ID: 1062637585

View in Genome Browser
Species Human (GRCh38)
Location 9:137499700-137499722
Sequence CCCCGAGCCGGGCAAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 321}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062637585_1062637598 18 Left 1062637585 9:137499700-137499722 CCTGCCCCTTGCCCGGCTCGGGG 0: 1
1: 0
2: 1
3: 35
4: 321
Right 1062637598 9:137499741-137499763 AACGGCGCGGTGCCATTTGCTGG No data
1062637585_1062637593 0 Left 1062637585 9:137499700-137499722 CCTGCCCCTTGCCCGGCTCGGGG 0: 1
1: 0
2: 1
3: 35
4: 321
Right 1062637593 9:137499723-137499745 TCCCCAGGCTGAAGCAGCAACGG No data
1062637585_1062637597 5 Left 1062637585 9:137499700-137499722 CCTGCCCCTTGCCCGGCTCGGGG 0: 1
1: 0
2: 1
3: 35
4: 321
Right 1062637597 9:137499728-137499750 AGGCTGAAGCAGCAACGGCGCGG No data
1062637585_1062637599 26 Left 1062637585 9:137499700-137499722 CCTGCCCCTTGCCCGGCTCGGGG 0: 1
1: 0
2: 1
3: 35
4: 321
Right 1062637599 9:137499749-137499771 GGTGCCATTTGCTGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062637585 Original CRISPR CCCCGAGCCGGGCAAGGGGC AGG (reversed) Intronic
900297559 1:1959618-1959640 ACCCGAGCTGGGCAGGTGGCAGG - Intronic
900435698 1:2629565-2629587 CCCCGAGCCCGGCCCGAGGCTGG + Intronic
900475840 1:2875993-2876015 CCCGGAGCAGGGCAGGGGCCAGG - Intergenic
900658846 1:3772954-3772976 CAAGGAGCCGGGCAAGGAGCCGG - Intronic
900927745 1:5716761-5716783 CCCAGGGCCGGGCATGGGACAGG - Intergenic
901066591 1:6497332-6497354 CCCCGTGCCGCGCGGGGGGCGGG + Intronic
901180251 1:7336747-7336769 TCCCGAGGTGGGCAGGGGGCTGG + Intronic
901876607 1:12170228-12170250 CCCAGAGCCAGGCACTGGGCTGG - Intronic
902289950 1:15429155-15429177 CTCCCAGCCTGGGAAGGGGCTGG - Exonic
903136795 1:21314548-21314570 CACCCAGCTTGGCAAGGGGCTGG - Intronic
903180197 1:21601481-21601503 TCCAGAGCCGGGCGCGGGGCTGG + Intronic
903476815 1:23625150-23625172 CACCGCGCCTGGCCAGGGGCTGG + Intronic
903789905 1:25885772-25885794 CCCAGGGCTGGGCAAAGGGCAGG + Exonic
904044853 1:27603101-27603123 CCCCGAGCCGGGGGAGCCGCGGG + Intronic
904213128 1:28898730-28898752 GGCCAAGGCGGGCAAGGGGCAGG - Intronic
904533133 1:31182092-31182114 CCCCGTGCAGGGCCTGGGGCGGG + Intronic
904536381 1:31202191-31202213 CCCCCAGCTGGGGAAGGGGTGGG - Intronic
905031330 1:34886036-34886058 CCTAGGGCCGGGCCAGGGGCAGG + Intronic
905369231 1:37474493-37474515 CGCGGAAGCGGGCAAGGGGCGGG - Intergenic
905390576 1:37633590-37633612 CCCCGGGCCGGGCTACAGGCTGG + Intronic
905648279 1:39639698-39639720 CCCCGAGGCGGGGCCGGGGCGGG - Exonic
905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG + Intergenic
907450359 1:54542300-54542322 CCCCGAGCCCAGCCAGAGGCGGG - Intronic
911176164 1:94820361-94820383 CCGCGAGCCGGGGCCGGGGCCGG - Exonic
912208591 1:107534561-107534583 CCCAGTGCCTGGCACGGGGCTGG + Intergenic
912532789 1:110338633-110338655 ACCTGTGCCGGCCAAGGGGCGGG - Exonic
913255002 1:116945019-116945041 CGCCGAGCAGGGCAACTGGCAGG + Exonic
914004202 1:143718175-143718197 CCCTGGGGCGGGCAACGGGCAGG + Intergenic
914033027 1:143975412-143975434 CCCCAAGCCGGGCAGGGTGGGGG + Intergenic
914095431 1:144540527-144540549 CCCCGGGGAGGGCAACGGGCAGG + Intergenic
914156418 1:145092554-145092576 CCCCAAGCCGGGCAGGGTGGGGG - Intronic
914303094 1:146393366-146393388 CCCCGGGGAGGGCAACGGGCAGG - Intergenic
