
1026288387 7:68984122-68984144 ATGGGTAACCAGCAGCCCTCTGG + Intergenic
1026841301 7:73671234-73671256 GGGGGCCACCAGCAGTGCCCCGG + Exonic
1027958480 7:84913433-84913455 ATGGGTAACCAGCAGCCCTCGGG + Intergenic
1029489036 7:100860385-100860407 GGGGTTCACCAGCACCTTGCAGG + Intronic
1029496985 7:100901026-100901048 AGGAGTGACCAGGAGCTCTCTGG - Intergenic
1029526194 7:101095479-101095501 GGGTGGAAACAGCAGCTCTCCGG + Intergenic
1029527030 7:101100957-101100979 TTGTGCCACCAGCAGCTCTCTGG - Intergenic
1030189548 7:106796551-106796573 ATGGGCAACCAGCAGCTCTCGGG - Intergenic
1030224098 7:107129701-107129723 ATGGGCAACCAGCAGCTCTCGGG - Intronic
1034265946 7:149780692-149780714 GGGGGTCACCTCCAGCTCAGGGG + Intergenic
1034666492 7:152822354-152822376 GGGGGTCACCTGCTGCTATGCGG + Intronic
1036750109 8:11438300-11438322 TGGGGTCAGCTGCAGCTCCCTGG + Intronic
1036908034 8:12724300-12724322 AGGGGTTTCCAGGAGCTCTCTGG - Intronic
1038399787 8:27274708-27274730 GGGCGTCACCAGTTTCTCTCCGG + Intergenic
1039752695 8:40492838-40492860 GGGGGTCACCAGTCTCTCCCTGG - Intergenic
1040900484 8:52412794-52412816 GGGCCTCAACATCAGCTCTCAGG - Intronic
1041593906 8:59623886-59623908 GCGTGTCACCAGCACTTCTCAGG + Intergenic
1041652129 8:60311773-60311795 GGGGGTCACCAGGTGCTCAGTGG + Intergenic
1042959601 8:74289496-74289518 TGGGGGCACCAGCAGCACTGTGG - Intronic
1044458508 8:92416809-92416831 GTGGTTTGCCAGCAGCTCTCGGG + Intergenic
1046440473 8:114246866-114246888 GGGGGTCACAAGGTGCTCACTGG - Intergenic
1046511575 8:115210854-115210876 GTGGGCAACCAGCAGCCCTCAGG + Intergenic
1048937882 8:139371836-139371858 GTGGGCCAGCAGCAGGTCTCTGG + Intergenic
1049410462 8:142471737-142471759 GGCGGGCACCAGCAGATCTCAGG - Intronic
1052521573 9:29554423-29554445 GTGGGCAACCAGCAGCCCTCAGG + Intergenic
1057580879 9:96286889-96286911 GTGGGCAACCAGCAGCCCTCAGG + Intronic
1058178668 9:101769261-101769283 GGAAGGCACCAGCAGCTGTCAGG + Intergenic
1059784320 9:117564072-117564094 GCAAGTCAGCAGCAGCTCTCAGG - Intergenic
1059900489 9:118920619-118920641 GGGGGACACAAGCACCTCTGGGG + Intergenic
1060054593 9:120402764-120402786 GGGGGGCACAAGCTGCTCCCTGG - Intronic
1060913676 9:127370852-127370874 GGGAGTCAGCAGCAGCACACTGG - Intronic
1061294162 9:129667854-129667876 GGGTCTCCCCAGCAGCTCCCTGG + Intronic
1061594442 9:131619855-131619877 GGGTGTGACCAGCAGCTGGCAGG + Intronic
1061862085 9:133473313-133473335 GGGGGTCTCCAGCAGCTCAGCGG - Intronic
1061950069 9:133931237-133931259 GGAAGGCACCAGCAGCTCTGGGG + Intronic
1062331240 9:136045867-136045889 GGGGCTCCCCAGCTGCGCTCAGG - Intronic
1062635175 9:137486873-137486895 GGGGGTCACCAGCAGCTCTCAGG - Intronic
1185703661 X:2250412-2250434 ATAGGCCACCAGCAGCTCTCGGG - Intronic
1187150570 X:16677904-16677926 AGGGGCAACCAGCAGCCCTCAGG + Intronic
1189433783 X:40973070-40973092 ATGGGCAACCAGCAGCTCTCGGG + Intergenic
1189619911 X:42825114-42825136 GGGGGTCTGAAGCAACTCTCCGG - Intergenic
1189965501 X:46368433-46368455 ATGGGCAACCAGCAGCTCTCAGG - Intergenic
1193647718 X:84089266-84089288 AGGGGTGACCACCAACTCTCTGG - Intronic
1198382608 X:136098586-136098608 GGGCGACACGAGCGGCTCTCCGG + Intergenic
1201234534 Y:11896505-11896527 GGGGGTCACCAGGTGCTCAGTGG + Intergenic
1201261194 Y:12160502-12160524 ATGGGTCACCAGCAGCCCTCAGG + Intergenic
1201328816 Y:12796634-12796656 ATGGGTAACCAGCAGCCCTCAGG - Intronic
1202625846 Y:56857671-56857693 ATGGGTAACCAGCAGCCCTCGGG + Intergenic