ID: 1062636696

View in Genome Browser
Species Human (GRCh38)
Location 9:137495204-137495226
Sequence CACCGGAGGCTGTCAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 673}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062636696_1062636704 18 Left 1062636696 9:137495204-137495226 CCTGTCCCTGACAGCCTCCGGTG 0: 1
1: 0
2: 2
3: 64
4: 673
Right 1062636704 9:137495245-137495267 GACACCCCATCCACACCGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 98
1062636696_1062636709 24 Left 1062636696 9:137495204-137495226 CCTGTCCCTGACAGCCTCCGGTG 0: 1
1: 0
2: 2
3: 64
4: 673
Right 1062636709 9:137495251-137495273 CCATCCACACCGCAAGGCGGAGG 0: 1
1: 0
2: 0
3: 9
4: 93
1062636696_1062636705 21 Left 1062636696 9:137495204-137495226 CCTGTCCCTGACAGCCTCCGGTG 0: 1
1: 0
2: 2
3: 64
4: 673
Right 1062636705 9:137495248-137495270 ACCCCATCCACACCGCAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062636696 Original CRISPR CACCGGAGGCTGTCAGGGAC AGG (reversed) Intronic
900563808 1:3322629-3322651 GACTGGAGGCTGCCAGGCACTGG - Intronic
900706028 1:4080812-4080834 CACCGGGGCCTGTCAGGGTGTGG + Intergenic
901773970 1:11546507-11546529 CACTGGGGGCTGGCAGAGACTGG - Intergenic
902138610 1:14333042-14333064 CACCAGGGCCTGTCAGGGAGTGG - Intergenic
902276877 1:15346182-15346204 CACAGGAGGCAGCCAGGGCCAGG - Intronic
902361399 1:15944256-15944278 CACCGGCGGCTGCCAGGCGCTGG + Intronic
903180724 1:21603566-21603588 TACCGGATCCTGGCAGGGACTGG + Intronic
903225897 1:21894163-21894185 GAGGGGAGGCTATCAGGGACGGG + Intronic
903594770 1:24485636-24485658 CACCGGGGCCTGTCAGGGGTGGG - Intergenic
903608095 1:24589692-24589714 CACCAGTGTGTGTCAGGGACAGG + Intronic
905135745 1:35798326-35798348 CACTGGGGACTGTCAGGGAGTGG - Intergenic
905457793 1:38100488-38100510 CCCAGGAGGCTGCCAGGGACAGG - Intergenic
905528462 1:38657137-38657159 CAAGGGAAGCTGTCAGGGAGGGG + Intergenic
905966860 1:42105457-42105479 CACTGGAGCCTGTCAGGGGGTGG + Intergenic
906528943 1:46512308-46512330 CAGCGGCTGCTGACAGGGACTGG - Exonic
906893759 1:49748167-49748189 CACCGGAGCCTGTCAGGGGGTGG - Intronic
907631460 1:56087202-56087224 CACTGGGGGCTGTCAGGGGTTGG + Intergenic
907813105 1:57891830-57891852 CACCGGGGCCTGTCAGGGGGTGG + Intronic
908044350 1:60152457-60152479 CACCAGAGGCTCTCATGGAATGG + Intergenic
908083612 1:60607279-60607301 CACTGGGGCCTGTCAGGGATTGG + Intergenic
909310279 1:74137927-74137949 CACCGGGGCCTGTCAGGGGGTGG + Intronic
909498933 1:76311436-76311458 CACCGGGTCCTGTCAGGGAATGG - Intronic
910068009 1:83177002-83177024 CACCGGAGCCTGTTAGGGGATGG - Intergenic
910177738 1:84449064-84449086 CACCAGGGCCTGTCAGGGGCTGG + Intergenic
910748608 1:90601821-90601843 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
910913088 1:92258738-92258760 CACCGGGGCCTGTCAGGGTTCGG + Intronic
911050691 1:93668453-93668475 CACCAGAGGCCACCAGGGACCGG + Intronic
911252216 1:95589799-95589821 CACTGGGGCCTGTCAGGGATAGG + Intergenic
911488827 1:98536816-98536838 CACCGGGGTCTGTCAGGGGATGG - Intergenic
911720804 1:101189327-101189349 CACCAGAGCCTGTCAGGGGATGG + Intergenic
911772714 1:101767249-101767271 CACTGGGGCCTGTCAGGGAATGG + Intergenic
912073476 1:105842638-105842660 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
912750892 1:112286546-112286568 CACCGGAGCCTGTCATGGGGTGG + Intergenic
912864123 1:113241790-113241812 CACCGGGGCCTGTCGGGGAGTGG + Intergenic
914282307 1:146187034-146187056 CACTGGAGCCTGTCAGGGGGTGG - Intronic
917367957 1:174254493-174254515 CACCGGGGCCTGTCAGGGTTCGG - Intronic
918403140 1:184184593-184184615 CACCGGAGCCTGTCATGGGGTGG - Intergenic
920461736 1:206145782-206145804 CAGGGGAGGCTGTTAGGGCCAGG - Intergenic
920604645 1:207369897-207369919 CACCAGGGCCTGTCAGGGAGTGG + Intergenic
921323299 1:213965190-213965212 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
921484317 1:215697983-215698005 CACTGGGGCCTGTCAGGGGCTGG - Intronic
921551890 1:216546961-216546983 CACCGGGGCCTGTCAGGGGATGG - Intronic
921753074 1:218819927-218819949 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
921830990 1:219727422-219727444 CACTGGGGCCTGTCAGGGAGTGG - Intronic
921833341 1:219752409-219752431 TACCAGAGGCTGACATGGACTGG + Intronic
922048155 1:221966669-221966691 CTCCGGAGCCGGTCACGGACTGG + Intergenic
922290864 1:224207957-224207979 CTCCTGAGGCTGTCATGAACTGG + Intergenic
922372765 1:224927971-224927993 CACCAGGGCCTGTCAGGGATTGG + Intronic
923294070 1:232575997-232576019 CAACGGTGGCTGCCAGGGATTGG + Intergenic
923354984 1:233145646-233145668 TACCGGAGGCTGCCAGGGGCAGG + Intronic
923362308 1:233223618-233223640 CACCGGGGCCTGTCAGGGGGTGG - Intronic
923362439 1:233224934-233224956 CACCGGGGCCTGTCAGGGTTTGG + Intronic
923451460 1:234121719-234121741 CACCGGGGCCTGTCAGGGGGTGG - Intronic
923721801 1:236473334-236473356 GACAGGAGGATGCCAGGGACAGG + Intronic
923840089 1:237661331-237661353 CACCGGGGCCTGTCAGGGAGTGG + Intronic
924179426 1:241425136-241425158 CACCGGGGCCTGTCAGGGGATGG - Intergenic
924322985 1:242868363-242868385 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1063036820 10:2294341-2294363 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1063223798 10:3995323-3995345 CACCGGGACCTGTCAGGGGCTGG - Intergenic
1063404330 10:5778120-5778142 CACCGGGGCCTGTCAGGGGATGG + Intronic
1065553490 10:26891783-26891805 CACCGGGGCCTGTCAGGGGTTGG + Intergenic
1065656155 10:27952553-27952575 CACCAGGGCCTGTCAGGGAAAGG - Intronic
1067013002 10:42732031-42732053 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1067310838 10:45112085-45112107 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1068127699 10:52861916-52861938 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1068227131 10:54119928-54119950 CACCAGGGCCTGTCAGGGAGTGG - Intronic
1068338967 10:55676346-55676368 CACCAGAGCCTGTCAGGGGTGGG - Intergenic
1068460711 10:57324720-57324742 CACTGGGGCCTGTCAGGGGCTGG + Intergenic
1068922030 10:62494896-62494918 CACCGGGGCCTGTCAGGGGTTGG - Intronic
1069779361 10:70945117-70945139 TCACGGAGACTGTCAGGGACAGG - Intergenic
1070294115 10:75144413-75144435 GAATGGTGGCTGTCAGGGACTGG - Intronic
1070709787 10:78672371-78672393 CACCAGGGCCTGTCAGGGAGTGG + Intergenic
1070877414 10:79826485-79826507 CACCGGAGGCAGTGAGGTAATGG + Intergenic
1071000272 10:80823796-80823818 CACTGGTGACTGTCAGGGGCTGG + Intergenic
1071160127 10:82735740-82735762 CACCGGGGCCTGTCAGGGGGTGG + Intronic
1071554555 10:86592390-86592412 CAGGGGAGGTTCTCAGGGACTGG - Intergenic
1072387943 10:94951408-94951430 CACCGGGGCCTGTCAGGGGGTGG + Intronic
1074941213 10:118237320-118237342 GACCAGAGGCTGGAAGGGACAGG - Intergenic
1074963671 10:118470120-118470142 GACCAGAGGATGTCAAGGACAGG - Intergenic
1075296311 10:121278774-121278796 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1075815549 10:125261954-125261976 CACCTGGGGCTGTCCCGGACTGG - Intergenic
1075971367 10:126656664-126656686 GACGGGCGGCTGCCAGGGACTGG + Intronic
