ID: 1062649741

View in Genome Browser
Species Human (GRCh38)
Location 9:137569438-137569460
Sequence TGGGTGAGTGACTGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1679
Summary {0: 1, 1: 2, 2: 20, 3: 184, 4: 1472}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062649741 Original CRISPR TGGGTGAGTGACTGGCTGGC TGG (reversed) Intronic
900493443 1:2964879-2964901 TGGGTGAGTGAATAGATGGACGG - Intergenic
900509331 1:3051165-3051187 TGGATGAGTGGATGGGTGGCTGG - Intergenic
900535663 1:3175951-3175973 TGGGTGAGTGAGTGGATGGATGG - Intronic
900535670 1:3175987-3176009 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
900535671 1:3175991-3176013 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
900535802 1:3176657-3176679 TAGGTGAATGAATGGCTGGATGG - Intronic
900573448 1:3371374-3371396 TGGGTGGGTGAATGGATGGGTGG - Intronic
900573478 1:3371492-3371514 TGGGTGAGTGGGTGGATGGATGG - Intronic
900573479 1:3371496-3371518 TGGGTGGGTGAGTGGGTGGATGG - Intronic
900573497 1:3371555-3371577 TGGGTGAGTGGGTGGGTGGATGG - Intronic
900649879 1:3725559-3725581 TGGGTGGGTGAATGGATGGATGG + Intronic
900649887 1:3725583-3725605 TGGGTGGGTGAATGGATGGTTGG + Intronic
900649957 1:3725835-3725857 TGGGTGGGTGAGTGGATGGATGG + Intronic
900649975 1:3725907-3725929 TGGGTGGGTGAATGGATGGTTGG + Intronic
900661299 1:3785375-3785397 AAAGTGAGTGCCTGGCTGGCCGG - Intronic
900678823 1:3904738-3904760 TGGCTGGCTGGCTGGCTGGCCGG + Intergenic
900747801 1:4373107-4373129 TGGGTGAGTGAGTGGATGGATGG - Intergenic
900929997 1:5730406-5730428 TGAGTGAGTCTCTGGCCGGCAGG - Intergenic
900941885 1:5804182-5804204 TGGATGAGTGAATGGTTGGGTGG - Intergenic
900941900 1:5804278-5804300 TGGGTGAATGACTGGATAGATGG - Intergenic
901127237 1:6938315-6938337 CGGCTGAGAGACTGGTTGGCTGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901318013 1:8322028-8322050 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
901700500 1:11042675-11042697 TGGCTGGGTGGCTGGCTGGAGGG + Intronic
901831340 1:11894386-11894408 TGGGTGGGTGAGTGGATGGATGG + Intergenic
901831341 1:11894390-11894412 TGGGTGAGTGGATGGATGGATGG + Intergenic
901881834 1:12198662-12198684 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
902202625 1:14845196-14845218 TGGGTGAGTGAGTGGATGGGTGG + Intronic
902202638 1:14845240-14845262 TGGGTGAGTGGGTGGATGGTTGG + Intronic
902243153 1:15101958-15101980 TGGCTGACTGGCTGGCTGGCTGG - Intronic
902243154 1:15101962-15101984 TGGCTGGCTGACTGGCTGGCTGG - Intronic
902603885 1:17558117-17558139 TGGATGAGTGAATGGATGGATGG - Intronic
902715543 1:18270207-18270229 TTGGAGAGTGAGTGGATGGCAGG - Intronic
902970294 1:20043476-20043498 TGGGTGTGTGATTGGTTGCCAGG + Intronic
903002121 1:20273894-20273916 TGGGTGGGTGAATGGATGGGTGG + Intergenic
903031981 1:20470304-20470326 TTGCTGAGCAACTGGCTGGCTGG + Intergenic
903066674 1:20703541-20703563 TGGGTGAGTGGGTGGATGGATGG + Intronic
903213401 1:21830726-21830748 TGGGGGAGTGCCTGGGTGGCGGG + Intronic
903277480 1:22231242-22231264 TGGGTGTGTGAGTGGGTGGATGG - Intergenic
903277518 1:22231431-22231453 TGGGTGAATGAATGGGTGGATGG - Intergenic
903287127 1:22284339-22284361 TGGATGGCTGGCTGGCTGGCTGG - Intergenic
903287128 1:22284343-22284365 TGGGTGGATGGCTGGCTGGCTGG - Intergenic
903287129 1:22284347-22284369 TGAGTGGGTGGATGGCTGGCTGG - Intergenic
903287130 1:22284351-22284373 TGGGTGAGTGGGTGGATGGCTGG - Intergenic
903294255 1:22333611-22333633 TGGATGAGTGATTGGATGGATGG + Intergenic
903294263 1:22333655-22333677 TGGGTGATTGAGTGGATGGATGG + Intergenic
903294715 1:22336433-22336455 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294753 1:22336661-22336683 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294773 1:22336765-22336787 TGGGTGATTGAGTGGATGGGTGG - Intergenic