914313448 1:146487310-146487332 CCGCGGGGCGGGCAACGGGCAGG + Intergenic
914479131 1:148049257-148049279 CCGCGGGGCGGGCAACGGGCAGG + Intergenic
914500902 1:148246071-148246093 CCGCGGGGCGGGCAACGGGCAGG - Intergenic
915490029 1:156245721-156245743 CCCGGAGCGGGGCGAGGGGTGGG - Intronic
917876796 1:179293657-179293679 CCGCGCGCCCGGGAAGGGGCGGG + Intergenic
918105614 1:181413195-181413217 CCCGCAGCCGGGCAGGGGGCGGG - Intronic
918114329 1:181483828-181483850 CCCCGTGCCGGCCTCGGGGCAGG + Exonic
921060365 1:211579415-211579437 CCCGGAGCCGGGCGTGGGCCGGG + Intergenic
922718038 1:227887153-227887175 TCCTGGGCCGGGCAGGGGGCGGG + Intergenic
1062847241 10:717604-717626 CCCAGGGCCGGGCAAGGGACGGG + Intergenic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1065727062 10:28677209-28677231 TCCCGAGCCGGTCCCGGGGCTGG + Intergenic
1069626608 10:69871735-69871757 GCCAGAGACGGGCATGGGGCTGG - Intronic
1070772065 10:79088334-79088356 CCCTGGGCAGGGCCAGGGGCTGG + Intronic
1070773528 10:79096717-79096739 CCCAGAGCCTAGCAGGGGGCTGG - Intronic
1073063698 10:100746318-100746340 CCCCGAGCCGGGACAGGAGCCGG - Intronic
1073578317 10:104642441-104642463 CCCCGAGGCGAGCAGGAGGCTGG - Intronic
1073607477 10:104910908-104910930 CCCTGAGCCAGGCATGGGCCTGG - Intronic
1074363245 10:112839206-112839228 CCCTGAGGAGGGAAAGGGGCTGG - Intergenic
1074377406 10:112951340-112951362 GGCCGAGCCGGGCGCGGGGCCGG - Intronic
1076279337 10:129232523-129232545 CCCCGGGCAGGGGCAGGGGCAGG - Intergenic
1076745405 10:132510300-132510322 CCTCGAGCCAGGCCAGGGCCGGG + Intergenic
1076785351 10:132746972-132746994 CCCAGAGCCCAGGAAGGGGCCGG - Intronic
1077143271 11:1034148-1034170 CACCCAGGCGGCCAAGGGGCAGG - Intronic
1077177543 11:1197565-1197587 CACGAAGCCGGGCAGGGGGCAGG - Intronic
1077601957 11:3580632-3580654 CCCCTAGCAGGGGAAGGGGCGGG - Intergenic
1078771858 11:14358918-14358940 CCCGGAGCCGGGCCTAGGGCGGG - Exonic
1083632447 11:64102733-64102755 CTATGAGCCGGGGAAGGGGCTGG - Intronic
1083678330 11:64340254-64340276 CCCCGACCCGGGCATGGAGGGGG + Exonic
1084257866 11:67955178-67955200 CCCCTAGCAGGGGAAGGGGCGGG - Intergenic
1084275209 11:68047812-68047834 CCCCCAGCCGGGCTGGGGCCCGG - Intronic
1084791629 11:71478598-71478620 TCCCGAGCGTGGAAAGGGGCTGG + Intronic
1084814893 11:71640059-71640081 CCCTCAGCAGGGGAAGGGGCGGG + Intergenic
1087181273 11:95144775-95144797 CCCCCAGTGGGGAAAGGGGCTGG + Intergenic
1088847851 11:113682707-113682729 CCCTGAGCCTGGCATGTGGCTGG + Intergenic
1089303815 11:117514455-117514477 CCCCGAGCCAGGGAAAGGACAGG - Intronic
1089496389 11:118910439-118910461 CCTCGAGCTGGGGACGGGGCGGG - Exonic
1090363953 11:126191016-126191038 CCGCGAGCCAGGCACGGTGCTGG - Intergenic
1091361354 11:134980897-134980919 TCCCAGGCTGGGCAAGGGGCAGG + Intergenic
1092428102 12:8389975-8389997 CCCCTAGCAGGGGAAGGGCCGGG - Intergenic
1096104167 12:48986849-48986871 CCCCCAGCCGGGCCAGGCGGCGG - Intergenic
1097195453 12:57240292-57240314 CCCCAAGCCCGGCCAGGAGCCGG - Intronic
1097241182 12:57576313-57576335 CCCGGAGCCGGGCCAGCTGCCGG - Exonic
1098897833 12:76084022-76084044 CCCCGAGGCGGGGAGGGGGCGGG - Intronic
1099133285 12:78863561-78863583 CCGCGCGCCAGGCTAGGGGCGGG - Intergenic
1099574364 12:84362009-84362031 CCGCGAGCCAGGCCAGGGGTAGG + Intergenic