1076843985 10:133060182-133060204 CACCGCAGGCTGTCAGGCTGGGG - Intergenic
1077529281 11:3087687-3087709 CACTGGTGGGTGCCAGGGACAGG - Exonic
1077781681 11:5336850-5336872 CACTGGAGCCTGTCAGGGCATGG - Intronic
1078661391 11:13289538-13289560 CTCCGGGGCCTGTCAGGGGCTGG - Intronic
1078776755 11:14400936-14400958 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
1079217383 11:18526271-18526293 CACCTGGGGCAGTAAGGGACTGG + Intronic
1079611616 11:22439757-22439779 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1080786635 11:35480860-35480882 CACCAGAGCGTGTCAGGGCCTGG - Intronic
1080950772 11:37030134-37030156 CACCGGGGCCTCTCAGGGGCTGG - Intergenic
1081323844 11:41721899-41721921 CACCGAGGTCTGTCAGGGAGTGG - Intergenic
1081356576 11:42121411-42121433 CTCCGGCGCCTGTCACGGACTGG + Intergenic
1081681855 11:45011966-45011988 CACCGGGGCCTGTCAAGGAGTGG - Intergenic
1082743682 11:56939215-56939237 CACCGGGGCCTGTCATGGAGTGG - Intergenic
1082886352 11:58087721-58087743 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1083285211 11:61654421-61654443 CACAGGAAGCTGTCAGAGCCCGG - Intergenic
1084091093 11:66879783-66879805 GACAGGAGGCAGTCAGAGACGGG + Intronic
1084124796 11:67092206-67092228 CACCGGAGCCTGTCGGGGAGTGG - Intergenic
1084945306 11:72634976-72634998 CCCCTCAGGCTGTCAGGGAAGGG + Intronic
1085507947 11:77070798-77070820 CACCGGAGGCTGGAAGAGACAGG - Intronic
1085533957 11:77207170-77207192 CACAGGAGGGTGTCTGGCACGGG + Intronic
1086720387 11:90114007-90114029 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1087371291 11:97288274-97288296 CACAGGGGCCTGTCAGGGGCTGG - Intergenic
1087515233 11:99151857-99151879 CACCGGGGCCTGTCAGGGGATGG + Intronic
1087706438 11:101497860-101497882 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1087733302 11:101802761-101802783 CACCGGGGCCTGTCAGGGGTAGG + Intronic
1087741802 11:101896512-101896534 CACAGGAGCCTGTCAGGGGGTGG - Intronic
1087956845 11:104299130-104299152 CACCGGAGTCTGTCAGTGGGTGG - Intergenic
1088077762 11:105873080-105873102 CACTGGGGCCTGTCAGGGAGTGG - Intronic
1089284887 11:117399139-117399161 CACCGGGGCCTGTCAGGGTTGGG - Intronic
1089827373 11:121291018-121291040 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1090659620 11:128872287-128872309 CATCGGAAGCTGTGAGGGAGAGG - Intergenic
1090689406 11:129162131-129162153 CACCGGGGCCTGTCAGGGGGTGG + Intronic
1090883516 11:130855718-130855740 CACTGGGGCCTGTCAGGGGCTGG - Intergenic
1091022034 11:132108860-132108882 CACTGGGGCCTGTCAGGGGCTGG - Intronic
1091146461 11:133284251-133284273 ATCCTGAGGCTGTCAGGCACTGG - Intronic
1091271435 11:134314352-134314374 CCCTGGTGGCTGTCTGGGACAGG - Exonic
1092038945 12:5366554-5366576 CACCAGGGCCTGTCAGGGGCTGG + Intergenic
1092532347 12:9354964-9354986 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1093199856 12:16173458-16173480 CACTGGGGGCTGTAAGGGGCTGG - Intergenic
1093329240 12:17814697-17814719 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1094045856 12:26166107-26166129 CACCAGGGCCTGTCAGGGATTGG + Intronic
1094052393 12:26235457-26235479 CACCGGGGACTGTCGGGGAGTGG - Intronic
1094097054 12:26718208-26718230 CACCAGAGCCTGTCAGGGGGTGG - Intronic
1094795987 12:33973260-33973282 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
1095567373 12:43641286-43641308 CACCGGGGCCTGTCAGTGGCTGG - Intergenic
1096735047 12:53646687-53646709 CACCGGGGCCTGTCAGGGGGTGG + Intronic
1097361789 12:58666322-58666344 CACCGGGGCCTGTCAGGGATCGG + Intronic
1097482611 12:60149337-60149359 CACCGGGGCCTGTCAGGGGTTGG - Intergenic
1097526023 12:60737354-60737376 CACCGGAGCCTGTCATGGGGTGG + Intergenic
1097527165 12:60751450-60751472 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
1097604801 12:61740319-61740341 CACCGGAGCCTGTCAGAGTTGGG + Intronic
1097753377 12:63382656-63382678 CACTGGGGACTGTCAGGGAGTGG + Intergenic
1098529137 12:71520702-71520724 CACCGGGGCCTGTCGGGGAATGG + Intronic
1099011136 12:77292520-77292542 CACCAGAGCCTGTCAGGGGGTGG + Intergenic
1099022397 12:77422948-77422970 CACCAGAGCCTGTCAGGGGGTGG - Intergenic
1099511501 12:83544537-83544559 CACCGGGGCCTGTCAGGGGCTGG - Intergenic
1099550478 12:84037752-84037774 CACCTGGGCCTGTCAGGGACTGG - Intergenic
1099962257 12:89407962-89407984 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1101557885 12:105827752-105827774 CACCACGGCCTGTCAGGGACTGG + Intergenic
1103154131 12:118668734-118668756 CACCGGGGCCTGTCATGGAGTGG - Intergenic
1104117442 12:125763331-125763353 CACCGGGGCCTATCAGGGAGTGG - Intergenic
1104196251 12:126541421-126541443 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1105465471 13:20635709-20635731 CACCGGGGCCTGTCGGGGAGTGG + Intronic
1105644943 13:22307099-22307121 CACTGGGGCCTGTCAGGGGCTGG - Intergenic
1105677158 13:22684127-22684149 CACCTGGGCCTGTCAGGGGCTGG - Intergenic
1105766651 13:23566652-23566674 CTTCTGAGGCTGTGAGGGACAGG + Intergenic
1105804590 13:23945812-23945834 CAAGGGCGGCTGTCAAGGACCGG - Intergenic
1106384189 13:29268153-29268175 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1106886587 13:34191702-34191724 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
1107184519 13:37503039-37503061 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
1108087355 13:46807724-46807746 CACCGGTGCCTGTCAGGGGCTGG - Intergenic
1108673482 13:52715508-52715530 CACCGGGGCCTGTCAGGGAGTGG - Intronic
1109024113 13:57139036-57139058 CACTGGGGTCTGTGAGGGACTGG - Intergenic
1109301619 13:60595327-60595349 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1109509347 13:63349877-63349899 CATAGGAGGGTGTCAGGGAATGG - Intergenic
1109640966 13:65191357-65191379 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1109838659 13:67893093-67893115 CACCGGGGCCTGTCAGGGTGTGG + Intergenic
1110199160 13:72828432-72828454 CACCGGCGCCTGTCGGGGAGTGG - Intronic
1110328367 13:74243111-74243133 CACCGGGGCCTGTCAGGGGTGGG - Intergenic
1110390551 13:74968491-74968513 CACCGGGGCCTGTCGGGGGCTGG - Intergenic
1111056667 13:82959130-82959152 CACTGGGGCCTGTCAGGGGCTGG + Intergenic
1111073175 13:83196883-83196905 CACCGGTGCCTGTCAGGGGGTGG + Intergenic
1111301740 13:86358920-86358942 CTCCGGCGCCTGTCACGGACTGG + Intergenic
1111557573 13:89901434-89901456 CACCGGGGCCTGTCGGGGAGTGG - Intergenic
1111702748 13:91711439-91711461 CACCGGGGCCTGTCAGGGGGTGG + Intronic
1111738220 13:92169164-92169186 CACTGGAGCCTGTCAGGGGTGGG + Intronic
1112144873 13:96688056-96688078 CACCGGGGCCTGTCATGGAATGG + Intronic
1112529712 13:100189043-100189065 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1112581126 13:100677142-100677164 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1112662430 13:101526311-101526333 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1113695416 13:112342610-112342632 CACAGGAGGCTGGAAGGGGCAGG + Intergenic
1113875121 13:113589461-113589483 CACCTGAGGCTATCACAGACCGG - Intronic
1113906976 13:113823859-113823881 CATCGGAGGGAGGCAGGGACAGG - Intronic
