ID: 1062638785

View in Genome Browser
Species Human (GRCh38)
Location 9:137506165-137506187
Sequence CAGTCTAACCACACAGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062638782_1062638785 3 Left 1062638782 9:137506139-137506161 CCGCGGTGTGGGCTGAGCACACC 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1062638785 9:137506165-137506187 CAGTCTAACCACACAGACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 139
1062638779_1062638785 19 Left 1062638779 9:137506123-137506145 CCACTGACACAAACGTCCGCGGT 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1062638785 9:137506165-137506187 CAGTCTAACCACACAGACCCCGG 0: 1
1: 0
2: 0
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062638785 Original CRISPR CAGTCTAACCACACAGACCC CGG Intronic
902613007 1:17608101-17608123 CCCTCTCACCACACATACCCGGG - Intronic
903592461 1:24467442-24467464 CACTCTGTCCACCCAGACCCAGG - Intronic
904877874 1:33670583-33670605 GAATCTAGCCACACAGAACCTGG + Intronic
905206953 1:36348354-36348376 CAGCCTAGTCACACATACCCAGG + Intronic
905245968 1:36613587-36613609 CAGACTCACCACACAGACACAGG + Intergenic
905938207 1:41841491-41841513 CCCTCTGACCACACAGAGCCAGG + Intronic
915063079 1:153202880-153202902 CATTCCAACCACAAAGACCCTGG + Intergenic
921950480 1:220924711-220924733 GAGTCTAACAACACAGGCACTGG + Intergenic
922601625 1:226859630-226859652 CATTTTGCCCACACAGACCCTGG - Intergenic
1063475437 10:6324517-6324539 CAGGCAAACCACCCAAACCCGGG - Intergenic
1067878575 10:50024934-50024956 CAGTATGGCCACACAGGCCCAGG + Intergenic
1070644873 10:78195012-78195034 CATCCTGACGACACAGACCCTGG + Intergenic
1074760442 10:116663558-116663580 CCCTCTAACCAAACAGTCCCTGG - Intergenic
1075140397 10:119828895-119828917 AACTCTGACCACACAGAACCAGG + Exonic
1078903450 11:15662776-15662798 AACTCTAACTTCACAGACCCAGG + Intergenic
1079241984 11:18727902-18727924 GAGGCAAATCACACAGACCCAGG + Intergenic
1082044989 11:47718183-47718205 CAGTCTACCAACAGGGACCCTGG + Intronic
1082763497 11:57148539-57148561 CTGTCTGTCCACACACACCCTGG + Intergenic
1084527619 11:69706470-69706492 CCCTCTAACCACACACACCAGGG - Intergenic
1086103835 11:83128841-83128863 CAGACCAGCCCCACAGACCCAGG + Intergenic
1086408772 11:86522574-86522596 CAGTGAAAACACACAGACACAGG - Intronic
1088717877 11:112564829-112564851 CAGCCTCACCAATCAGACCCTGG - Intergenic
1091284011 11:134397965-134397987 CAGTCTGACCACAGCGACTCAGG + Intronic
1092985974 12:13846906-13846928 CAGTATAACAAAATAGACCCAGG + Intronic
1095694238 12:45126272-45126294 TAGTCTAAGCACACATACCTGGG - Intergenic
1095924086 12:47561175-47561197 CACTCCCACCAGACAGACCCAGG - Intergenic
1096599131 12:52717056-52717078 AAGTCTAACTCCACAGGCCCAGG - Intergenic
1099676619 12:85768953-85768975 CAGTCTAACCAAACATAACGTGG - Intergenic
1101615126 12:106328891-106328913 CACTCTCACCACTCAGATCCCGG + Intronic
