ID: 1062638357

View in Genome Browser
Species Human (GRCh38)
Location 9:137503420-137503442
Sequence AGAAAGAAGGAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062638349_1062638357 17 Left 1062638349 9:137503380-137503402 CCAAAAAAGAAGAAGGAAGGAGG 0: 1
1: 0
2: 11
3: 121
4: 909
Right 1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062638357 Original CRISPR AGAAAGAAGGAGAATGAGGA GGG Intronic
No off target data available for this crispr