903294803 1:22336941-22336963 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294811 1:22336989-22337011 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294819 1:22337037-22337059 TGGGTGATTGAGTGGATGGAGGG - Intergenic
903294827 1:22337085-22337107 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294835 1:22337133-22337155 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294853 1:22337233-22337255 TGGGTGATTGAGTGGATGGATGG - Intergenic
903294872 1:22337360-22337382 TGGGTGATTGAGTGGATGGAGGG - Intergenic
903294881 1:22337408-22337430 TGGGTGATTGAGTGGATGGATGG - Intergenic
903357825 1:22758876-22758898 TGGATGAATGGATGGCTGGCTGG + Intronic
903777777 1:25804346-25804368 TTGCTGACTGACTGGCTAGCAGG - Intronic
904042372 1:27592335-27592357 TGGGTGGGTGACGAGCTGGGTGG - Intronic
904253549 1:29240645-29240667 TGGGGGAGGGGCTGGCAGGCAGG - Intronic
904263112 1:29302460-29302482 TGGGTGAGTCACTGAGTGACTGG - Intronic
904311553 1:29632700-29632722 TGGGGGACTGAGTGGCTGGGAGG - Intergenic
904642086 1:31938444-31938466 TCGCTGACTGGCTGGCTGGCCGG + Intronic
905239607 1:36573086-36573108 TGGGTGATGGACGGGCTGTCAGG + Intergenic
905274630 1:36809212-36809234 TGGGTGAGTGGTTGGATGGATGG - Intronic
905274631 1:36809216-36809238 TGGGTGGGTGAGTGGTTGGATGG - Intronic
905323045 1:37131274-37131296 TGGGTGAGGGACAGGCAGGAGGG - Intergenic
905906300 1:41620773-41620795 AGGGTGAGTGACTGGGTGAATGG - Intronic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906108095 1:43306635-43306657 TTGGTGATTTACTGGGTGGCTGG + Intronic
906551885 1:46672054-46672076 TGGGACAGTGCCTGGCTGCCTGG + Intronic
906790231 1:48652798-48652820 TGCGTGAGTGTGGGGCTGGCTGG + Intronic
908391382 1:63686759-63686781 TGGGTGAGTGGGTGGATGGTTGG - Intergenic
909359522 1:74744476-74744498 TGCGTGAGTGTTTGGCTGACAGG + Intronic
909565428 1:77048362-77048384 TGGGTGAGTGAATAACTGGGAGG - Intronic
912250823 1:108010939-108010961 TAGCTGTGGGACTGGCTGGCAGG + Intergenic
912580363 1:110715440-110715462 TGGGTGAGTGGGTGGATGGATGG - Intergenic
912727920 1:112075841-112075863 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
912727922 1:112075845-112075867 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
913521373 1:119648195-119648217 TGGCTGGTTGGCTGGCTGGCTGG + Intergenic
913521374 1:119648199-119648221 TGGTTGGCTGGCTGGCTGGCTGG + Intergenic
913521375 1:119648203-119648225 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
913521376 1:119648207-119648229 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
913521377 1:119648211-119648233 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
914047213 1:144102668-144102690 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
914047214 1:144102672-144102694 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
914047215 1:144102676-144102698 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
914047846 1:144105447-144105469 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
915195686 1:154187948-154187970 TGGGCAAGTGGATGGCTGGCTGG - Intronic
915562713 1:156696738-156696760 TTGGTCACTGAGTGGCTGGCGGG - Intergenic
916008550 1:160683661-160683683 TGGATCAGGGACTGTCTGGCTGG + Intronic
916124011 1:161553201-161553223 TTGGTGAGTGATTGGCTGAGGGG + Intergenic
916133894 1:161634563-161634585 TTGGTGAGTGATTGGCTGAGGGG + Intronic
916206747 1:162322372-162322394 TGGGAGCATGCCTGGCTGGCAGG - Intronic
916432935 1:164749676-164749698 TGGGTGAGTGGATGGATGGATGG + Intronic
918505027 1:185244554-185244576 TGGGTGAGTCAGTGGGTGGGTGG + Intronic
919756415 1:201068931-201068953 TGGGGGAGCCACAGGCTGGCTGG + Intronic