1102442240 12:112972146-112972168 CATTCCCACCACACAGACTCTGG + Exonic
1103362170 12:120360986-120361008 CACTCTTAACTCACAGACCCAGG + Intronic
1106027259 13:25967059-25967081 CAGTCTAACCCCAGAAGCCCAGG + Intronic
1106975430 13:35205983-35206005 AATTCTAACCCTACAGACCCGGG - Intronic
1107684365 13:42881805-42881827 CACTGTTACCCCACAGACCCAGG + Intergenic
1110588571 13:77225479-77225501 CAGTCAAATCGCACAGAGCCTGG + Exonic
1114763543 14:25344848-25344870 AAGTGGAACCACACAGTCCCAGG - Intergenic
1122198816 14:100109421-100109443 CAGTCTAGACAAACAAACCCAGG - Intronic
1126761101 15:51971090-51971112 CAATCTAACATCACAGACTCCGG + Intronic
1128261212 15:66234492-66234514 CTGTCAAACTAGACAGACCCAGG + Intronic
1130404795 15:83588853-83588875 CAGTGAATACACACAGACCCTGG + Intronic
1130430927 15:83846202-83846224 CAGTGTAAGCATACAAACCCTGG - Intronic
1132405768 15:101541215-101541237 CTGTCTGTCCACAGAGACCCTGG - Intergenic
1132555691 16:571209-571231 CAGGCTAACCAGACACACACAGG - Intronic
1132555722 16:571414-571436 CAGGCTAACCAGACACACACAGG - Intronic
1132555726 16:571468-571490 CAGGCTAACCAGACACACACAGG - Intronic
1136048604 16:27634823-27634845 AAGTCTATACACATAGACCCTGG + Intronic
1139415751 16:66807927-66807949 CAGTCTCACCACAGTCACCCAGG + Intronic
1146229084 17:31093132-31093154 CAGTTAAGCCACACAGACACTGG - Intergenic
1148795680 17:50195602-50195624 CAGGCTCACCACGCACACCCTGG + Exonic
1148797190 17:50202661-50202683 CAGTCAAACCAGAGAGAACCTGG + Intergenic
1151957345 17:77387014-77387036 GGGGCTAACCACACTGACCCTGG - Intronic
1152120559 17:78415762-78415784 AAGTCTAACCACACTGTCACAGG - Intronic
1152520553 17:80853423-80853445 ATGCCTAAACACACAGACCCTGG - Intronic
1153235402 18:2981242-2981264 CCCTCTAACCACACACACCCAGG + Intronic
1156279729 18:35625181-35625203 CAATCTAACCAAAGAGTCCCGGG + Intronic
1160658032 19:283585-283607 CAGACTAACCAAACAGGCCAGGG + Intronic
1160847021 19:1170545-1170567 CTGTCTGACCACACAGCCCTCGG + Intronic
1162113790 19:8415911-8415933 CACTCAAACCACAGAGGCCCAGG - Intronic
1165145469 19:33727377-33727399 CACTCTACACACACAGACACGGG - Intronic
1165570687 19:36772489-36772511 CAGTCCAACCACACAGTCACCGG + Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927857297 2:26535650-26535672 CAGTCTCTCCACACTGACTCTGG + Intronic
930086250 2:47499335-47499357 CAGACAAACCACACACACCCTGG - Intronic
933649044 2:84834093-84834115 CCTTCCATCCACACAGACCCGGG + Intronic
935709725 2:105887468-105887490 CAGGCCTTCCACACAGACCCTGG - Intronic
937638776 2:124188167-124188189 AAGTCTAAGCACAATGACCCTGG - Intronic
939646480 2:144705507-144705529 GAGTCTAACCAGAAAGATCCTGG + Intergenic
943737823 2:191376687-191376709 CAGTCCAAACACAAAGACCATGG - Intronic
946442259 2:219706722-219706744 TAGTCTCTCCACCCAGACCCTGG - Intergenic
