ID: 1062636320

View in Genome Browser
Species Human (GRCh38)
Location 9:137493503-137493525
Sequence CCCCAACCGTGCCCTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062636320_1062636322 -6 Left 1062636320 9:137493503-137493525 CCTGCTTCAGGGCACGGTTGGGG 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1062636322 9:137493520-137493542 TTGGGGACATTTGTCCTGACTGG No data
1062636320_1062636325 16 Left 1062636320 9:137493503-137493525 CCTGCTTCAGGGCACGGTTGGGG 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1062636325 9:137493542-137493564 GACCAAACGGTCCCCACACCAGG No data
1062636320_1062636329 25 Left 1062636320 9:137493503-137493525 CCTGCTTCAGGGCACGGTTGGGG 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1062636329 9:137493551-137493573 GTCCCCACACCAGGGGTTGCTGG No data
1062636320_1062636328 18 Left 1062636320 9:137493503-137493525 CCTGCTTCAGGGCACGGTTGGGG 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1062636328 9:137493544-137493566 CCAAACGGTCCCCACACCAGGGG No data
1062636320_1062636326 17 Left 1062636320 9:137493503-137493525 CCTGCTTCAGGGCACGGTTGGGG 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1062636326 9:137493543-137493565 ACCAAACGGTCCCCACACCAGGG No data
1062636320_1062636323 3 Left 1062636320 9:137493503-137493525 CCTGCTTCAGGGCACGGTTGGGG 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1062636323 9:137493529-137493551 TTTGTCCTGACTGGACCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062636320 Original CRISPR CCCCAACCGTGCCCTGAAGC AGG (reversed) Intronic
900567197 1:3339343-3339365 GCGCATCCGTGCCCGGAAGCAGG + Intronic
901055117 1:6445728-6445750 TCCCAATCGTGCCCCGAGGCAGG - Exonic
902942690 1:19812001-19812023 CCCCATCGTTGCCCTTAAGCAGG - Intergenic
905105447 1:35560982-35561004 GCGCAACCCTGCACTGAAGCTGG + Exonic
905423878 1:37867858-37867880 CCCCACCCATTCCCAGAAGCTGG + Intronic
906206869 1:43991730-43991752 CCCCACCCGTGCTCTGCCGCTGG - Exonic
907912213 1:58836577-58836599 CCCCAACCATTTCCTGGAGCTGG + Intergenic
909761148 1:79288965-79288987 CCCTGACCTTACCCTGAAGCAGG + Intergenic
913158668 1:116125850-116125872 CCCACACCCTGCCCTGCAGCTGG - Intronic
920007803 1:202846017-202846039 CCCCAACAGGGCTCGGAAGCAGG + Intergenic
920312495 1:205056819-205056841 CCCCTGCCCTGCCCTGCAGCAGG + Intronic
924038926 1:239964148-239964170 CCCCACCCCTGCCCTGCTGCAGG - Intergenic
1063203613 10:3809633-3809655 CCCCAACCATGTCATGAAGAGGG + Intergenic
1064958451 10:20937612-20937634 CACCAAGCGTGAGCTGAAGCAGG + Intronic
1065131914 10:22630761-22630783 CCCCAACAGTCCTCTAAAGCTGG + Intronic
1065198485 10:23290024-23290046 CCCACAGCCTGCCCTGAAGCAGG - Intronic
1065605984 10:27418420-27418442 CACCAAGCGTGAGCTGAAGCAGG + Intergenic
1067702822 10:48585966-48585988 GCCCAACAGCGCCCTGAAACTGG + Intronic
1072726363 10:97816506-97816528 CCCCAGCTGTGCCTGGAAGCAGG - Intergenic
1073099127 10:100997884-100997906 CCCCAGCCCTGCCCAGCAGCCGG - Intronic
1075904257 10:126066758-126066780 CACCACCTGTACCCTGAAGCCGG - Exonic
1076796336 10:132800094-132800116 CCCCACCCAGGCCCTGCAGCCGG - Intergenic
1081645198 11:44785522-44785544 CCCCCACCGCCCCCTGAAGCAGG + Intronic
1083921891 11:65785913-65785935 CCCCATCCCTGCCCTTAAGTAGG + Intergenic
