ID: 1062639447

View in Genome Browser
Species Human (GRCh38)
Location 9:137510803-137510825
Sequence GTGACTTTCCGCCCACACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062639447_1062639455 4 Left 1062639447 9:137510803-137510825 CCCCCGTGTGGGCGGAAAGTCAC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1062639455 9:137510830-137510852 GTGCCGAGGCATGAGACTGAAGG No data
1062639447_1062639452 -10 Left 1062639447 9:137510803-137510825 CCCCCGTGTGGGCGGAAAGTCAC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1062639452 9:137510816-137510838 GGAAAGTCACCCAGGTGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062639447 Original CRISPR GTGACTTTCCGCCCACACGG GGG (reversed) Intronic
902035599 1:13455889-13455911 GTGGCTTTCTGACCACACGCTGG - Intergenic
902591244 1:17476265-17476287 GTGAGTTTCCCTCCACTCGGGGG + Intergenic
906776793 1:48536980-48537002 GTCACTTTCTGCTCACACGCTGG - Intronic
907282690 1:53361535-53361557 GTGGCTTGCCGCCCACACGTGGG + Intergenic
916834847 1:168532959-168532981 ATGAATTTCAGCCCACACCGTGG + Intergenic
919380666 1:196856506-196856528 GTCACTTTCAGCCCACAAGCAGG + Intronic
922507404 1:226134486-226134508 GTGACTTTCAGCAAAAACGGTGG + Intergenic
1062947856 10:1474644-1474666 GAGACTGTCCGCCCACCAGGAGG + Intronic
1080788603 11:35499211-35499233 GTGCCTTTCCTCCCACAGCGAGG + Intronic
1083716677 11:64581454-64581476 GTGTCCCGCCGCCCACACGGAGG - Intergenic
1084033812 11:66495871-66495893 GTGACTTGCCTCCCAAACAGTGG - Intronic
1089797125 11:120989861-120989883 GTGACTTTCTCCCCACAGGCAGG + Intergenic
1090259915 11:125312120-125312142 GTAACTTTCCTCCTACAAGGGGG + Intronic
1090271527 11:125389442-125389464 GTGGCTTTCCACCCTCATGGTGG + Intronic
1096460710 12:51820381-51820403 GTGACATCCCTCCCACGCGGAGG + Intergenic
1102621151 12:114195674-114195696 GTGAATGTCCGCCCACATTGGGG + Intergenic
1105408617 13:20151468-20151490 GTGACTTCCCGCCAGCATGGGGG - Intronic
1115821219 14:37214438-37214460 GTGGCTTGCCGCCCACAATGAGG - Intronic
1119164283 14:72479517-72479539 GTGACTTTCACCCCACCCAGGGG - Intronic
1120945441 14:89990842-89990864 GTGACTTTCCACACACATGCTGG - Intronic
1129921196 15:79320480-79320502 GTGGCTTGCCGCCCACAGGAAGG + Intronic
1133693098 16:8235228-8235250 GTGACTTTCCCACCACCCTGGGG + Intergenic
1138465179 16:57185248-57185270 GTGACTGTCAGTCCACACAGAGG - Intronic
1143784168 17:9244385-9244407 GTGGCTCTCCGCCCACCCGGGGG - Intergenic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1166434042 19:42752166-42752188 GTGACTTGCTGCCCACAAGTGGG + Intronic
1166437187 19:42777495-42777517 GTGGCTTGCCGCCCACAAGTGGG + Intronic
1166453830 19:42923609-42923631 GTGGCTTGCCGCCCACAAGTGGG + Intronic
1166466088 19:43032162-43032184 GTGGCTTGCCGCCCACAAGTGGG + Intronic
1166472229 19:43088230-43088252 GTGGCTTGCCGCCCACAAGTGGG + Intronic
1166483369 19:43192179-43192201 GTGGCTTGCCGCCCACAAGTGGG + Intronic
1166485836 19:43211266-43211288 GTGGCTTGCCGCCCACAAGTGGG + Intergenic
1167073149 19:47232062-47232084 GTGACATTCGCCCGACACGGTGG + Intronic
932478557 2:72024400-72024422 GCCACCTTCCGCCCCCACGGGGG + Intergenic
933257539 2:80098400-80098422 GTGTCAGTCCGCCCCCACGGGGG + Intronic
936144355 2:109969732-109969754 GTGGCTTGCCGCCCACAGGCGGG - Intergenic
936181038 2:110267692-110267714 GTGGCTTGCCGCCCACAGGCGGG - Intergenic
936200333 2:110401737-110401759 GTGGCTTGCCGCCCACAGGCGGG + Intergenic
946724232 2:222646201-222646223 GTGACTCTCCTCCCACAAGGAGG - Intronic
949046809 2:241876274-241876296 GTGGCTTGCTGCCCACACAGGGG + Intergenic
1175309173 20:57999480-57999502 GTGGCTTTCCCTCCACAGGGAGG - Intergenic
1179063291 21:38000409-38000431 GTGACCTTCCTTCCACACTGAGG - Intronic
1179913565 21:44462568-44462590 GTGTCTTCCAGCCCACACTGCGG + Intergenic
1184221694 22:43104853-43104875 GTGGCTTTCTGCCCACACTTTGG + Intergenic
950890310 3:16398750-16398772 GTGACTTTCCAGCCACCCAGGGG - Intronic
961195807 3:125000429-125000451 GTGACTTTCCTACCTCACTGGGG + Intronic
961603054 3:128075742-128075764 GTGCGCGTCCGCCCACACGGGGG + Intronic
968319035 3:197749670-197749692 TCGACTTTCCGCCCAAACTGGGG - Intronic
986344642 5:6823143-6823165 GATGTTTTCCGCCCACACGGCGG + Intergenic
999256724 5:150213648-150213670 GTGTCTTCCCGCCCACCCGTTGG + Intronic
1010180272 6:73078640-73078662 CTGACTTCCCTCCCACACTGTGG - Intronic
1011263324 6:85490644-85490666 GTGACTTACCGCCCACCTGCAGG - Exonic
1016941362 6:149485172-149485194 GAGACTTGCTGCCCTCACGGAGG - Intergenic
1022532889 7:31078184-31078206 GGGACTGTCTGCCCACAGGGTGG - Intronic
1029699757 7:102238636-102238658 GTGGCTTGCCGCCCACACCCAGG + Intronic
1031315669 7:120255230-120255252 GTGACTTTCCACCCACATTATGG + Intergenic
1036129422 8:6094790-6094812 GTGACTTTCCACTCAAACAGAGG + Intergenic
1044159748 8:88898651-88898673 GTGGCTTGCCACCCACACTGAGG - Intergenic
1053014744 9:34655358-34655380 GTGACTTGCCACCCTCACTGTGG + Intronic
1057554398 9:96076132-96076154 GTGGCTTGCCGCCCACACAGAGG - Intergenic
1062639447 9:137510803-137510825 GTGACTTTCCGCCCACACGGGGG - Intronic
1062642388 9:137526177-137526199 GTGGCTTGCCGCCCACAAGGAGG + Intronic
1190689676 X:52903025-52903047 GTGGCTATCAGCCCACACTGGGG - Intronic
1190696307 X:52952767-52952789 GTGGCTATCAGCCCACACTGGGG + Intronic
1201960946 Y:19680394-19680416 GTGCCTTTCTGCCCACTCAGGGG + Intergenic