1103321252 12:120093908-120093930 CCCTGAGCAGGGGAAAGGGCTGG - Exonic
1103407499 12:120686535-120686557 CCCCGAGCCCGCTAAGGGGAGGG + Intergenic
1103410916 12:120710785-120710807 CCCCGCGCTGGTCAAGTGGCCGG - Intronic
1103964834 12:124632212-124632234 CCCCCAGGCTGGCAAGGTGCTGG - Intergenic
1104020560 12:124989211-124989233 AGCCGGGCCGGGCAGGGGGCGGG + Intergenic
1104568311 12:129903973-129903995 GCCCCAGCCGGGCCCGGGGCCGG - Intergenic
1104970473 12:132528505-132528527 CCCCGTGGCGGGCAGGGGGAAGG + Intronic
1105243569 13:18628505-18628527 CGCCGAGCCGGGCGACGAGCGGG - Intergenic
1106602674 13:31200601-31200623 CCCCGCGCCGGGCGGGAGGCTGG + Intronic
1106647078 13:31647765-31647787 CCCTGAGTTGGGCAAGGGGACGG - Intergenic
1106735907 13:32587113-32587135 CCCCCTTCCGGGCGAGGGGCGGG + Intronic
1107596984 13:41973395-41973417 CCCCAAGCTCGGCAAGGTGCTGG - Intergenic
1108527614 13:51299464-51299486 CCCTGAGCCAGGCTAGGGGAGGG - Intergenic
1113981449 13:114280657-114280679 CCACAAGCGGGGCCAGGGGCTGG - Intergenic
1114492690 14:23113330-23113352 CCCAGGGCCTGGGAAGGGGCAGG - Intergenic
1115203221 14:30874996-30875018 CACCCAGCGGAGCAAGGGGCCGG - Intronic
1119219252 14:72893165-72893187 CTCCCGGCCGGGCGAGGGGCAGG - Intronic
1121742359 14:96263121-96263143 TCCAGTGCCTGGCAAGGGGCTGG + Intronic
1122131183 14:99605082-99605104 CGCCGCTCCGGGCAGGGGGCAGG - Intergenic
1122544846 14:102516754-102516776 GCCCGAGGCGGGGAAGGGGCCGG + Intergenic
1122548893 14:102539458-102539480 CCCCCGGCCCGCCAAGGGGCGGG - Intergenic
1122719803 14:103715783-103715805 CCCCGGGCTGGGCGAGGGGCCGG + Exonic
1122858673 14:104572318-104572340 CCCAGAACGGGGCAAGGGGGAGG + Intronic
1124218117 15:27826143-27826165 CACTGTGCCGGGCAAAGGGCAGG - Intronic
1124427117 15:29571130-29571152 CCGGGAGCCGGGAGAGGGGCGGG + Intergenic
1129231196 15:74198011-74198033 CCCAGAGCTTGGCATGGGGCTGG - Intronic
1129268461 15:74407373-74407395 ACCAGAGCCAGGCCAGGGGCAGG - Intergenic
1129440573 15:75578584-75578606 CCGCGAGCCGGGCACGGGAGCGG + Intronic
1129676015 15:77632737-77632759 CCCCGCGTCGGGAGAGGGGCCGG + Intronic
1129949358 15:79572342-79572364 CCCAGAGCCCGGCAAGGACCAGG + Intergenic
1131143786 15:89999339-89999361 CCCCGTGCCGGCGAAGGTGCTGG - Intergenic
1131431716 15:92393792-92393814 CGCGGAGCCGGGCGCGGGGCGGG + Intergenic
1131838973 15:96416560-96416582 CCGTGGGACGGGCAAGGGGCGGG - Intergenic
1132314274 15:100879335-100879357 CCCCGACCCGGGCGCGGCGCAGG + Intronic
1132499813 16:280355-280377 GCCAGAGCCGGGCACGGGCCGGG + Intronic
1132583030 16:694070-694092 CCCCGCCCCGGGCAGGGGGGCGG - Exonic
1132614867 16:835451-835473 CCCCAGGCCAGGCCAGGGGCTGG + Intergenic
1132732210 16:1368000-1368022 CCAGGAGTGGGGCAAGGGGCAGG - Intronic
1132748509 16:1446838-1446860 CCCCGAGCTGAGCACGGGGCTGG + Intronic
1133040939 16:3059429-3059451 TCCCGAGCCCGGGGAGGGGCGGG + Exonic
1133271960 16:4614646-4614668 GCCGGAGCCGGGCGAGGGCCGGG - Intronic
1133370135 16:5240395-5240417 CCCCCAGCAGGGGAAGGGGCGGG + Intergenic
1133802227 16:9092624-9092646 CCCTGAGCCGGCCTCGGGGCGGG + Intronic
1136060561 16:27723482-27723504 CCCAGAGAAGCGCAAGGGGCAGG - Intronic
1136550369 16:30979566-30979588 GCCCGCGCCGGGCAGGGGTCAGG - Exonic
1136871039 16:33808526-33808548 CCCAGGGCGGGGCAGGGGGCGGG - Intergenic