947508915 2:230732814-230732836 CCCACTAACCACACTGACCCAGG - Intronic
1168771745 20:420505-420527 CTGACTCACCACTCAGACCCCGG + Intronic
1170462517 20:16590567-16590589 CTGTCTGACAGCACAGACCCAGG + Intergenic
1170935566 20:20806082-20806104 CAGCCTAGCCACACAGCCTCCGG - Intergenic
1173247268 20:41345285-41345307 CAGTGGAACCACACAAACCTGGG + Intronic
1174545413 20:51321545-51321567 CAGTCTGACCACAGACACCACGG - Intergenic
1179723846 21:43330911-43330933 CAGGCTAGGCCCACAGACCCGGG + Intergenic
1179884384 21:44307184-44307206 CTGCCTCACCACCCAGACCCGGG + Intronic
1180670454 22:17548777-17548799 CAGTCTAACCACCCACATTCTGG + Exonic
1182245475 22:28954184-28954206 CTGTTTAACCACACAGTCCATGG - Intronic
1183475963 22:38035883-38035905 CAGTAAAACCACACCCACCCTGG - Intronic
1184211762 22:43040260-43040282 CAGTCTCACCTCACTTACCCTGG - Intronic
1184995909 22:48207477-48207499 CAGGATGACCACAGAGACCCAGG - Intergenic
949443167 3:4105216-4105238 CATTCTACCCTCCCAGACCCTGG - Intronic
950003007 3:9672097-9672119 CAGTGTAGCCACTCTGACCCAGG - Intronic
953780991 3:45870238-45870260 CAGGCTACACCCACAGACCCAGG + Intronic
954556483 3:51521255-51521277 CAGTTTCACCCAACAGACCCAGG - Intergenic
955397191 3:58565933-58565955 CCTTCTAACCACACCTACCCAGG - Exonic
957671222 3:83304965-83304987 CAATCTGGCCACACAGAGCCTGG - Intergenic
960855855 3:122101417-122101439 CAGTCTAACTCCGCTGACCCAGG - Intronic
966898739 3:184465244-184465266 AAGTCTATCCTCACAGATCCTGG - Intronic
969499789 4:7545688-7545710 CAATCTCACCCCACAGGCCCTGG + Intronic
970661755 4:18293155-18293177 CAGTCCACCCACACATGCCCAGG - Intergenic
970921355 4:21399195-21399217 AAGTCTAACCACTCAGAGCATGG + Intronic
973325823 4:48860879-48860901 AAGTCAAACCACAAAAACCCAGG - Exonic
977203172 4:94140443-94140465 CAGTCTCCCCTCACAGGCCCAGG - Intergenic
977760918 4:100735954-100735976 CAGTGTAAGCACAAAGACCATGG - Intronic
984837379 4:184034194-184034216 AAGTCTCACCCCAAAGACCCAGG - Intergenic
984948164 4:184986182-184986204 AAGGCTAACGGCACAGACCCAGG + Intergenic
986606853 5:9531352-9531374 CTGTCAAACCACACAAAGCCAGG - Intronic
986727645 5:10611425-10611447 CAGGCGAACCACACAGACACAGG - Intronic
988291213 5:29289440-29289462 TACTCTAACCACACAGCCACTGG - Intergenic
991297658 5:65098994-65099016 CACTCCAACCCCTCAGACCCAGG + Intergenic
994640711 5:102406236-102406258 CAGTCTAAACATAAAGACACAGG + Intronic
999227739 5:150041171-150041193 CATTCTGACCACACAGCTCCTGG + Intronic
1000122290 5:158208832-158208854 CAGTGTAACCTCCCAGACTCAGG + Intergenic
1001104370 5:168840574-168840596 CATCCTGACCACACAGAGCCAGG + Intronic
1001465152 5:171957667-171957689 CAGCCTAGCCACAAAGACCTTGG + Exonic
1002842716 6:920456-920478 TACTCCAACCACACAGACCTAGG + Intergenic
1006100710 6:31684391-31684413 CAGTCTCACCTCCCATACCCTGG - Intergenic