1084499319 11:69525460-69525482 CCACAACCAGACCCTGAAGCAGG - Intergenic
1085025925 11:73236607-73236629 CCCCAACCCTGCCTTGAGCCTGG - Intergenic
1086840011 11:91673404-91673426 CCCCACTCCTCCCCTGAAGCAGG + Intergenic
1090445745 11:126763392-126763414 ACCCAACAGTGCTCTGATGCAGG + Intronic
1091777213 12:3192365-3192387 CCCCAGGCGAGCCATGAAGCAGG + Intronic
1091934864 12:4427169-4427191 CCCCACCCCTGCCCTAAATCTGG + Intergenic
1092697098 12:11184385-11184407 CCACAGCTGTGCCCTGGAGCCGG - Intergenic
1093493020 12:19726125-19726147 GCCCACCCGTGGCCTGAAGGTGG + Intergenic
1096509258 12:52118536-52118558 CTCCATCTGTGACCTGAAGCTGG + Intergenic
1097191178 12:57220330-57220352 CCCCCACCGCGCCCCGGAGCCGG + Intronic
1098930726 12:76409241-76409263 CTCTGACCTTGCCCTGAAGCAGG + Intronic
1103356866 12:120328047-120328069 CCCCAACCAGCCCGTGAAGCTGG - Intergenic
1106431545 13:29685362-29685384 CCCCTACCCTGCTGTGAAGCAGG + Intergenic
1106617222 13:31340750-31340772 CACCAAGCGTGAGCTGAAGCAGG + Intergenic
1120190689 14:81436652-81436674 CCCCAACCAGACCCCGAAGCTGG + Intergenic
1122873104 14:104650525-104650547 CCCCAAACGGACACTGAAGCGGG + Intergenic
1125507725 15:40276637-40276659 CCCCAGCCATGGCCTGGAGCAGG - Exonic
1128675544 15:69605747-69605769 TCCCAACTGTCCTCTGAAGCAGG + Intergenic
1128677574 15:69622987-69623009 CACCAAGCGTGAGCTGAAGCAGG - Intergenic
1128759591 15:70207018-70207040 CCCCCAGCATGCCCTGCAGCAGG + Intergenic
1131261595 15:90890708-90890730 CCCCAACCCGCTCCTGAAGCAGG - Intronic
1132880610 16:2160236-2160258 CCCCCACCGTCCCCTCCAGCTGG - Intronic
1133068741 16:3231096-3231118 CTCCACCCGTACCCTGAAGCTGG - Intronic
1133212359 16:4270770-4270792 CCCCAACCCTGCCCAGGATCAGG + Intronic
1138583504 16:57956492-57956514 CTCCATGAGTGCCCTGAAGCCGG - Intronic
1140481382 16:75264754-75264776 CCCCATCCTTTCCGTGAAGCAGG - Intronic
1141410636 16:83830505-83830527 CCCCAACCCTGATCTGAAGGTGG + Intergenic
1142969980 17:3604755-3604777 CCCCTACCCTGCCCTGAACTGGG + Intergenic
1143109238 17:4544195-4544217 TGCCAACAGTGCCCTGGAGCTGG - Intronic
1143109253 17:4544255-4544277 TGCCAACAGTGCCCTGGAGCTGG - Intronic
1144167060 17:12623317-12623339 CCTCACCCGTGCCCTGGAGAAGG + Intergenic
1144563855 17:16343965-16343987 ACCCAAGCAGGCCCTGAAGCGGG + Intronic
1145274961 17:21423699-21423721 ACCCTACCCTGCCCTGCAGCAGG - Intergenic
1145312815 17:21709599-21709621 ACCCTACCCTGCCCTGCAGCAGG - Intergenic
1147374626 17:40016319-40016341 CCCCAGCCAGGCCCTGCAGCTGG + Exonic
1148187030 17:45651557-45651579 CCCCAACCCTTCACTAAAGCAGG - Intergenic
1148830843 17:50429999-50430021 CCCCAGACCTGCCCTAAAGCTGG + Intronic
1150124585 17:62627941-62627963 CCCCGCCCGGGCCCTGAAGTTGG - Intronic
1150309370 17:64115318-64115340 CTCCAACCCTGCCCCTAAGCTGG + Intronic
1151595303 17:75074752-75074774 CCACAACCGGCTCCTGAAGCTGG + Intergenic
1152623409 17:81377575-81377597 CCCCAACCAAGCCCTGAAGCTGG + Intergenic
1155677022 18:28441432-28441454 CCCCTACCTTGCCCTAGAGCAGG + Intergenic
1156404793 18:36773581-36773603 CCACAACCGTCCCAGGAAGCTGG - Intronic
1158521794 18:58177182-58177204 CCACGCCCGTGCCCTGAATCTGG + Intronic
1158685799 18:59613167-59613189 CCCCATCCATGCCCTGCAGCTGG - Intronic
1160837689 19:1132426-1132448 CCCCACCCGTGCCCCGCCGCAGG + Intronic