1139390529 16:66604572-66604594 CCCCAGGCCGGGGAGGGGGCGGG + Intronic
1139594561 16:67950259-67950281 TCCCCAGCCGGGCGAGGGCCTGG + Intronic
1141819000 16:86432275-86432297 CCCCGAGGCGGGCCCGTGGCAGG + Intergenic
1142115542 16:88354305-88354327 CCCCGAACCTGGCACTGGGCTGG - Intergenic
1203101133 16_KI270728v1_random:1307532-1307554 CCCAGGGCGGGGCAGGGGGCGGG + Intergenic
1142741239 17:1933082-1933104 CCCAGAGCCTGGCCAGTGGCTGG + Intergenic
1142812238 17:2400757-2400779 CCGCGAGCCGGGCACAGGTCAGG + Exonic
1143487200 17:7261571-7261593 CTCCGAGCCGGGGACGAGGCTGG + Intronic
1144849992 17:18239189-18239211 CCCCGAGCCGGGCATGTGTGTGG + Intronic
1144968239 17:19091134-19091156 CCCAGAGCCCAGCATGGGGCGGG - Intergenic
1144979678 17:19160929-19160951 CCCAGAGCCCAGCATGGGGCGGG + Intergenic
1144988544 17:19217303-19217325 CCCAGAGCCCAGCATGGGGCGGG - Intronic
1145980116 17:29006063-29006085 CGCCGAGCGGGGCTGGGGGCGGG + Exonic
1146379080 17:32315192-32315214 CCCCGAGCTGGGCCTGGGCCAGG + Intronic
1146909908 17:36641835-36641857 CCGCGAGCCGGGCCTGGGCCAGG - Intergenic
1147312966 17:39605907-39605929 GCCCGAGCCGTGGAAGCGGCCGG + Exonic
1149365381 17:55938871-55938893 ACCCGAGGAGTGCAAGGGGCTGG + Intergenic
1149995784 17:61405353-61405375 TCCCGAGAGGGGCAAGGAGCCGG + Exonic
1150488767 17:65560887-65560909 CCGCGAGCCGAGCCGGGGGCCGG - Intronic
1150840453 17:68601291-68601313 CCCCGAGCCTGGCCTGGCGCCGG + Exonic
1151573038 17:74936577-74936599 TCCCGGGCTGGGCAGGGGGCAGG - Intronic
1151780161 17:76240309-76240331 CCCCGCACCGGGCGCGGGGCGGG - Exonic
1152005244 17:77676404-77676426 CCCCGCGCCGGGCGAAGAGCCGG + Intergenic
1152108075 17:78342208-78342230 CCACGGGCCGGGCGTGGGGCTGG + Intergenic
1152545962 17:81000239-81000261 CCCCATGCTGGTCAAGGGGCTGG - Intronic
1152751719 17:82065442-82065464 CTCCGCGCCGGGCCAGGGGAAGG + Exonic
1152938448 17:83153712-83153734 CCCCCAGCGGGGCAGGAGGCAGG - Intergenic
1153935314 18:9914882-9914904 CCCCGGGCCGGGGCAGGGGTCGG - Intronic
1154445369 18:14431376-14431398 CGCCGAGCCGGGCGAAGAGCGGG + Intergenic
1155654294 18:28176926-28176948 CCGCGGGCCGGGCCACGGGCGGG - Intronic
1156457216 18:37301533-37301555 CCTCGTGCCAGGCATGGGGCTGG + Intronic
1157252116 18:46104302-46104324 TCCCGGGCCCGGCGAGGGGCGGG + Intronic
1159798075 18:72867700-72867722 CCCCGAGCCGGGGCCGGGGCCGG + Exonic
1160563458 18:79772775-79772797 CCCCTACCTGGGCAAGGGGTGGG - Intergenic
1160753269 19:745253-745275 CCCCGATGCGGGGAAGGAGCAGG + Intronic
1160810083 19:1009485-1009507 CCCCGAGCTGTGCCAGGAGCTGG - Exonic
1160861076 19:1237459-1237481 CCCCGAGCCGGCCAAGGGTGGGG + Intronic
1161074483 19:2278721-2278743 CCATGAGCCGGGCACGGAGCCGG + Exonic
1161175573 19:2840842-2840864 CCCAAAGCCTGGCAGGGGGCAGG - Intergenic
1161200961 19:3014533-3014555 CCCAGAGTCGGGGAAGAGGCTGG + Intronic
1161310864 19:3593229-3593251 CCCAGAGTGGGGCAAAGGGCTGG - Exonic
1161400856 19:4065809-4065831 CCCCGGGGCGGGGAGGGGGCCGG + Intronic
1161838935 19:6667079-6667101 CCTGGATCCTGGCAAGGGGCAGG - Intronic
1162312142 19:9913907-9913929 CCCGGAGCCCGGCGGGGGGCGGG + Intronic
1162659253 19:12156512-12156534 TCCCGAGACGGGGGAGGGGCCGG - Intronic
1162687687 19:12401025-12401047 TCCCGAGGCGGGGGAGGGGCTGG - Intronic
1162781723 19:13010210-13010232 CCCTGAGCGGGCCATGGGGCAGG - Intronic