1115844200 14:37507589-37507611 CACCGGGACCTCTCAGGGACTGG + Intronic
1115896699 14:38096417-38096439 CACCGGGGCCTGTCACGGATTGG + Intergenic
1115936418 14:38558308-38558330 CACCAGGGCCTGTCAGGGAGTGG + Intergenic
1116180584 14:41527212-41527234 CACCAGGGCCTGTCAGGGAGTGG + Intergenic
1116354340 14:43909192-43909214 CACGGGGGCCTGTCAGGGAGTGG - Intergenic
1116511291 14:45750143-45750165 CACCAGAGCCTGTCAGGGGGTGG - Intergenic
1116533808 14:46006454-46006476 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
1116569466 14:46497156-46497178 CACCAGGGCCTGTCAGGGAGTGG - Intergenic
1116634987 14:47383189-47383211 CACCGGAGCCTGTCAGGGGATGG + Intronic
1116642027 14:47475812-47475834 CACTGGGGCCTGTCAGGGATCGG + Intronic
1116776189 14:49183643-49183665 CACCGGGGCCTGTCGGGGAGTGG + Intergenic
1117501803 14:56359753-56359775 CACCGGGGCCTGTCAGGGGCTGG - Intergenic
1117932474 14:60857730-60857752 CACCGGGGCCTGTCAGGGGATGG - Intronic
1119586450 14:75840401-75840423 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1120568293 14:86086242-86086264 CACCGGGGCCTGTCAGGGAGTGG - Intergenic
1120624659 14:86809986-86810008 CACCGGAGCCTGTCAGGGGTTGG - Intergenic
1120797976 14:88656452-88656474 CACTGGGGCCTGTCAGGGAGTGG + Intronic
1121294295 14:92805175-92805197 CACTGGGTGCTTTCAGGGACGGG - Intronic
1121516899 14:94558444-94558466 CAGAGGAGGGTGTCAGGGAGTGG + Intergenic
1121555701 14:94835075-94835097 CACAGGAGGCTGTTAGGTAAGGG + Intergenic
1121696068 14:95913323-95913345 CACCGGAGCCTGTCGGGGAGTGG - Intergenic
1122783764 14:104154664-104154686 CACCAGAGGCTGCCATGGTCTGG + Intronic
1124214060 15:27792029-27792051 CACCGCAGGCTGTGAGGCAATGG - Intronic
1124913194 15:33943428-33943450 CAATGAAGGCTGTCAGGGGCTGG + Intronic
1125211921 15:37226762-37226784 CACCGGGGCCTGTCAGGGGTGGG + Intergenic
1125220473 15:37327015-37327037 CCCCGGGGCCTGTCAGGGGCTGG - Intergenic
1125857929 15:42968677-42968699 CACCAGGGCCTGTCAGGGGCTGG - Intronic
1126084226 15:44996158-44996180 CACCGGGGCCTGTCAGGGCTTGG + Intergenic
1126197752 15:45950758-45950780 CACAGGAGCCTGTCAGGGGAGGG - Intergenic
1126613238 15:50550767-50550789 CACCGGGGCCTGTCAGGGAGTGG - Intergenic
1127117668 15:55743446-55743468 CCCCGGAGGCTGGCTGGGCCAGG - Intergenic
1127588209 15:60397816-60397838 CCCCGGAGGCCGTCGGGGGCAGG - Intronic
1127593664 15:60454861-60454883 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1129303921 15:74644496-74644518 CACCGGGGCCTGTCAGGGTGTGG + Intronic
1129489519 15:75909922-75909944 CACCAGGGCCTGTCAGGGAGTGG - Intronic
1129947954 15:79558532-79558554 CACCGGGGCCTGTCATGGAGTGG + Intergenic
1130774514 15:86964787-86964809 CACCGGGGCCTGTCAGGGGTTGG - Intronic
1130932742 15:88441413-88441435 GACTGGAGGGTGTCAGGGGCTGG - Intergenic
1132254518 15:100364297-100364319 CACCGGGGCCTGTCAGGGGATGG + Intergenic
1133921748 16:10159591-10159613 CAGCGGAGTCTGTCAAGGAGTGG + Intronic
1134887910 16:17810703-17810725 CACCGGAGCCTGTCGGGGGTGGG - Intergenic
1135472197 16:22741215-22741237 CACCAGAGCCTGTCAGGGGTCGG - Intergenic
1135536692 16:23300176-23300198 CACCAGAGCCTGTCAGGGGGTGG + Intronic
1135972932 16:27085386-27085408 CACCGGGGGCTCACAGGGCCGGG + Intergenic
1135978342 16:27126305-27126327 CACCAGGGCCTGTCAGGGATTGG + Intergenic
1136772378 16:32852509-32852531 CACCGGAGACTGTTGGGGAGTGG + Intergenic
1137460873 16:48662086-48662108 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1138107276 16:54294874-54294896 CACCGGAAGCTGACAGGGGGTGG + Intergenic
1138163974 16:54782630-54782652 CACCGGAGCCTGTCACGGGGTGG - Intergenic
1138164695 16:54790110-54790132 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1138917393 16:61483041-61483063 CACCGGGGCCTGTCGGGGAATGG + Intergenic
1138949863 16:61899134-61899156 CACCGGGGCCTGTCAGGGTGTGG - Intronic
1139001708 16:62518830-62518852 CACAGGAGCCTGTCGGGGACTGG - Intergenic
1139548623 16:67661378-67661400 CACCGCAGGCTGGCAGGAATGGG - Intronic
1139842432 16:69892350-69892372 CACCGGGGCCTGTCAGGGGTGGG - Intronic
1141174642 16:81710848-81710870 CAGCAAAGGCTGACAGGGACAGG - Exonic
1203074801 16_KI270728v1_random:1114607-1114629 CACCGGAGACTGTTGGGGAGTGG + Intergenic
1142777532 17:2153344-2153366 CATCAGAAGTTGTCAGGGACTGG + Intronic
1143423745 17:6816387-6816409 CACCGGGGCCTGTCAGGGTGTGG - Intronic
1143735124 17:8906161-8906183 CACCGGGGCCTGTCGGGGATGGG - Intronic
1143825427 17:9602280-9602302 CACCGGGGCCTGTCAGGGGTGGG - Intronic
1144441346 17:15285573-15285595 CACTGGCCGCTGTCTGGGACAGG + Intergenic
1144541937 17:16152309-16152331 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1144622658 17:16828298-16828320 CATCGGAGCCTGTCAGGGGGTGG + Intergenic
1145012071 17:19374222-19374244 CTGGGGAGGCTGTCAGGGAGTGG + Intronic
1146507618 17:33418938-33418960 CACCGGGGCCTGTCAGGGGTGGG + Intronic
1146650356 17:34602581-34602603 CACTGGAGACTGGCAAGGACAGG + Intronic
1146912979 17:36659911-36659933 CAGAGGAGGCTGTCAGGGGCGGG + Intergenic
1148972357 17:51494912-51494934 CACCGGGGCCTGTCAGGGAGTGG - Intergenic
1148983132 17:51596518-51596540 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1149088021 17:52743077-52743099 CACCAGGGTCTGTCAGGGGCTGG - Intergenic
1149180462 17:53930807-53930829 CACCGGGGCCTGTCAGGGTGTGG + Intergenic
1149212775 17:54322652-54322674 CACCGGGGCCTGTCAGGGGTGGG + Intergenic
1149327127 17:55543471-55543493 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1149359109 17:55874490-55874512 CACCAGAGCCTGTCATGGAGTGG - Intergenic
1150830114 17:68511854-68511876 CTCCGGGGGCTGGCAGCGACAGG + Intronic
1150855550 17:68748975-68748997 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1150856483 17:68758197-68758219 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
1150997109 17:70331404-70331426 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1151474599 17:74338527-74338549 CACATGAGGCTGCCAGGGTCAGG + Intronic
1203168168 17_GL000205v2_random:118411-118433 CACTGGAGCCTGTCAGGAAGTGG + Intergenic
1153474861 18:5488399-5488421 CACTGGGGCCTGTCGGGGACTGG + Intronic
1153601332 18:6783753-6783775 CACAAGAGGCAATCAGGGACTGG + Intronic
1153605832 18:6830476-6830498 CACCAGGGCCTGTCAGGGGCTGG - Intronic
1154041258 18:10858644-10858666 CACGGGAGGAAGGCAGGGACTGG + Intronic
1155664128 18:28286576-28286598 CACCGGAGCCTGTCAGGGGGTGG + Intergenic
1155837449 18:30603817-30603839 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1156191462 18:34726082-34726104 CACCAGAGCCTGTCGGGGAGTGG + Intronic
1157318099 18:46610385-46610407 CACCGGGGCCTGTCGGGGGCTGG + Intronic
1157337015 18:46748056-46748078 CACCGGGGCCTGTCAGGGGGTGG + Intronic
1157795171 18:50567245-50567267 CACCAGGGCCTGTCAGGGAGTGG - Intronic
1158091238 18:53716167-53716189 CACTGGGGCCTGTCAGGGGCTGG - Intergenic
1158187951 18:54792701-54792723 CACCAGAGACTGTTAGGTACTGG - Intronic
1158297127 18:56010719-56010741 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1159146357 18:64458691-64458713 CACCGGGGCCTGTCAGGGGTCGG + Intergenic