1161337872 19:3723973-3723995 CCCCATCTGTCCCCTGAATCTGG - Intronic
1162367868 19:10260110-10260132 CCCCAACAGTGCCCAGAACCTGG - Intergenic
1163018256 19:14469903-14469925 CCCCAACAGGGACCTGAAGTTGG + Exonic
1163477873 19:17537527-17537549 ACCCACCTATGCCCTGAAGCCGG - Exonic
1167306795 19:48714359-48714381 CCCTCACCGAGCCCTGACGCCGG + Exonic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
926360802 2:12084867-12084889 GCACAACCATGCCGTGAAGCAGG + Intergenic
930597941 2:53411058-53411080 CACCAAGCGTGAGCTGAAGCAGG + Intergenic
931860844 2:66352846-66352868 CACCAAGCGTGAGCTGAAGCAGG - Intergenic
932589923 2:73059158-73059180 CCCCAACCTTGCCCCAGAGCAGG + Intronic
933721209 2:85398752-85398774 CCCCAAGCCTGCTCTGAAGGAGG - Exonic
936531113 2:113277728-113277750 CCCCACCTGCGCCCGGAAGCAGG - Intronic
937507191 2:122550894-122550916 CACCAAGCGTGAGCTGAAGCAGG + Intergenic
938263470 2:129910914-129910936 CCCCACCCCTGCACTGACGCTGG + Intergenic
941965965 2:171301596-171301618 TCCCAACAGTGCTCTGCAGCTGG + Intergenic
942461271 2:176170577-176170599 CCCCAAACTTGCCCTGGACCTGG - Intronic
942556590 2:177178192-177178214 CCCCAACCTGGCCATGAAGGAGG + Intergenic
944661917 2:201928602-201928624 CCCCAACCCTTCCATGGAGCAGG + Intergenic
946091306 2:217226303-217226325 CCTCCATCCTGCCCTGAAGCAGG + Intergenic
946279962 2:218659565-218659587 CCCCACTCCAGCCCTGAAGCCGG + Intronic
946339062 2:219056928-219056950 CTCCCCCTGTGCCCTGAAGCTGG - Intronic
947715326 2:232336288-232336310 CCCCAACTCTGCCCTGACCCAGG + Intronic
947742264 2:232490061-232490083 ACCCAACTGCTCCCTGAAGCTGG - Intergenic
1170483665 20:16793805-16793827 CACCAAGCGTGAGCTGAAGCAGG - Intergenic
1173623074 20:44451263-44451285 CCCCATCCTTGCCCTCAAGCTGG + Intergenic
1175221775 20:57421370-57421392 CCCTAACCTCACCCTGAAGCTGG + Intergenic
1175860447 20:62147642-62147664 CCCCAACCCTGCCCCGCAACAGG - Intronic
1177893998 21:26840175-26840197 CCCCATCCGTGTCCTCTAGCAGG - Intronic
1179808410 21:43854647-43854669 CCCCACCCGGGCCCTGATACAGG - Intergenic
1180991963 22:19942185-19942207 CCCCAACCCAGTCTTGAAGCGGG - Intronic
1182239135 22:28900780-28900802 CACCAACCCTGCCCGGAAGGAGG - Intronic
1184073901 22:42163934-42163956 CCTCATCCGTGGCCTGAACCCGG + Intronic
1184568763 22:45309485-45309507 CCCCAACCCAGACCTGAGGCTGG - Exonic
1184749812 22:46478885-46478907 GCCCAACCCAGCCCTGCAGCAGG + Intronic
1184784728 22:46666151-46666173 CCCCAACCCTGGCCTGAGTCAGG + Intronic
1184924866 22:47629926-47629948 CCCCAACAGTGGCCAGAAGGCGG + Intergenic
1185171325 22:49296280-49296302 CCACAAGCTTGCCCTGAAGGTGG + Intergenic
950130901 3:10546213-10546235 CCCCAACTGCCCCCTGGAGCTGG + Intronic
954816605 3:53286946-53286968 CCCCAGTCCTGCCCTGCAGCAGG - Exonic
955423602 3:58764504-58764526 CACCGACCGTGAGCTGAAGCAGG - Intronic
957604197 3:82376264-82376286 CACCAAGCGTGAGCTGAAGCAGG - Intergenic
958801675 3:98763460-98763482 CCACAACCTTCCCCTTAAGCAGG - Intronic
960397093 3:117151168-117151190 CACCGACCTTCCCCTGAAGCAGG - Intergenic
961044296 3:123698367-123698389 CCCCAACCTTGTCCTGAGGATGG + Intronic
962611119 3:137077028-137077050 CACAAACCATGCCATGAAGCTGG - Intergenic
969241368 4:5900628-5900650 CTCCAACCGTGCCATGGGGCAGG - Intronic
971241257 4:24891009-24891031 CCCCAGCCGAGCCCTGTGGCTGG + Intronic