919895665 1:202008342-202008364 TGGGTGAGGGACTGGGTGGAGGG + Exonic
920113641 1:203604135-203604157 TGGGTGGATGAATGGATGGCTGG - Intergenic
920356389 1:205376333-205376355 TGTGTGAGAGACTGCATGGCAGG - Intergenic
920366285 1:205449941-205449963 TGGAGGAGTGAGTGGCTGCCTGG - Intronic
920390024 1:205594076-205594098 TGGGTGAGGGATGGGCTGCCTGG - Intronic
921047016 1:211484945-211484967 TGGGCGGGCGACTGTCTGGCAGG + Intronic
921825596 1:219668601-219668623 TGAGTGATTGGCTGGCTGGTTGG - Intergenic
921825597 1:219668605-219668627 TTGTTGAGTGATTGGCTGGCTGG - Intergenic
922526914 1:226310781-226310803 TGGGTGAGTCACTGGGTGTGAGG + Intergenic
922576591 1:226664991-226665013 TGGGTGAGTGACTAGCAGCCAGG + Intronic
922795687 1:228338370-228338392 GAGGTGAGTGACTGCCGGGCCGG + Exonic
922964360 1:229675623-229675645 TGGGTGAGTGAGTGGGTGTGTGG - Intergenic
922989714 1:229896124-229896146 TGGGGGAGTGAGGGGCTGGGAGG - Intergenic
1062820029 10:527990-528012 TGGGTGATTGCCATGCTGGCGGG - Intronic
1062943707 10:1444329-1444351 TGGGTGAGTGGATGGCTGGGTGG - Intronic
1062943709 10:1444333-1444355 TGGATGGGTGAGTGGATGGCTGG - Intronic
1063073283 10:2688960-2688982 TGGGTGAGTGGATGGATGGATGG - Intergenic
1063073309 10:2689103-2689125 TGGATGAGTGGCTGGATGGATGG - Intergenic
1063378471 10:5569159-5569181 TGGGTGAGTGGTTGGTTGGTTGG + Intergenic
1063378484 10:5569221-5569243 TAGGTGAGTGCTTGGTTGGCTGG + Intergenic
1063502715 10:6569640-6569662 TGGGAGTGTGACAGGCTGGAGGG + Intronic
1064271645 10:13871184-13871206 AGCGTGAGTGCCTGGCTGGGAGG - Intronic
1064497600 10:15929910-15929932 TGGTTGGTTGGCTGGCTGGCTGG - Intergenic
1064953046 10:20875721-20875743 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1064953047 10:20875725-20875747 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1064953048 10:20875729-20875751 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1066593816 10:37026046-37026068 TGGATGAGTAGCTGGGTGGCTGG + Intergenic
1066593818 10:37026058-37026080 TGGGTGGCTGGCTGGCTAGCTGG + Intergenic
1067289052 10:44928262-44928284 TGGGTGAGTGGATGGATGGGTGG - Intronic
1067297810 10:44984778-44984800 TGGGTGAGAGAATGGCAGGGTGG - Intronic
1067659191 10:48221823-48221845 TGGGTGTGTGGGTGGCTGGGTGG + Intronic
1067659209 10:48221891-48221913 TGGGTGGGTGAGTGGATGGATGG + Intronic
1067659210 10:48221895-48221917 TGGGTGAGTGGATGGATGGATGG + Intronic
1067709628 10:48637600-48637622 TGGGTGGGTGAATGGATGGATGG + Intronic
1069694456 10:70376628-70376650 TGGGTGGGCCCCTGGCTGGCAGG - Intronic
1069717720 10:70531574-70531596 TGGGTGAGTGGCTGGCTGCAAGG + Intronic
1069735591 10:70652040-70652062 GGAGTCAGTGACTGGGTGGCAGG - Intergenic
1069824456 10:71246552-71246574 TTGGTGAGTGACTGGGTTGAGGG + Intronic
1070362115 10:75700774-75700796 TGGGTGGGTGAATGGATGGATGG + Intronic
1070810302 10:79294209-79294231 TGGGGAAGTGACTGGAAGGCCGG + Intronic
1071433816 10:85627915-85627937 TGGGGGAGTGACTGGCAGGAGGG - Intronic
1071505283 10:86228202-86228224 TGGGTGGGTGAGTAGGTGGCCGG + Intronic
1072726398 10:97816676-97816698 TGGGATGGTGGCTGGCTGGCTGG + Intergenic
1072734904 10:97872604-97872626 TGAGTGAATCACTGGCTGGATGG + Intronic
1072734907 10:97872616-97872638 TGGCTGGATGGCTGGCTGGCTGG + Intronic
1072783917 10:98267963-98267985 TTGGTGAGCGACTGGAGGGCCGG + Intronic
1072796080 10:98355512-98355534 TGGGTGTGTGGCTGGCTGGAAGG + Intergenic
1074767905 10:116714072-116714094 TGGGTGGGTGAGTGGATGGATGG + Intronic
1074767906 10:116714076-116714098 TGGGTGAGTGGATGGATGGACGG + Intronic
1074872293 10:117586756-117586778 TGGGTGAATGATTGGATGGGTGG - Intergenic