1159385735 18:67723558-67723580 CATTGGGGCCTGTCAGGGACTGG - Intergenic
1159452614 18:68621569-68621591 CACTGGGGCCTGTCAGGGGCTGG + Intergenic
1159472124 18:68870180-68870202 CACCGGAGCCTGTCAGGGGGTGG + Intronic
1159907550 18:74109814-74109836 CACCGGGGTCTGTCAGGGGATGG + Intronic
1159957457 18:74529967-74529989 CGCCGGAGGAGGTCAGGGCCTGG + Intergenic
1160010989 18:75107009-75107031 CACTGGAGGCTGTGGGTGACTGG - Intergenic
1160087743 18:75794223-75794245 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1160521684 18:79511657-79511679 CTCCTGAGGCAGTCAGGGCCTGG + Intronic
1161827491 19:6578286-6578308 CACCGGGGCCTGTCAGGGGTTGG - Intergenic
1162588807 19:11577615-11577637 CACCGGAGGCTCTGAGAGGCTGG + Exonic
1162632049 19:11935863-11935885 CACCGGGGCCTGTCAGGGGCTGG - Intronic
1162891944 19:13739903-13739925 CACTGGGGCCTGTCAGGGAATGG - Intronic
1163068662 19:14819326-14819348 CACTGGAGCCTGTCAGGGGGTGG - Intronic
1163712730 19:18856499-18856521 CAGTGGAGGCTGGCAGGGAGTGG - Intronic
1164439640 19:28263646-28263668 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1164543295 19:29138566-29138588 CACCGGAGCCTGTCATGGGGTGG + Intergenic
1164730263 19:30498423-30498445 CACTGGGGCCTGTCAGGGAGTGG + Intronic
1164899312 19:31904965-31904987 CACTGGGGCCTGTCAGGGAAGGG + Intergenic
1164917454 19:32063385-32063407 CACTGGAGCCTGTCAGGGGTTGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165603218 19:37076529-37076551 CACTGGGGCCTGTCAGGGAGTGG - Intronic
1166273835 19:41737114-41737136 CACCGGAGCCTGTCATGGGGTGG + Intronic
1166706863 19:44912910-44912932 CCCCTGGGGCTGACAGGGACTGG + Intergenic
1166747338 19:45147605-45147627 CACCTGGGGCTGCCAGGGACAGG - Intronic
1166914307 19:46184424-46184446 CACCGGAGCCTGTCGGGGGTGGG - Intergenic
1167092362 19:47353372-47353394 CACGCGGGGCTCTCAGGGACTGG + Exonic
1167799895 19:51733526-51733548 CACCGGAGCCTGTCAAGGGAGGG + Intergenic
1168502478 19:56905067-56905089 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
1168622884 19:57893084-57893106 CACTAGAGGCTCTCAGGGAAAGG + Intronic
925117264 2:1390174-1390196 CACCGGGGCCTGTCAGAGGCTGG - Intronic
925301890 2:2822682-2822704 AAATGGTGGCTGTCAGGGACTGG + Intergenic
926527434 2:13998749-13998771 CACCGGGGCCTGTCGGGGAGTGG + Intergenic
926546599 2:14248565-14248587 CACCGGGGCCTGTCAGGGACTGG + Intergenic
926627553 2:15105243-15105265 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
928027657 2:27753053-27753075 CAGGGGAGGCTCTCAGGCACTGG + Intergenic
928170073 2:28997970-28997992 CACCAGAGCCTGGCAGGGCCAGG - Intronic
928305231 2:30164573-30164595 GACCAGAGGTTTTCAGGGACTGG + Intergenic
929076953 2:38085789-38085811 CTCCGGCGCCGGTCAGGGACTGG - Intronic
929353551 2:40991161-40991183 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
929361343 2:41094987-41095009 CACCAGGGCCTGTCAAGGACTGG + Intergenic
929842571 2:45484759-45484781 GACTGTAGGTTGTCAGGGACTGG - Intronic
931228078 2:60351322-60351344 CAGCTGAGGCTGGAAGGGACTGG - Intergenic
931360100 2:61570822-61570844 CACCGTAGCCTATCAGTGACTGG + Intergenic
932728440 2:74199348-74199370 CACCAGAGCCTGTCAGTGCCGGG + Intronic
932785974 2:74604186-74604208 CACCAGAGCCTGTCAGGCAGAGG - Intronic
933408021 2:81887605-81887627 CACTGGAGCCTGTTAAGGACTGG - Intergenic
933557822 2:83852091-83852113 CACCGTGGCCTGTCAGGGAATGG + Intergenic
933870432 2:86560544-86560566 CACCGGGGCCTGTCAGGGGTTGG + Intronic
934845424 2:97658995-97659017 CACAGGATGCTGCGAGGGACGGG + Exonic
934872360 2:97878682-97878704 CACCAGGGCCTGTCAGGGGCTGG + Intronic
934924409 2:98371924-98371946 GACCAGAGGCTGTCAGGATCAGG + Intronic
935003828 2:99049565-99049587 CACCGGGGCCTGTCAGGGGGTGG + Intronic
935962099 2:108435953-108435975 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
936833781 2:116682011-116682033 CACTGGGGGCTGTCAGGGGGTGG + Intergenic
936850188 2:116886823-116886845 CACTGGAGCCTGTCAGGGAGTGG + Intergenic
936935710 2:117836623-117836645 AACAGGAGGCGGTCAGGGAGCGG - Intergenic
938018422 2:127886097-127886119 CACCGGAGGCAGTGAGGTAATGG + Intergenic
938723164 2:134084330-134084352 CACAGGTGGGTCTCAGGGACTGG + Intergenic
939042986 2:137214588-137214610 CACCGGGGCCTGTCAGGGGGTGG - Intronic
939491495 2:142882485-142882507 CACCGGAGCCTGTCGTGGAGTGG - Intronic
940073393 2:149714560-149714582 CACTGGGGCCTGTCAGGGAAGGG + Intergenic
940703319 2:157073587-157073609 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
941590221 2:167410568-167410590 CACTGGGGCCTGTCAGGGGCTGG + Intergenic
941732282 2:168932164-168932186 CACCGGGGCCTGTCAGGGGATGG - Intronic
941771781 2:169352857-169352879 CACCGGGGCCTGTCAGGGGGTGG + Intronic
942424863 2:175848888-175848910 CACCAGGGCCTGTCAGGGAGTGG + Intergenic
944001976 2:194850715-194850737 CACCGGGGTCTGTCATGGAGTGG - Intergenic
944033336 2:195263958-195263980 CACCTGAGCCTGTCAGGGGGTGG - Intergenic
944195428 2:197048345-197048367 CACTGGGGCCTGTCAGGGAGTGG - Intronic
944375285 2:199034421-199034443 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
945490701 2:210451308-210451330 CACCGGGGCCTGTCAGGGGGTGG + Intronic
945574180 2:211509170-211509192 CACCAGAGCCTGTCGGGGAGTGG + Intronic
946085737 2:217169324-217169346 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
946307760 2:218865813-218865835 CAGCGAAGTCTGTCAGGGAAGGG + Intronic
946672381 2:222119438-222119460 CACTGGAGCCTGTCAGGGGATGG - Intergenic
946781785 2:223198911-223198933 CACCTGGGCCTGTCAGGGAGTGG + Intergenic
946875970 2:224130251-224130273 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
947381369 2:229548577-229548599 CACTGGGGCCTGTCAGGGGCGGG + Intronic
947397904 2:229704640-229704662 GACCAGTGGCTGCCAGGGACTGG + Intronic
947440066 2:230112215-230112237 CAACGGGGCCTGTCAGGGAGTGG - Intergenic
947921174 2:233875666-233875688 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
948021896 2:234740354-234740376 CACTGGGGTCTGTCAGGGAGTGG + Intergenic
948991796 2:241559244-241559266 TCCCCGAGGCTGCCAGGGACCGG - Intronic
1169395558 20:5225862-5225884 CACCGGGGCCTGTCTGGGCCTGG - Intergenic
1170290953 20:14767796-14767818 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1170696012 20:18659738-18659760 CACTGGGGCCTGTCAGGGAGTGG + Intronic
1171091707 20:22291422-22291444 CACTGGGGTCTGTCAGGGACTGG + Intergenic
1172770665 20:37380702-37380724 CACTCGCGGCTGTCAGGGCCAGG - Intronic
1173144934 20:40516229-40516251 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1173301578 20:41808413-41808435 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1173331434 20:42079058-42079080 CACCTGAGGCTGTCAGATATTGG + Exonic
1173871737 20:46346361-46346383 GACCGGAGGCTGGCAGGAATGGG + Intronic
1174670197 20:52299965-52299987 CACCAGGGGCTGTCAGGGGGTGG + Intergenic
1174999564 20:55612094-55612116 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1175004641 20:55669360-55669382 CACCTGAGACTATCAGGGACAGG - Intergenic