1162909900 19:13842972-13842994 CCCCGGGCCGGGCAGGGGGCGGG + Intergenic
1162931808 19:13961251-13961273 CCCCGAGCTGGGCATGGGCCTGG + Exonic
1163200883 19:15768247-15768269 ACCTGAGCCAGGCCAGGGGCTGG - Intergenic
1163216735 19:15884779-15884801 ACCAGAGCCAGGCCAGGGGCTGG - Intronic
1164272685 19:23686987-23687009 TCCCGAGAGGGGGAAGGGGCTGG - Intronic
1165230082 19:34381331-34381353 CCCAGAGCCAGGGATGGGGCAGG - Intronic
1165738077 19:38189986-38190008 CCCCCAGCCAGGAAAGGGCCAGG - Intronic
1165757963 19:38305051-38305073 CCCAGCGCTGGGCAGGGGGCAGG - Intergenic
1166134122 19:40765185-40765207 CCCAGAACAGGGGAAGGGGCAGG - Exonic
1166139528 19:40798834-40798856 CCCCGCGCTGGGCGGGGGGCGGG + Intronic
1166546327 19:43636453-43636475 CACCCAGTGGGGCAAGGGGCAGG - Intronic
1166547027 19:43639871-43639893 CCCCCGGGCGGGCAGGGGGCGGG - Intergenic
1166571294 19:43798678-43798700 CCCCGAGACGTGCTAGGCGCGGG - Intronic
1167040564 19:47020652-47020674 GCCCAAGCCGGGCGGGGGGCGGG - Intronic
1167103861 19:47419379-47419401 TCCAGAGCCGGGGAAGGGACGGG - Intronic
1167749762 19:51372502-51372524 CCCCCAGCAGGGCCAGGGACCGG + Exonic
1168308557 19:55449862-55449884 CACAGAGCTGGGCAGGGGGCTGG - Intergenic
1168669193 19:58228561-58228583 TCCCCAGCAGGGCAAGGCGCCGG + Intergenic
926053270 2:9758048-9758070 CCCTGAGCCAGGGAAGGGACTGG - Intergenic
926707341 2:15846083-15846105 CCCTGACCCAGGCAAGGGGCTGG - Intergenic
926801835 2:16665907-16665929 CCGCGAGCCGGGCTGGGGGCGGG - Intronic
927997619 2:27496943-27496965 CCCGGAGCCTGGCAAGTGGGAGG + Exonic
928091038 2:28375325-28375347 CACCCAGCCCGGCAGGGGGCAGG + Intergenic
928127783 2:28628207-28628229 CCCAGGGCATGGCAAGGGGCTGG + Intronic
929532334 2:42761034-42761056 CCTGGAGCTGGGCAAGGGCCAGG + Intergenic
932574729 2:72956335-72956357 CCCAGAGCTGAGGAAGGGGCTGG - Intronic
932682308 2:73836559-73836581 CCCTGAGCAGGGGAAAGGGCTGG + Intronic
932699750 2:73984788-73984810 CCCCGGGCCGGGCGAGAGGGGGG - Intergenic
933765698 2:85707078-85707100 TCCCAAGCCAGGCAAGGAGCTGG - Intergenic
934865044 2:97800886-97800908 CCCAGAGCCGCGCATGAGGCTGG + Intronic
936537431 2:113323141-113323163 TCCCAAGCAGGGCAGGGGGCTGG + Intergenic
937221334 2:120344648-120344670 CGCCCAGCTGGGCAAGGGTCCGG + Intergenic
938902098 2:135807066-135807088 CCCAGAGCCTGGCACAGGGCAGG + Intronic
941826196 2:169899656-169899678 CACCAGGCCGGGCAAGGGGCGGG - Intronic
944621287 2:201518170-201518192 CCCAGAGCCCGTCAAGGTGCTGG + Intronic
946321892 2:218959446-218959468 CCCCGAGCGGAGGAAGGGGAAGG - Intergenic
946328332 2:218996380-218996402 CACCGAGCGGGGCTGGGGGCTGG + Intergenic
947593563 2:231397758-231397780 CCACGAGCAGGGCCAGGGCCAGG - Exonic
947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG + Intergenic
948192495 2:236070760-236070782 CCCTGGGCCGGGGCAGGGGCGGG + Intronic
948368702 2:237474454-237474476 CCCAGAGCGGGGCAGGGGCCAGG + Intergenic
948492330 2:238321129-238321151 CCCGGAGCCGGGGGAGGGGCAGG - Intronic
1172097548 20:32467731-32467753 CCCCCAGCCCAGCAAGGGGTTGG + Intronic
1172126356 20:32627251-32627273 GCCCCAGCCGGCCAAGTGGCAGG - Intergenic
1172482332 20:35278197-35278219 CCCCGCCCCGCGCAAGGGGACGG + Intergenic
1172619537 20:36309828-36309850 CCCCAAGCCTGGCACAGGGCTGG - Intronic
1174180687 20:48672513-48672535 CTCCGAGCCGGGCAGGGGTCTGG + Intronic