1075901919 10:126049989-126050011 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1075901920 10:126049993-126050015 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1075901921 10:126049997-126050019 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1075901922 10:126050001-126050023 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1075901923 10:126050005-126050027 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1075901924 10:126050009-126050031 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1075902098 10:126051437-126051459 TGGCTGGGTGGCTGGCTGGATGG - Intronic
1075902122 10:126051517-126051539 TGGGTGGCTGGCTGGCTGGATGG - Intronic
1075902123 10:126051521-126051543 TGGATGGGTGGCTGGCTGGCTGG - Intronic
1075902156 10:126051641-126051663 TGGGTGGCCGGCTGGCTGGCTGG - Intronic
1075902157 10:126051645-126051667 TGGATGGGTGGCCGGCTGGCTGG - Intronic
1075902164 10:126051669-126051691 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1076158149 10:128219552-128219574 TGGGTGAGTGAGTGACTGGGTGG - Intergenic
1076278133 10:129223493-129223515 TGGGTGAGTGAGTGGGTGACTGG + Intergenic
1076278137 10:129223501-129223523 TGAGTGGGTGACTGGGTGGGTGG + Intergenic
1076278181 10:129223823-129223845 TGGGTAAGTGAATGACTGGCTGG + Intergenic
1076278183 10:129223827-129223849 TAAGTGAATGACTGGCTGGGTGG + Intergenic
1076278197 10:129223894-129223916 TGGGTGAGTGGATGACTGGCTGG + Intergenic
1076278199 10:129223898-129223920 TGAGTGGATGACTGGCTGGGTGG + Intergenic
1076278227 10:129224013-129224035 TGGGTGAATGAGTGGGTGGGTGG + Intergenic
1076278304 10:129224376-129224398 TGGGTGAGTAAATGGGTGGATGG + Intergenic
1076602808 10:131669982-131670004 TGGGTGAGTGAATGGATGAGTGG + Intergenic
1076602825 10:131670061-131670083 TGGGTGAGTGAATGGATGGATGG + Intergenic
1076602841 10:131670141-131670163 TGGGTGAGTGAATGGATGAGTGG + Intergenic
1076845037 10:133065763-133065785 TGGATGAGTGAGTGGATGGGTGG + Intergenic
1076867642 10:133175879-133175901 TGGGTGGGTGAATGGATGGGTGG + Intronic
1076867659 10:133175939-133175961 TGGGTGGGTGAATGGATGGGTGG + Intronic
1076867676 10:133175999-133176021 TGGGTGGGTGAATGGATGGGTGG + Intronic
1076931859 10:133536838-133536860 TGGGAGGGTGGATGGCTGGCTGG + Intronic
1076931860 10:133536842-133536864 AGGGTGGATGGCTGGCTGGCTGG + Intronic
1077150208 11:1069751-1069773 TGAGTGAGTGACTGGATAGGTGG - Intergenic
1077150246 11:1069955-1069977 TGGGTGAGTGGATGGATGGATGG - Intergenic
1077150247 11:1069959-1069981 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1077150281 11:1070080-1070102 TGGGTGAGTGGATGGATGGATGG - Intergenic
1077168574 11:1154548-1154570 TGGGTGAGTGAGTGAGTGGGTGG - Intergenic
1077171785 11:1169660-1169682 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171808 11:1169822-1169844 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077171817 11:1169866-1169888 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171842 11:1169998-1170020 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077171888 11:1170267-1170289 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171918 11:1170433-1170455 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077171927 11:1170477-1170499 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171957 11:1170645-1170667 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077171966 11:1170689-1170711 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077171988 11:1170821-1170843 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077172021 11:1171016-1171038 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077172054 11:1171254-1171276 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172068 11:1171367-1171389 TGGGTGAGTGAATGGGTGAGTGG - Intronic