971586031 4:28406956-28406978 CACCAAGCGTGAGCTGAAGCAGG + Intergenic
985989749 5:3545898-3545920 CATCAACAGTGCCCTCAAGCTGG - Intergenic
987595535 5:19993011-19993033 CTCCAAACCTGCCCTGAAACTGG + Intronic
992631119 5:78682112-78682134 CACCAAGCGTGACCTAAAGCAGG + Intronic
995108887 5:108405856-108405878 TGCCAACCTTCCCCTGAAGCAGG + Intergenic
996643441 5:125786647-125786669 ACACAACAGTGCCCTGAAACTGG - Intergenic
996675333 5:126168350-126168372 CCCCAACACTGCCCAGATGCAGG + Intergenic
1004127340 6:12886614-12886636 CCCCAACCATGCACTGATGTGGG - Intronic
1007614523 6:43172190-43172212 CCCCAACCGGGCCCCGGGGCCGG - Intronic
1007717386 6:43865162-43865184 GCCAGACCCTGCCCTGAAGCTGG - Intergenic
1011303133 6:85896928-85896950 CACCAAACGTGAGCTGAAGCAGG - Intergenic
1012052360 6:94361663-94361685 CCCCAACCCTGCTCTGAGACTGG + Intergenic
1015620357 6:135125882-135125904 CTCCAACTGTGCCCTGAAAGAGG - Intergenic
1019578904 7:1750519-1750541 ACCCAGCCTTGCCCTGCAGCTGG + Intergenic
1019648243 7:2142340-2142362 CCCCAACCCAGCCCTGCACCAGG - Intronic
1022474400 7:30700400-30700422 GCCCAACCCTGTGCTGAAGCAGG - Intronic
1023142896 7:37120298-37120320 CACCAAGCGTGACCCGAAGCAGG + Intronic
1032603734 7:133327176-133327198 CACCAAGCGTGAGCTGAAGCAGG - Intronic
1036146091 8:6256208-6256230 GCCCAAGGCTGCCCTGAAGCAGG + Intergenic
1036787928 8:11700353-11700375 CCGGAACCGTGCTCTGCAGCCGG - Intronic
1037770473 8:21796194-21796216 CCCCAGCCTTGTCCTGAAGTTGG + Intronic
1038005654 8:23427738-23427760 CCCCTAGCGTCCCCTGCAGCAGG + Intronic
1038006961 8:23439540-23439562 GTCCCACCGTGCCCTGAAGGAGG - Intronic
1039825793 8:41173178-41173200 GGCCCACCATGCCCTGAAGCTGG + Intergenic
1040059639 8:43093417-43093439 CTCCGGCCGTGCACTGAAGCCGG - Intergenic
1040445061 8:47485020-47485042 CACCAAGCGTGAGCTGAAGCAGG + Intronic
1041654005 8:60330553-60330575 CCCCACCCCTGCCCTGCTGCTGG - Intergenic
1049020026 8:139950115-139950137 CCCCCACGGTCACCTGAAGCTGG - Intronic
1049848733 8:144819477-144819499 CCCCAACAGTGGCCTGGGGCAGG - Intergenic
1050525595 9:6543740-6543762 CCCCAACATTGCCCTATAGCAGG - Intronic
1052033692 9:23657000-23657022 CCTCAACCCTGCCCTTAGGCTGG - Intergenic
1052466877 9:28840045-28840067 CCACAACCCTGCTCTGAAACTGG + Intergenic
1055478616 9:76688104-76688126 CCTCACCCCTGCCCTGAAGCTGG + Intronic
1059425083 9:114215980-114216002 CCCCAACCGTGTGCTCCAGCGGG - Intronic
1061826394 9:133260913-133260935 CCCCACCGGAGCCCTGGAGCAGG + Intronic
1062058895 9:134483962-134483984 CACCCACCGTGCCCTGGAGAAGG - Intergenic
1062581293 9:137230344-137230366 GCCCAACCCTGCCCTGAACCCGG + Intergenic
1062636320 9:137493503-137493525 CCCCAACCGTGCCCTGAAGCAGG - Intronic
1185816302 X:3159377-3159399 CTCTAACCTTTCCCTGAAGCAGG + Intergenic
1188036120 X:25318898-25318920 CACCAAGCGTGAGCTGAAGCAGG - Intergenic
1190116468 X:47628935-47628957 TCCCAACCCTGCCATGCAGCTGG + Intronic
1191232659 X:58108244-58108266 CACCAAGCGTGAGCTGAAGCAGG + Intergenic
1197412608 X:126138262-126138284 CCACAACAGTGCACTGAAGAGGG + Intergenic
1200099678 X:153684448-153684470 CCCCATCCCTGCCCTGCTGCAGG + Intronic
1200243078 X:154507900-154507922 CGCCTGCCGTGCCCTGAGGCTGG - Intronic
1201265153 Y:12199250-12199272 CTCTAACCTTTCCCTGAAGCAGG - Intergenic