1175715526 20:61252480-61252502 CCCGGTGCCGGGCACCGGGCGGG + Exonic
1175820763 20:61907589-61907611 CCCCCAGCAGGACAAGGAGCTGG - Intronic
1176123412 20:63464381-63464403 CCCCGTGCCAGGTGAGGGGCTGG - Intronic
1176178787 20:63740215-63740237 CGCCGCGCCGGGCTGGGGGCGGG + Intronic
1176194629 20:63831436-63831458 CCGGGAGCCGAGCGAGGGGCGGG - Intergenic
1176256430 20:64155441-64155463 CCTGGAGCAGGGCAAGGCGCTGG + Intronic
1176450614 21:6858483-6858505 CGCCGAGCCGGGCGACGAGCGGG - Intergenic
1176665943 21:9687794-9687816 CCCCGGGCTGGGCAGAGGGCAGG - Intergenic
1176828784 21:13723501-13723523 CGCCGAGCCGGGCGACGAGCGGG - Intergenic
1178244164 21:30935788-30935810 AGCCCAGCCAGGCAAGGGGCTGG + Intergenic
1178453738 21:32728069-32728091 CCCCGCGCGAGGGAAGGGGCGGG + Intergenic
1178497820 21:33101860-33101882 CCCCAGGCCGGGCAGGTGGCAGG + Intergenic
1179605563 21:42513608-42513630 CTCGGAGCCGGGGAAGGCGCGGG + Intronic
1179727299 21:43347645-43347667 GCCAGAGCCGGGCTGGGGGCCGG - Intergenic
1180057146 21:45364855-45364877 CCCCGACGGGGACAAGGGGCCGG + Intergenic
1180200883 21:46223382-46223404 CCCAGAGCCTGGCACGGGACAGG + Intronic
1181264193 22:21620862-21620884 CCCTGAGCCGAGCATGGTGCTGG + Intronic
1181308606 22:21931219-21931241 CCCCGAGCCAGGCGACGTGCAGG + Exonic
1181956347 22:26590110-26590132 GCCCCAGCCGGGGAAGGGGGAGG + Exonic
1182296161 22:29312078-29312100 GCCCGAGCTGGGTCAGGGGCTGG - Intronic
1183546363 22:38456228-38456250 CTCCGAGCCGGGAAGGGGGGTGG + Intergenic
1184161404 22:42699563-42699585 CCCCATGCAGGGCAAGGGGAGGG + Intronic
1184649529 22:45913219-45913241 CCCCAAGGCGGGCAGGGGGAGGG + Intergenic
1184766903 22:46576976-46576998 CCCCGAGCCGGCCGCGGGGCGGG + Intronic
1184922398 22:47614751-47614773 GAGCGAGCCGGGCAGGGGGCAGG + Intergenic
1185077982 22:48693569-48693591 CCCAGAGCCGGACCAGGGGTGGG - Intronic
1185299154 22:50070469-50070491 CACCGAGCGGGGCCAGGGCCTGG - Intronic
1185338284 22:50280450-50280472 CCACGAGCGGGGCCACGGGCGGG - Intronic
950125832 3:10509299-10509321 CCCCGAGCCAGGCAAGGCAAGGG - Intronic
950162440 3:10770763-10770785 CTCCCAGCCTGGCAAGTGGCTGG - Intergenic
950444241 3:13027047-13027069 CCCAGAGCCATGCAAGGCGCAGG + Intronic
952899772 3:38102324-38102346 CACCCAGCAGGGGAAGGGGCGGG - Intronic
953705386 3:45226361-45226383 CCCCGAGCCTGGCGAGCGGAGGG - Intergenic
954076930 3:48188314-48188336 CCCGGAGCTGGGCAAGCGGGTGG - Exonic
957072795 3:75579666-75579688 CCCCCAGCAGGGGAAGGGGCGGG - Intergenic
961453786 3:127014483-127014505 CCCCGAGACGGGCCCGAGGCAGG + Exonic
961873098 3:130002494-130002516 CCCCCAGCAGGGGAAGGGGCGGG - Intergenic
962770737 3:138608552-138608574 CCCAGAGCGGGGCCAGCGGCCGG + Intergenic
967858312 3:194134419-194134441 CCGGGACCCGGGGAAGGGGCGGG + Intergenic
968642502 4:1721614-1721636 CTCAGAGCCCGGCAACGGGCGGG + Exonic
969016407 4:4106976-4106998 CCCCCAGCAGGGGAAGGGGCGGG - Intergenic
969285657 4:6200505-6200527 CCGCGATCCGGGCAGGCGGCCGG + Exonic
969737548 4:9001348-9001370 CCCCCAGCAGGGGAAGGGGCGGG + Intergenic
969796752 4:9532911-9532933 CCCCCAGCAGGGGAAGGGGGGGG + Intergenic
972436998 4:39044654-39044676 GCCCGAGCCGGGGAAGGGGGTGG - Intergenic
973330442 4:48906497-48906519 CCCCGGCACGGGCGAGGGGCTGG - Intronic