1006829009 6:36957726-36957748 CAGTCTACCCCTACAGAGCCTGG - Intronic
1008388913 6:50926205-50926227 CATTCTTACCACACAGTCCAGGG + Intergenic
1011490307 6:87884652-87884674 CACTCTAGCCAAACAGAGCCAGG - Intergenic
1014089880 6:117391743-117391765 CAGTGGAACCAGACAGGCCCTGG - Intronic
1018103345 6:160460709-160460731 CAGTCCAATCCCACAGAACCTGG - Intergenic
1021166385 7:17347662-17347684 CAAACTAAACACACAGACTCTGG + Intergenic
1024629002 7:51231929-51231951 AAGTCTAACCACAGCCACCCAGG + Intronic
1029180006 7:98693552-98693574 CAGGGTAACCACACAGCTCCTGG + Intergenic
1031930897 7:127684822-127684844 CACCTTAAGCACACAGACCCTGG - Intronic
1032806600 7:135361210-135361232 CATACAAACCACACAGATCCTGG + Intergenic
1033262421 7:139855344-139855366 CATTCTAAACACACAGAACCTGG + Intronic
1033586584 7:142779034-142779056 CAGGCTGGCCACACAGACACTGG + Intergenic
1035029182 7:155846319-155846341 CAGGCTCACTACACACACCCCGG - Intergenic
1035661431 8:1351389-1351411 CAGCCTATCCACACACACTCAGG - Intergenic
1035661448 8:1351479-1351501 CAGCCTATCCACACACACTCAGG - Intergenic
1035661575 8:1352167-1352189 CAGCCTATCCACACACACTCAGG - Intergenic
1036168493 8:6459977-6459999 CAGTCTAACCCCAGAGCCCGTGG - Intronic
1037748896 8:21667296-21667318 GAGTAAAACCACACAGACCCAGG + Intergenic
1042617679 8:70668683-70668705 CAGTTTAAACACGCACACCCTGG + Intronic
1045876583 8:106988843-106988865 CAATCTAAGCACACAAACCCTGG - Intergenic
1047285010 8:123480264-123480286 CAGCGTAACCACAAAGACCAGGG + Intergenic
1048538316 8:135318271-135318293 AAGTCTATCCACACAGAAACTGG + Intergenic
1049266834 8:141672066-141672088 CAGCCTCACCACTCACACCCTGG + Intergenic
1050122169 9:2318776-2318798 CAGTGGAACCATACAGACCTGGG + Intergenic
1052728084 9:32253814-32253836 CAGGTTGACCACACAGACCAAGG + Intergenic
1053309616 9:37008634-37008656 TAGTCTCACCACACACACACAGG + Intronic
1053544612 9:39009786-39009808 CAGTCCACACCCACAGACCCAGG + Intergenic
1059281773 9:113140504-113140526 CAGTCTAATCTCAGAGACACTGG + Intergenic
1060498490 9:124134984-124135006 CAGTCTCACCACACCCAGCCAGG + Intergenic
1061865505 9:133490069-133490091 CAGTATAGCCCCACAGCCCCCGG - Intergenic
1062638785 9:137506165-137506187 CAGTCTAACCACACAGACCCCGG + Intronic
1186297175 X:8162824-8162846 CAGACTGACCACACAGAGCTGGG + Intergenic
1186354827 X:8779778-8779800 CAGACTGACCACACAGAGCTGGG - Intergenic
1186376972 X:9014113-9014135 CAGACTGACCACACAGAGCTGGG - Intergenic
1188947981 X:36331826-36331848 CAGTCTATTCAAACAGAACCCGG + Intronic
1191242266 X:58198812-58198834 CATTCTAACAATACAGACACTGG + Intergenic
1191786089 X:64918501-64918523 CAGTGTAACATCACAGAGCCTGG - Intronic
1192524264 X:71828223-71828245 CAGGCTAGCCTCACAGCCCCAGG - Intergenic
1199036233 X:143053726-143053748 CAATCCCACCACCCAGACCCAGG - Intergenic
1199597049 X:149514357-149514379 CAGTGCAATCACACAGAGCCTGG - Intronic