ID: 1062639677

View in Genome Browser
Species Human (GRCh38)
Location 9:137512225-137512247
Sequence ATGTGTACACGCTCGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062639671_1062639677 2 Left 1062639671 9:137512200-137512222 CCATGACCCAGCAGCCCCAACAG 0: 1
1: 0
2: 3
3: 32
4: 379
Right 1062639677 9:137512225-137512247 ATGTGTACACGCTCGTGCAGTGG No data
1062639669_1062639677 24 Left 1062639669 9:137512178-137512200 CCTGAGCCAAGCACACGTGACTC 0: 1
1: 0
2: 4
3: 11
4: 110
Right 1062639677 9:137512225-137512247 ATGTGTACACGCTCGTGCAGTGG No data
1062639668_1062639677 25 Left 1062639668 9:137512177-137512199 CCCTGAGCCAAGCACACGTGACT 0: 1
1: 0
2: 1
3: 15
4: 242
Right 1062639677 9:137512225-137512247 ATGTGTACACGCTCGTGCAGTGG No data
1062639670_1062639677 18 Left 1062639670 9:137512184-137512206 CCAAGCACACGTGACTCCATGAC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1062639677 9:137512225-137512247 ATGTGTACACGCTCGTGCAGTGG No data
1062639667_1062639677 26 Left 1062639667 9:137512176-137512198 CCCCTGAGCCAAGCACACGTGAC 0: 1
1: 0
2: 0
3: 6
4: 140
Right 1062639677 9:137512225-137512247 ATGTGTACACGCTCGTGCAGTGG No data
1062639673_1062639677 -5 Left 1062639673 9:137512207-137512229 CCAGCAGCCCCAACAGAAATGTG 0: 1
1: 0
2: 10
3: 20
4: 212
Right 1062639677 9:137512225-137512247 ATGTGTACACGCTCGTGCAGTGG No data
1062639672_1062639677 -4 Left 1062639672 9:137512206-137512228 CCCAGCAGCCCCAACAGAAATGT 0: 1
1: 0
2: 0
3: 21
4: 403
Right 1062639677 9:137512225-137512247 ATGTGTACACGCTCGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062639677 Original CRISPR ATGTGTACACGCTCGTGCAG TGG Intronic
No off target data available for this crispr