1176325539 21:5445736-5445758 CACTGGAGCCTGTCAGGAAGTGG + Intergenic
1176403589 21:6340726-6340748 CACTGGAGCCTGTCAGGAAGTGG - Intergenic
1176433568 21:6648378-6648400 CACTGGAGCCTGTCAGGAAGTGG + Intergenic
1176523139 21:7840014-7840036 CACTGGGGCCTGTCAGGGAAGGG + Intergenic
1176934379 21:14849119-14849141 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1177130209 21:17246461-17246483 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1177598662 21:23281689-23281711 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
1177728385 21:24996413-24996435 CACCGGGGCCTGTCAGGGGTGGG - Intergenic
1177756996 21:25360287-25360309 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1178657159 21:34470026-34470048 CACTGGGGCCTGTCAGGGAAGGG + Intergenic
1179366626 21:40764935-40764957 CACCGGGGCCTGTCAGGGGGTGG + Intronic
1179372628 21:40820445-40820467 CACCAGGGCCTGTCAGGGAGTGG + Intronic
1179521711 21:41949973-41949995 CACCAGGGCCTGTCAGGGACTGG + Intronic
1179568758 21:42265548-42265570 CACCAGCGGCTGGCAGAGACAGG + Intronic
1180055065 21:45353469-45353491 CCCCTGAGGCTGTAAGGGAGAGG - Intergenic
1180521529 22:16211666-16211688 CAATGGAAGTTGTCAGGGACTGG + Intergenic
1180634162 22:17251026-17251048 CACTGGAGGCTGTCACTGGCAGG - Intergenic
1181160624 22:20957688-20957710 CACTGGAGGATGTCAGGGAAAGG - Intergenic
1181818991 22:25461001-25461023 CACCGAGGCCTGTCAGGGAGTGG + Intergenic
1182707085 22:32290254-32290276 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1182732017 22:32503489-32503511 CTCCGGCGGCGGTCACGGACTGG + Intergenic
1182812961 22:33133335-33133357 CACTGGGGCCTGTCAGGGGCAGG - Intergenic
1182868047 22:33622089-33622111 CACTGGAGGTTGTTAGGGAAAGG + Intronic
1183280243 22:36928355-36928377 CCCCCGAGGCTGTCATGGAGGGG - Intronic
1184561843 22:45268334-45268356 CACCGGCGGCTGTCAGGAGGAGG - Intergenic
1184613736 22:45623462-45623484 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1184754263 22:46507528-46507550 CACCGCAGGCTGTTGGGGCCTGG - Intronic
1185322173 22:50206650-50206672 CTTCTGAGGCTGCCAGGGACAGG - Intronic
949804548 3:7940194-7940216 CACCAGTGCCTGTCAGGGGCTGG + Intergenic
950487112 3:13280467-13280489 CACAGGAGACTCACAGGGACGGG - Intergenic
951135054 3:19095708-19095730 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
951401138 3:22232544-22232566 CACCAGGGCCTGTCAGGGATGGG - Intronic
951620245 3:24593626-24593648 CACCGGGGCCTGTCATGGAGTGG - Intergenic
951917373 3:27816132-27816154 CACCAGGGCCTGTCAGGGAGTGG - Intergenic
952641355 3:35600684-35600706 CACCAGAGCCTGTCAGGGGGTGG - Intergenic
952724337 3:36567496-36567518 CACTGGGGCCTGTCAGGGGCTGG - Intergenic
952842048 3:37654848-37654870 CACCGGGGCCTGTCAGGGGTGGG - Intronic
952926141 3:38320671-38320693 CACCGGGGCCTGTCAGGGGATGG - Intergenic
953013782 3:39052856-39052878 CACCGGGGCCTGTCGGGGGCTGG + Intronic
953920202 3:46946554-46946576 CACCTGATGCTGTCAGGGGCAGG + Intronic
954271188 3:49510638-49510660 CCTCAGAGGCTGTCAGGGACTGG + Exonic
954585998 3:51737346-51737368 CACCAGGGCCTGTCAGGGGCAGG - Intergenic
955009099 3:54997007-54997029 CACCGGGGCCTGTCAGGGGGTGG + Intronic
956079585 3:65543736-65543758 CACTGGGGCCTGTCAGGGATGGG + Intronic
956269963 3:67441211-67441233 CACTGGGGCCTGTCAGGGGCTGG + Intronic
956460370 3:69465546-69465568 CACCGGGGCCTGTCGGGGGCTGG - Intronic
956606918 3:71082461-71082483 CACCGGGGCCTGTCAGGGGGTGG + Intronic
957036678 3:75299832-75299854 CACCAGAGCCTGTCAGGGGTTGG - Intergenic
959349198 3:105239300-105239322 CACCGGGGCCTGTCGGGGATGGG - Intergenic
959616080 3:108348804-108348826 CACCGGGGCCTGTCAGGGGGTGG - Intronic
962662913 3:137622606-137622628 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
962916780 3:139911642-139911664 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
963259769 3:143180101-143180123 CACCGGGGCCTGTCAGGGGAGGG - Intergenic
963639235 3:147838145-147838167 CACCAGGGCCTGTCAGGGAGTGG - Intergenic
963879022 3:150506626-150506648 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
964660584 3:159115905-159115927 CACTGGGGCCTGTCAGGGATGGG + Intronic
964685017 3:159385851-159385873 CACCGGGGCCTGTCAGGGGATGG - Intronic
964831798 3:160891981-160892003 CACCGGGGCCTGTCAGGGGGTGG + Intronic
964907691 3:161737969-161737991 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
965129042 3:164670696-164670718 CACCGGGGCCTGTCAGGGGTTGG + Intergenic
965352495 3:167631101-167631123 CACCGGGGCCTGTCAGGGGGTGG + Intronic
965494245 3:169378157-169378179 CACCAGAGCCTGTCAGGGGGTGG + Intronic
965770600 3:172177856-172177878 CACTGGGGCCTGTCAGGGACAGG - Intronic
965800667 3:172490626-172490648 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
966107027 3:176348161-176348183 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
966191275 3:177273798-177273820 CACCGGGGCCTGTCATGGAGTGG - Intergenic
966573415 3:181473112-181473134 CACCAGGGCCTGTCAGGGAGTGG - Intergenic
966834344 3:184037881-184037903 GACCGGATGCTGAAAGGGACGGG + Intronic
968020758 3:195386627-195386649 CAGCGGAGCCTGTCAGGTGCGGG + Intronic
968072322 3:195792967-195792989 CACTGGCGCCTGTCAGGGACGGG + Intronic
968930416 4:3575905-3575927 CACCGGGCCCTGTCAGGAACAGG - Intergenic
969039884 4:4287893-4287915 CAGGAGAGGCTGTCAGGGTCTGG + Intronic
969264346 4:6055219-6055241 GACTGGAGGCTGCCAGGGGCCGG + Intronic
969833774 4:9821482-9821504 CACCGGGGCCTGTCAGGGGCTGG + Intronic
969900955 4:10348860-10348882 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
970651110 4:18179080-18179102 CACCGGGGCCTGTCCGGGGCTGG + Intergenic
971769369 4:30876911-30876933 CACCGGGGCCTGTCTGGGAGTGG - Intronic
971993658 4:33935029-33935051 CACCGGGGCCTGTCGGGGGCTGG + Intergenic
972220773 4:36951481-36951503 CACTGGAGCCTGTCAGGGGTGGG - Intergenic
972409440 4:38778267-38778289 CACCGGGGCCTGTCAGGGGGTGG + Intronic
972919400 4:43919660-43919682 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
973097582 4:46222369-46222391 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
973189519 4:47371093-47371115 CACTGGAGCCTGTCAGGGTGGGG - Intronic
974109393 4:57509643-57509665 CACTGGAGCCTATCAGAGACTGG - Intergenic
974343942 4:60653859-60653881 CACTGGGGTCTGTCAGGGATTGG - Intergenic
975358657 4:73440218-73440240 CACTGGGGCCTGTCAGGGAGTGG - Intronic
975490418 4:74982279-74982301 CACTGGGGCCTGTCAGGGTCGGG + Intronic
976273630 4:83254169-83254191 GACCAGTGGCTGCCAGGGACTGG - Intergenic
976545336 4:86328836-86328858 CACCGGGGCCTGTCAGGGGAGGG + Intronic
976606667 4:86990011-86990033 CACCAGGGCCTGTCAGGGAATGG + Intronic
976938352 4:90667498-90667520 CACCGGGGCCTGTCAGGGAGTGG - Intronic
977002497 4:91521040-91521062 CACCGGGGCCTGTCAGGGGCGGG - Intronic
979009510 4:115349808-115349830 CACTGGAGCCTGTCAGGGGGTGG - Intergenic
979012830 4:115393146-115393168 CACCAGGGCCTGTCAGGGGCTGG + Intergenic
979031610 4:115655313-115655335 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