978576839 4:110197175-110197197 CCCGGAGCTAGGCAAGGGGCCGG - Intronic
985409079 4:189664547-189664569 CCCCGGGCTGGGCAGAGGGCAGG + Intergenic
985995379 5:3594700-3594722 CCCTGAGCCTGGGAAGGCGCTGG - Intergenic
986116721 5:4782492-4782514 CAAGGAGCCAGGCAAGGGGCAGG + Intergenic
988595428 5:32586001-32586023 CCCCGCTCAGGGCGAGGGGCGGG - Intronic
991371683 5:65925977-65925999 CCCCGAGACGCGCAGGGGGCGGG - Intergenic
992563152 5:77972585-77972607 GCCCGGGCCGGGCCAGGGGTGGG + Intergenic
992939517 5:81750041-81750063 CCCCGAGCGGCGGGAGGGGCGGG - Intronic
994670129 5:102754586-102754608 CCAGGGGCCGGGCAAGGGGGTGG + Intronic
997209407 5:132068648-132068670 GCGCGAGCCGGGCAAGGGCCTGG + Intergenic
998080968 5:139274475-139274497 ACCCGAGCCTTGAAAGGGGCAGG + Intronic
999603870 5:153296234-153296256 CGGCTAGCCGGGCAGGGGGCTGG + Intergenic
1002924063 6:1594765-1594787 CCCCCAGCCTGGCAGGGCGCTGG + Intergenic
1003116407 6:3286639-3286661 GCCCGGGCCGGGGCAGGGGCAGG + Intronic
1003936263 6:10977830-10977852 CCATGAGCTGAGCAAGGGGCCGG + Intronic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005883236 6:30075555-30075577 GCCCGAGCTGGGCCCGGGGCTGG - Exonic
1006091551 6:31631731-31631753 CCCCGACCCCGGCAAGAGGTAGG - Exonic
1007701780 6:43770119-43770141 CCCCGGGGCGGGCCGGGGGCGGG + Intergenic
1007765711 6:44158679-44158701 CCCTCAGCTGGGTAAGGGGCTGG + Intergenic
1011113062 6:83859751-83859773 CCCCGGGCAGGGCCCGGGGCCGG + Exonic
1012169747 6:96002827-96002849 CCCAGAACCTGGCAAGGGCCGGG - Intergenic
1012484169 6:99702442-99702464 CACCGAGCCAGGCACGGGGTGGG - Intergenic
1013155744 6:107490068-107490090 CCGCGAGCCGAGCCGGGGGCGGG - Exonic
1016340818 6:143060475-143060497 CGCCGGGCCGGGCGAGGGGGCGG - Intronic
1017719001 6:157232159-157232181 GCCAGAGCTGGGGAAGGGGCAGG + Intergenic
1018054414 6:160039737-160039759 CCCCTAGCCTGGAAAGGTGCAGG + Intronic
1018710963 6:166497941-166497963 CTCCCAGCTGGGCAGGGGGCTGG - Intronic
1018743086 6:166744866-166744888 CCCAGAGCCGGGGAAGGCCCAGG - Intronic
1019119203 6:169790047-169790069 CCTCGAGAAGGGCAAAGGGCAGG - Intergenic
1019318732 7:405248-405270 CCCTGAGTCAGGGAAGGGGCAGG + Intergenic
1019472649 7:1229689-1229711 GCCCGGGCGGGGGAAGGGGCAGG + Intergenic
1019983937 7:4641760-4641782 CCGCGAGCAGGGCCCGGGGCGGG - Intergenic
1020105635 7:5421121-5421143 GCCCGAGGCGGGCAAGCGTCCGG + Exonic
1020130626 7:5556700-5556722 CCGGGAGCGGGGGAAGGGGCTGG + Intronic
1020228142 7:6296361-6296383 TCCAGAGCCAGGGAAGGGGCTGG + Intergenic
1020274268 7:6615425-6615447 CCCCGGGCCGGGTGAGTGGCCGG + Intergenic
1022192203 7:28027168-28027190 CCCTGAGACTGGCATGGGGCTGG - Intronic
1022196303 7:28070556-28070578 CCCGGAGCCGGACATGGGGCAGG - Intronic
1029414828 7:100436176-100436198 CCCCGGGCGGCGGAAGGGGCGGG - Exonic
1029547145 7:101216562-101216584 CCCCGTGCCAGGCAAGGGGTGGG + Intronic
1033449177 7:141447718-141447740 GCCCGAGCAGGGTTAGGGGCTGG + Intronic
1034263949 7:149772675-149772697 CCCGGAGCTGGGGAGGGGGCCGG - Intronic
1034267696 7:149789220-149789242 CACAGAGCAGGGCCAGGGGCAGG - Intergenic
1034279012 7:149838680-149838702 CCCCGAGCCGGGCTCGGGCGAGG + Intronic
1034493430 7:151406475-151406497 CCCAGAGCTGTGCAAGGGCCAGG + Intronic
1035391622 7:158508226-158508248 CCCCACGCTGGGCAGGGGGCAGG + Intronic
1036210322 8:6835520-6835542 CCGCGTGCAGGGGAAGGGGCGGG - Exonic