979173593 4:117633947-117633969 CACCGGGTCCTGTCAGGAACTGG - Intergenic
979927706 4:126588287-126588309 CACCGGAGCCTGTCAGGGGTTGG + Intergenic
980249922 4:130301794-130301816 CACCAGAGGCTAGCTGGGACAGG - Intergenic
980855647 4:138436106-138436128 CACCAGGGCCTGTCAGGGGCTGG + Intergenic
981126838 4:141116976-141116998 CACCGGAGCCTGTCAGGGGGTGG + Intronic
981391863 4:144200295-144200317 CACCAGAGCCTGTCAGGGTTGGG + Intergenic
981663055 4:147189864-147189886 CACCGGGGCCTGTCAGGGGTTGG + Intergenic
981686244 4:147458118-147458140 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
982839626 4:160167448-160167470 CACTGGAGCCTGTCAGGGGGTGG - Intergenic
983386622 4:167071396-167071418 CACCGGTGCCTGTCAGGGGGTGG - Intronic
983388222 4:167093448-167093470 CACCGGGGCCTGTCAGGGGATGG - Intronic
984049544 4:174846724-174846746 CACTGGGGCCTGTCAGGGAAGGG - Intronic
984270045 4:177538418-177538440 CACCAGGGCCTGTCAGGGAGTGG + Intergenic
984393853 4:179169783-179169805 CTCCGGCGGCGGTCACGGACTGG - Intergenic
984788364 4:183590605-183590627 AACCGGCGGCTGTCAGACACAGG + Intergenic
984827445 4:183939283-183939305 CACCGGAAGCTGGAAGGGACAGG - Intronic
985317968 4:188678688-188678710 CACCAGGGCCTCTCAGGGACTGG + Intergenic
985733923 5:1566329-1566351 CAGGGGAGGCTGTCGGGGGCAGG + Intergenic
986118881 5:4811537-4811559 CACAGGGGCCTGTCAGGGAGTGG - Intergenic
986366242 5:7035095-7035117 CACAGGGGCCTGTCAGGGATGGG - Intergenic
986381113 5:7187003-7187025 CACTGGGGCCTGTCAGGGGCGGG - Intergenic
986533616 5:8763664-8763686 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
986717808 5:10536637-10536659 GACCTGTGGCTGTCAGGGACTGG - Intergenic
987103124 5:14610235-14610257 CAGAGGAGCCTCTCAGGGACTGG + Exonic
987535976 5:19188005-19188027 CACCAGAGTCTGTCAGGGTGTGG + Intergenic
987683552 5:21167456-21167478 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
987741936 5:21920513-21920535 CACCGGGGCCTGTCAGGGTGTGG + Intronic
987852383 5:23373214-23373236 CACCGGGGCCTGTCGGGGAGTGG - Intergenic
988171969 5:27669725-27669747 CACCGGGGACTGTCAGGGGGTGG - Intergenic
988610273 5:32717009-32717031 CACCGGGGCCTGTCAGGGGGTGG - Intronic
988667174 5:33341841-33341863 CACCGGGGCCTGTCAGGGGCTGG - Intergenic
988848500 5:35154972-35154994 CACTGGAGCCTGTCAGGGGAGGG + Intronic
989175123 5:38517042-38517064 CATCGGGGCCTGTCAGGGATGGG + Intronic
989672221 5:43932079-43932101 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
990618352 5:57531042-57531064 CACCGGGGCCTGTCGGGGGCTGG + Intergenic
990808262 5:59691555-59691577 CACCGGGGTCTGTCATGGAGTGG + Intronic
990809588 5:59707671-59707693 CACTGGGGCCTGTCAGGGAGTGG - Intronic
992292490 5:75293469-75293491 CAAGGGAAGCTGTGAGGGACTGG - Intergenic
992329592 5:75702147-75702169 CACCGGGGCCTGTCAGGGGGTGG + Intronic
993011569 5:82489173-82489195 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
993116740 5:83728199-83728221 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
994610054 5:102024636-102024658 CACCGGGGCCTGTCAGGGGGCGG + Intergenic
994886936 5:105576464-105576486 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
994956465 5:106539513-106539535 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
995108588 5:108402640-108402662 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
995263003 5:110127467-110127489 CACTGGGGCCTGTCAGGGGCTGG - Intergenic
995337255 5:111013965-111013987 CACCGGGGCCTGTCAGGGGATGG - Intergenic
996065093 5:119071129-119071151 CACCGGAGCCGGGAAGGGACAGG + Intronic
996125396 5:119720446-119720468 CACCGGAGCCTGTCATGGGCTGG + Intergenic
997112989 5:131095586-131095608 CACCGGGGCCTGTCAGGGGTGGG - Intergenic
997521449 5:134526592-134526614 CCCCGGAAGGTGTCTGGGACCGG - Intronic
997578086 5:134998075-134998097 CACCGGGGCCTGTCATGGAGGGG - Intronic
997604592 5:135165264-135165286 CACCGGGGCCTGTCAGGGGGTGG - Intronic
998061163 5:139119831-139119853 AACCAGAGGCTGTCAGGGGTAGG - Intronic
999584966 5:153080187-153080209 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
999616255 5:153427728-153427750 CACTGGAGGGGGTCTGGGACAGG + Intergenic
999879425 5:155845032-155845054 CACCGGGGCCTGTCATGGATGGG - Intergenic
1000400601 5:160823371-160823393 CACTGGGGCCTGTCAGGGAGTGG + Intronic
1000673223 5:164088389-164088411 CACTGGGGCCTGTCAGGGAATGG - Intergenic
1001779099 5:174352212-174352234 CACCGGGGCCTGTCAGGGGTGGG + Intergenic
1002335076 5:178471874-178471896 CACCGGAGTCAGTCAGGGGGTGG - Intronic
1003438226 6:6114359-6114381 CACTGGAGCTTGTCAGGGACTGG - Intergenic
1003713046 6:8614746-8614768 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
1003831325 6:10015213-10015235 CACTGGGGCCTGTCAGGGAGTGG - Intronic
1004124569 6:12860158-12860180 CACTGGGGCCTGTCAGGGAGTGG - Intronic
1004126809 6:12882103-12882125 CACCCGAGGCTGAGAGGGACAGG + Intronic
1004234783 6:13864850-13864872 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1004289778 6:14355896-14355918 CACTGGGGCCTGTCAGGGGCTGG - Intergenic
1004541020 6:16549996-16550018 CACCGGGGTCTGTTGGGGACTGG + Intronic
1004549983 6:16637331-16637353 CACCGGGGCCTGTCATGGAGTGG + Intronic
1004829481 6:19462140-19462162 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1004854845 6:19738668-19738690 CACCGGGGCCTGTCAGGGGTTGG - Intergenic
1004943857 6:20590513-20590535 CACCGGGGGCTGTTGGGGAGTGG - Intronic
1005772801 6:29092836-29092858 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1006197787 6:32257265-32257287 CACCGGGGCCTGTCAGAGAGTGG - Intergenic
1006916626 6:37598697-37598719 CACCGGGGCCTGTCAGGGAATGG - Intergenic
1008095296 6:47333814-47333836 CACCGGGGCCTGTCAGGGTTTGG + Intergenic
1008896474 6:56562744-56562766 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1008963152 6:57287594-57287616 CACTGGAGCCTGTCAGGGGGTGG + Intergenic
1008979429 6:57465977-57465999 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1009167568 6:60358967-60358989 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1009452825 6:63821606-63821628 CTCCAGAGGCTGTCAGGGAAAGG + Intronic
1009570585 6:65378869-65378891 CACCGGGGCCTGTCAGGGGGTGG + Intronic
1010994560 6:82518252-82518274 CACCGGGGCCTGTCAGGGGTTGG + Intergenic
1011736658 6:90317327-90317349 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1012122037 6:95380819-95380841 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
1012832281 6:104219298-104219320 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1013263851 6:108474039-108474061 CACCAGAGCCTGTCAGGAGCCGG - Intronic
1013892305 6:115038712-115038734 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1014190487 6:118490167-118490189 GACTGGTGGTTGTCAGGGACTGG + Intronic
1014464190 6:121735680-121735702 CACTGGAGCCTGTCAGGGGAGGG - Intergenic
1014586083 6:123199659-123199681 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1014761858 6:125365461-125365483 CAATGGTGGCTGCCAGGGACAGG + Intergenic