1036242647 8:7092610-7092632 CCCCCAGCAGGGGAAGTGGCGGG + Intergenic
1036258160 8:7221419-7221441 CCCCTAGCAGGGGAAGTGGCGGG - Intergenic
1036310209 8:7680015-7680037 CCCCTAGCAGGGGAAGTGGCGGG - Intergenic
1036664601 8:10730480-10730502 CCCCGACCCGTGCGAGGGCCAGG - Intronic
1036830089 8:12014536-12014558 CCCCTAGCAGGGGAAGGGGCGGG - Intronic
1036891629 8:12600864-12600886 CCCCTAGCAGGGGAAGTGGCGGG - Intergenic
1036899173 8:12658829-12658851 CCCCCAGCAGGGGAAGGGGCGGG - Intergenic
1037889900 8:22618558-22618580 CCCCGACCCTGGCCATGGGCGGG - Intronic
1039824088 8:41158177-41158199 CCCAGAGCTGGGCACGTGGCTGG - Intergenic
1041107580 8:54458063-54458085 CCCCGACCCGGGGGAGGGGGTGG - Exonic
1043403361 8:79905638-79905660 CACCGTGCCTGGCCAGGGGCAGG - Intergenic
1044242370 8:89902420-89902442 CCACGGCCCGGGCGAGGGGCCGG - Intronic
1045016770 8:98007325-98007347 CCTGGAGCAGAGCAAGGGGCAGG - Intronic
1045295381 8:100867931-100867953 CCCCGTGTGAGGCAAGGGGCTGG + Intergenic
1045571275 8:103371430-103371452 CCCCGAGCCCGGCGTGGGGGCGG - Intergenic
1049172823 8:141172560-141172582 CCCTGAGCGGCGCAAGGGGCAGG + Intronic
1049286191 8:141776578-141776600 CCCCGAGCCAGGCACGGAGCGGG + Intergenic
1049470325 8:142772440-142772462 CCCCAAGCCTGGGAAGGGGGAGG - Intronic
1049474542 8:142790617-142790639 GGCCGGGCCGGGCCAGGGGCCGG + Intergenic
1049515221 8:143050902-143050924 CCCCGAGCCGGGCCCTGGTCAGG - Intronic
1049686524 8:143941406-143941428 CCCTGGGCCGGGCCAGGGTCAGG + Intronic
1049751598 8:144286847-144286869 ACCCGAGCAGGGCAATGGGCAGG + Intronic
1049774423 8:144397899-144397921 CTCAGCGGCGGGCAAGGGGCAGG + Intronic
1049838571 8:144755496-144755518 TCCAGAGCCGGGGAGGGGGCGGG + Exonic
1052818933 9:33123839-33123861 CCCCGGGCGGTGAAAGGGGCTGG - Intronic
1052864147 9:33454841-33454863 CCCTGAGGCTGGCATGGGGCAGG - Intergenic
1053123104 9:35560641-35560663 CCCTGGGCCGGGAAAGGGGCTGG + Exonic
1055637882 9:78296232-78296254 CCCCTAGCCAGGCCAGGCGCAGG - Intergenic
1055804159 9:80074506-80074528 CCCAGAGCTTGGCCAGGGGCAGG - Intergenic
1056243005 9:84668394-84668416 CCGCGACCCGGGCCATGGGCTGG + Intergenic
1058908262 9:109498366-109498388 CCGCGCGCCGGGCGGGGGGCGGG + Intergenic
1060514658 9:124258166-124258188 CCCCCAGCCGGGCCGAGGGCGGG + Intronic
1060855871 9:126914862-126914884 CGCCGAGCCGGGCCGGGGCCGGG - Exonic
1062041537 9:134406634-134406656 CCCGGAGCCCAGCACGGGGCAGG + Intronic
1062117088 9:134815316-134815338 TCCAGAGCCAAGCAAGGGGCAGG - Intronic
1062168241 9:135119608-135119630 CCCCTGGTCGGGCACGGGGCAGG + Exonic
1062379146 9:136278424-136278446 CCCCGAGCTGGGCACGGCCCTGG + Intergenic
1062607873 9:137356113-137356135 GCACGAGCTGGGCAAGAGGCAGG + Intronic
1062637585 9:137499700-137499722 CCCCGAGCCGGGCAAGGGGCAGG - Intronic
1203518568 Un_GL000213v1:26034-26056 CGCCGAGCCGGGCGACGAGCGGG + Intergenic
1203660155 Un_KI270753v1:33967-33989 CCCCGGGCTGGGCAGAGGGCAGG + Intergenic
1186304211 X:8237609-8237631 CACTCAGCAGGGCAAGGGGCCGG - Intergenic
1190024834 X:46913109-46913131 CCCGAAGCCAGGCAAAGGGCAGG - Intronic
1193969972 X:88039136-88039158 CCCCGGGTCGGGCGGGGGGCGGG - Intergenic
1195479073 X:105321954-105321976 GCCCTAGCAGGCCAAGGGGCTGG + Intronic
1195668332 X:107449854-107449876 CCCCGAGCCCGGCATGGGCTTGG - Intergenic