1015194167 6:130507172-130507194 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1015211860 6:130707591-130707613 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1015623464 6:135156556-135156578 CAAGGGAAGCTGTGAGGGACTGG - Intergenic
1016270543 6:142283477-142283499 CACCGGGGCCTGTCAGGGTATGG + Intergenic
1016488734 6:144572553-144572575 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1016888136 6:148978657-148978679 CACCGGGGCCTGTCAGGGGTTGG + Intronic
1017232112 6:152084257-152084279 CACCGGGGCCTGTCAGGGGTTGG + Intronic
1017285778 6:152674771-152674793 CACTGGGGCCTGTCGGGGACTGG - Intergenic
1017297761 6:152818423-152818445 CACCGAGGCCTGTCAGGGAGTGG + Intergenic
1017968126 6:159284662-159284684 CACTGGAGCCTGTCAGGGGGTGG - Intergenic
1018580213 6:165301857-165301879 CAGTGGAGGCTGTCAGAGAGGGG - Exonic
1018617143 6:165697685-165697707 GAATGGAGGCTTTCAGGGACTGG + Intronic
1018996141 6:168711957-168711979 CCCCTGTGGCTGTCAGGGAAGGG + Intergenic
1019694194 7:2435735-2435757 CACCTGAGGCTAGCAGGCACTGG - Intergenic
1019712191 7:2522791-2522813 CTCCGAGGGCTGTCAGGGAGAGG + Intronic
1020545429 7:9523190-9523212 CACTGGAGCCTGTCAGGGGGTGG - Intergenic
1020698311 7:11444587-11444609 CACCGGGGTCTGTCAGGGGATGG + Intronic
1020933237 7:14427080-14427102 CACTGGGGCCTGTCAGGGAGTGG + Intronic
1021171684 7:17405081-17405103 CACCGGGGCCTGTCGGGGGCTGG + Intergenic
1021228624 7:18058660-18058682 CACTGGGGCCTGTCAGGGATGGG + Intergenic
1021525676 7:21584413-21584435 CACCAGGGGATGTCAGGGAGTGG + Intronic
1022221979 7:28322602-28322624 CACCAGAGCCTGTCGGGGAGTGG - Intronic
1022542995 7:31156543-31156565 CACTGGAGGCTGTCAGAGGGTGG - Intergenic
1023508869 7:40929089-40929111 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1024150251 7:46564395-46564417 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1024577657 7:50777900-50777922 CACCAGGGCCTGTCAGGGAGGGG + Intronic
1024682476 7:51707407-51707429 CACCAGGGCCTGTCAGGGGCTGG - Intergenic
1024769191 7:52698279-52698301 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1025204257 7:56982643-56982665 CACCAGAGGCTGGAAGGGGCAGG + Intergenic
1025258453 7:57400565-57400587 AACAGGAGGCTGACAGGGCCTGG - Intergenic
1025667682 7:63594291-63594313 CACCAGAGGCTGGAAGGGGCAGG - Intergenic
1025862487 7:65344545-65344567 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1026212509 7:68318330-68318352 CACTGGGGCCTGTCAGGGAGGGG + Intergenic
1026617719 7:71921195-71921217 CACCGCAGCCTCTCAGGGAGTGG + Intronic
1027276088 7:76557758-76557780 CACCGGAGCCTGTTAGGGGATGG + Intergenic
1027843897 7:83347573-83347595 CACCGGGGCCTGTCAGGGGTCGG + Intergenic
1027849449 7:83430663-83430685 CACCGGGGCCTGTCAGGGGCTGG + Intronic
1028152455 7:87389607-87389629 CACCGGGGGCTGTCATGGGGTGG + Intronic
1028316228 7:89406074-89406096 CACCAGGGCCTGTCAGGGAGTGG - Intergenic
1028832644 7:95343932-95343954 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1028955394 7:96683862-96683884 CACTGGAGTCTGTCAGGGGGTGG + Intronic
1030186056 7:106763185-106763207 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1030226367 7:107156090-107156112 CACCGGGGCCTGTCAGGGGGTGG + Intronic
1030386643 7:108874929-108874951 CACCTGTGGCTGTCAGGGTGGGG - Intergenic
1030464984 7:109889783-109889805 CACCGAGGCCTGTCAGGGAGTGG + Intergenic
1030470668 7:109959011-109959033 CAGCGGGGCCTGTCAGGGGCTGG + Intergenic
1030921962 7:115401877-115401899 CACCAGGGCCTGTCAGGGGCTGG + Intergenic
1031436847 7:121742778-121742800 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1031570186 7:123349670-123349692 CACCGGTGCCTGTCAGGGGGTGG + Intergenic
1031744566 7:125477901-125477923 CACCAGGGCCTGTCAGGGATGGG - Intergenic
1031756837 7:125654881-125654903 CACCGGGGCCTGTCAGGGTGTGG - Intergenic
1032197851 7:129799616-129799638 CTCCGGAGGCTGCTAGGGGCGGG - Intergenic
1033838866 7:145349376-145349398 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1034039568 7:147863086-147863108 CACTGGGGCCTGTCAGGGAGTGG - Intronic
1035090936 7:156309630-156309652 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1035261724 7:157665969-157665991 CACCACAGCCTGTCAGGGGCTGG + Intronic
1035937075 8:3852694-3852716 CTTTGGAGGCTGTGAGGGACGGG + Intronic
1036406161 8:8456926-8456948 CACCGGGGCCTGTCAGGGAGTGG - Intergenic
1036707847 8:11058672-11058694 CACCGGAGCCTGTCGTGGGCTGG + Intronic
1037060488 8:14503281-14503303 CACCGGAGCCTGTCAGGGGATGG + Intronic
1037612368 8:20487033-20487055 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1038484738 8:27926432-27926454 CACCGGGGCCTGTCAGGGGGTGG + Intronic
1039712382 8:40068869-40068891 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1040335592 8:46414383-46414405 CACCGAAGGCTGTCCCGGGCGGG + Intergenic
1040355491 8:46613865-46613887 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1040942488 8:52846869-52846891 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1041116471 8:54542643-54542665 CACTGGAGCCTGTCAGGGAGTGG - Intergenic
1041161081 8:55044443-55044465 CACCGGAGCCTGTCATGGTGTGG + Intergenic
1041381584 8:57258771-57258793 CAGCGGAGGCTGTCAGGGATGGG - Intergenic
1042349520 8:67762775-67762797 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
1043443866 8:80300516-80300538 CACCGGAGTCTGGGAGGGAGAGG - Intergenic
1043532959 8:81171170-81171192 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
1043571742 8:81611418-81611440 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
1043700397 8:83280289-83280311 CACTGGAGCCTGTCAGTGAGTGG - Intergenic
1043767176 8:84150986-84151008 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1043828836 8:84963237-84963259 CACTGGGGCCTGTCGGGGACTGG + Intergenic
1043890766 8:85650557-85650579 CACCGGGGCCTGTCATGGGCGGG - Intergenic
1043893722 8:85719946-85719968 CACCGGGGCCTGTCATGGGCGGG + Intergenic
1043896402 8:85741395-85741417 CACCGGGGCCTGTCATGGGCGGG + Intergenic
1043898599 8:85758780-85758802 CACCGGGGCCTGTCATGGGCGGG - Intergenic
1043900212 8:85770974-85770996 CACCGGGGCCTGTCATGGGCGGG - Intergenic
1043902174 8:85786249-85786271 CACCGGGGCCTGTCATGGGCGGG - Intergenic
1043903783 8:85798442-85798464 CACCGGGGCCTGTCATGGGCGGG - Intergenic
1043905395 8:85810636-85810658 CACCGGGGCCTGTCATGGGCGGG - Intergenic
1043907004 8:85822823-85822845 CACCGGGGCCTGTCATGGGCGGG - Intergenic
1044016695 8:87054676-87054698 CCCAGCAGGCTGTCAGGGACTGG + Intronic
1044615088 8:94131833-94131855 CACCAGAGCCTGTCAGGGGGTGG - Intronic
1044858021 8:96495061-96495083 CACCGCGGGGCGTCAGGGACGGG + Intronic
1045965665 8:108021755-108021777 CACCGGGGCCTGTCGGGGGCAGG + Intronic
1046229177 8:111331097-111331119 CACTGGGGTCTGTCAGGGACAGG - Intergenic
1046401700 8:113713097-113713119 CACCGGGGCCTGTCAGGGTATGG + Intergenic
1046498296 8:115042832-115042854 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1047121806 8:121913145-121913167 CACAGGGGCCTGTCAGGGGCTGG + Intergenic
1047345971 8:124028943-124028965 CACCGGGGCCTGTCAGGGGATGG - Intronic
1048466267 8:134667119-134667141 CACTGGGGCCTGTCAGGGGCTGG + Intronic
1048541095 8:135342788-135342810 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1048594724 8:135854377-135854399 CACCGGGGCCTGTCGGGGAGTGG - Intergenic
1048902632 8:139053961-139053983 CACCGGGGCCTGTCATGGGCTGG - Intergenic
1049078210 8:140418046-140418068 CACCAGGGCCTGTCAGGGAATGG + Intronic
1049320856 8:141995457-141995479 CACCAGAGCCACTCAGGGACAGG - Intergenic
1049442879 8:142617235-142617257 CTCCAGTGGCTGTCAGGGACGGG - Intergenic
1049661811 8:143822961-143822983 CACAGGAGGCAGGAAGGGACAGG + Intronic
1050066485 9:1765165-1765187 CACCGGGGCCTGTCAGGGGTTGG + Intergenic
1050132971 9:2431718-2431740 CACCAGGGTCTGTCAGGGGCTGG - Intergenic
1050181454 9:2927360-2927382 CACAGGAGCCTGTCAGGGAGTGG + Intergenic
1051241157 9:15057429-15057451 CACCGGGGCCTGTCACGGAGTGG + Intergenic
1051272175 9:15366168-15366190 CACAGGGGCCTGTCGGGGACTGG - Intergenic
1052068708 9:24055195-24055217 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1052143504 9:25019744-25019766 CACTGGGGCCTGTCAGGGAGTGG - Intergenic
1052290773 9:26837589-26837611 CACCGGGGCCTGTCGGGGAGTGG + Intergenic
1052451009 9:28631314-28631336 CACCGGAGCCTGTCATGGGGTGG - Intronic
1052516048 9:29481275-29481297 CACCGGGGCCTGTCAGGGTGTGG - Intergenic
1052618672 9:30876888-30876910 CACTGGGGTCTGTCAGGGACTGG + Intergenic
1055343636 9:75311554-75311576 CACCGGGGCCTGTCATGGAGTGG - Intergenic
1055624775 9:78165188-78165210 CACCGGGACCTGTCAGGGAGTGG - Intergenic
1055737830 9:79351388-79351410 CACTGGAGCCTGTCAGGGGTTGG - Intergenic
1056861604 9:90189727-90189749 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1056888021 9:90462724-90462746 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
1057017891 9:91669791-91669813 CACCGGGGTCTGTCAGGGGATGG - Intronic
1057682247 9:97199840-97199862 CGCCGGCGGCTGCCAGGGAGAGG - Intergenic
1060171822 9:121468175-121468197 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1060979636 9:127785159-127785181 CAACGGAGGGTGGCGGGGACCGG + Intergenic
1061016918 9:127986712-127986734 CAAGGGAGGCAGTCAGGGACGGG - Intergenic
1061509604 9:131052580-131052602 CAGCTGAGGCTGGAAGGGACAGG + Exonic
1061921607 9:133785526-133785548 CAGCGGAGCCTGCCTGGGACAGG + Intronic
1062253030 9:135607898-135607920 CACCCGAGGCTGGCAGCGTCTGG + Intergenic
1062393317 9:136342624-136342646 CAGCTGAGCCTGGCAGGGACAGG + Intronic
1062636696 9:137495204-137495226 CACCGGAGGCTGTCAGGGACAGG - Intronic
1203437968 Un_GL000195v1:160292-160314 CACTGGAGCCTGTCAGGAAGTGG - Intergenic
1185531537 X:823075-823097 CACTGGGGCCTGTCAGGGTCTGG - Intergenic
1185648651 X:1632838-1632860 CACTGGGGCCTGTCAGGGCCTGG + Intronic
1185655593 X:1682513-1682535 CACCGGGGCCTGTCAGGGGCTGG - Intergenic
1185917677 X:4053901-4053923 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1186347500 X:8709098-8709120 CACCAGAGCCTGTCAGGGGGTGG + Intronic
1186508034 X:10109834-10109856 CGGCCGAGGCTGACAGGGACCGG + Exonic
1186726268 X:12362362-12362384 CACCGGGGCCTGTCATGGAGTGG - Intronic
1186825141 X:13331759-13331781 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1186929689 X:14375060-14375082 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
1186950709 X:14621519-14621541 CACCGGGGCCTGTCGGGGGCTGG - Intronic
1187049722 X:15683744-15683766 CACGGGAGGCTGTGAGGCAGGGG + Intergenic
1187258324 X:17661430-17661452 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1187759470 X:22564576-22564598 CACCGGGGCCTGTCAGGGGATGG + Intergenic
1188178294 X:27021941-27021963 CACCGGGGCCTGTCAGGGAGTGG - Intergenic
1188466321 X:30485724-30485746 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1188932273 X:36126252-36126274 CACCGGGGCCTGTCAGGGGGTGG - Intronic
1189188756 X:39077152-39077174 CACTGGAGCCTGTCAGAGGCTGG - Intergenic
1189574465 X:42336609-42336631 AACCGGAGCCTGTCAGGGGGTGG - Intergenic
1189660816 X:43296331-43296353 AACCGGAGCCTGTCAGGGTGTGG + Intergenic
1190358978 X:49631516-49631538 CACCGGAGCCTGTCAGAGGGTGG - Intergenic
1190511063 X:51174972-51174994 CACCGGAGCCTGCCAGGGGTGGG + Intergenic
1190943407 X:55067211-55067233 CACCGGGGCCTGTCAGGGGTGGG - Intergenic
1191200673 X:57777976-57777998 CACTGGAGCCTGTCATGGGCTGG - Intergenic
1191738261 X:64410108-64410130 CACCGGGGCCTGTCGGGGGCTGG + Intergenic
1192031198 X:67514299-67514321 CATTGGAGCCTGTCAGGGAGAGG + Intergenic
1192045632 X:67670756-67670778 CACCAGGGCCTGTCAGGGAGTGG - Intronic
1192538201 X:71946538-71946560 CACAGGAGACTGACAGGGAGCGG + Intergenic
1192723376 X:73723796-73723818 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1192889517 X:75374216-75374238 CACCGGGGCCTGTCGGGGGCTGG + Intronic
1192939125 X:75894114-75894136 CACCGGGGCCTGTCAGGGGGCGG - Intergenic
1192962925 X:76149057-76149079 CTCCTGAGGCTGTCATGGGCGGG + Intergenic
1193217848 X:78885487-78885509 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1193400863 X:81040587-81040609 CACCAGGGACTGTCAGGGAAGGG + Intergenic
1193517540 X:82487468-82487490 CAGCGGTGGCTGCCAGAGACTGG + Intergenic
1193721949 X:84997436-84997458 CACAGGGGCCTGTCAGGGGCTGG + Intergenic
1193868006 X:86761200-86761222 CACTGGGGCCTGTCAGGGATGGG - Intronic
1194056920 X:89146418-89146440 CACCAGAGCCTGTCAGGGGGTGG + Intergenic
1194610311 X:96035392-96035414 CACCGGCGCCTGTCAGGGGGTGG + Intergenic
1195345621 X:103948024-103948046 CACTGGAGCCTGTCGGGGAGCGG + Intronic
1195825199 X:108992012-108992034 CACCAGGGCCTGTCAGGGAGTGG - Intergenic
1196073953 X:111554131-111554153 CACTGGGGCCTGTCAGGGGCTGG + Intergenic
1197320107 X:125017854-125017876 CACCGGAGCCTATCAGGGGTTGG + Intergenic
1197405309 X:126041238-126041260 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1197456159 X:126678070-126678092 CACTGGAGCCTGTCAGGGGTGGG + Intergenic
1197576350 X:128216929-128216951 CACTGGGGCCTGTCAGGGAGTGG + Intergenic
1198794529 X:140381427-140381449 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1198869141 X:141157268-141157290 CACCGGGGCCTGTCAGGGGGTGG + Intergenic
1198875347 X:141219045-141219067 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1198978283 X:142362347-142362369 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1199344617 X:146723945-146723967 CACTGGGGCCTGTCAGGGGCTGG + Intergenic
1199780807 X:151057594-151057616 CACTGGGGCCTGTCAGGGGCTGG - Intergenic
1199925742 X:152461817-152461839 CACTGGAGCCTGTCAGGGGAGGG + Intergenic
1200355132 X:155541201-155541223 CACTGGGGCCTGTCAGGGAGTGG - Intronic
1200370267 X:155717562-155717584 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1200370852 X:155722938-155722960 CACCGGGGCCTGTCAGGGGGTGG - Intergenic
1200743804 Y:6884266-6884288 CACTGGGGCCTGTCAGGGGCTGG + Intergenic
1200951256 Y:8902133-8902155 CACAGCAGGCTGTCTGGGCCTGG - Intergenic
1201253464 Y:12084452-12084474 CACCGGGGCCTGTCAGGGTATGG + Intergenic