1077172088 11:1171477-1171499 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172094 11:1171505-1171527 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077172110 11:1171585-1171607 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172124 11:1171665-1171687 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172130 11:1171693-1171715 TGGGTGAGTGAGTGGGTGAGTGG - Intronic
1077172346 11:1172770-1172792 TGGGTGAGTGAATGGGTGAACGG - Intronic
1077172363 11:1172854-1172876 TGGGTGAGTGAGTGGGTGAATGG - Intronic
1077213521 11:1384352-1384374 TGGGTGGGTGGGTGGGTGGCAGG - Intergenic
1077294947 11:1821988-1822010 TGGTTGAGTGAATGGATGGATGG + Intergenic
1077304135 11:1860851-1860873 TGGGTGGATGATTGGATGGCTGG + Intronic
1077311976 11:1892881-1892903 TGGGTGAGTGGATGAATGGCTGG + Intergenic
1077312095 11:1893414-1893436 TGGGTGGGAGGATGGCTGGCTGG + Intergenic
1077312096 11:1893418-1893440 TGGGAGGATGGCTGGCTGGCTGG + Intergenic
1077312098 11:1893426-1893448 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1077312099 11:1893430-1893452 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077319124 11:1933156-1933178 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1077357728 11:2126490-2126512 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1077357778 11:2126708-2126730 TGGGTGGGTGAGTGGATGGTTGG + Intergenic
1077357780 11:2126712-2126734 TGGGTGAGTGGATGGTTGGGTGG + Intergenic
1077357791 11:2126764-2126786 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1077418137 11:2435453-2435475 TGGGTGAATGACAGGTGGGCAGG - Intergenic
1078084287 11:8224534-8224556 TGGTAGAGTGGCTGGCTGGCCGG + Exonic
1078400562 11:11022764-11022786 TGGGTGGGTGGCTGGGTGGATGG - Intergenic
1078537277 11:12185166-12185188 TGGGTGGGTGGCTGGATGGATGG + Intronic
1078550653 11:12278075-12278097 TGGGTGAGTGAGTGGGTGAGTGG + Intronic
1078552078 11:12288041-12288063 TGGGGGAATGACTCACTGGCTGG - Intronic
1078714327 11:13825632-13825654 TGAGTGAATGACTGGCTGGTTGG - Intergenic
1078714328 11:13825636-13825658 TTGTTGAGTGAATGACTGGCTGG - Intergenic
1079003443 11:16776237-16776259 TGAGTGAGTGACTGTGTGACAGG - Intergenic
1079291451 11:19191761-19191783 TGTGTGAGTCAGTGTCTGGCGGG + Intronic
1079840790 11:25397096-25397118 TGGCTCAGTCACTGACTGGCAGG - Intergenic
1080343539 11:31296093-31296115 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1080606483 11:33869148-33869170 TGGGAGAGGGACTGGGCGGCGGG - Intronic
1080826988 11:35856658-35856680 CGGGTGGGTGAATGGATGGCTGG + Intergenic
1080826989 11:35856662-35856684 TGGGTGAATGGATGGCTGGATGG + Intergenic
1081611991 11:44568402-44568424 TGGGTGAGTGGCGGGGTTGCTGG + Intronic
1081680696 11:45000392-45000414 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1081680697 11:45000396-45000418 TGGGTGGCTGGCTGGCTGGCTGG - Intergenic
1081680698 11:45000400-45000422 TGGATGGGTGGCTGGCTGGCTGG - Intergenic
1082967650 11:58984095-58984117 GGGGTGGGTGACTGGGGGGCTGG - Intronic
1083201282 11:61122480-61122502 TGGGTGAGTGGATGGATGGATGG + Intronic
1083201312 11:61122711-61122733 TGGGTGGGTGAGTGGGTAGCAGG + Intronic
1083434669 11:62634202-62634224 GGGGTGAGTGAAAGGCTGGAAGG + Intronic
1083743042 11:64721284-64721306 TGGGTGCGCGAGTGGCTGGTGGG - Intronic
1083752127 11:64766604-64766626 AGGCTGAGTGAGCGGCTGGCTGG - Intronic
1083828385 11:65216075-65216097 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828438 11:65216402-65216424 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1083828448 11:65216434-65216456 TGGGTGAATGAGTGGGTGGGTGG + Intergenic
1083828454 11:65216458-65216480 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1083828478 11:65216590-65216612 TGGGTGAGTGAGTGCGTGGGTGG + Intergenic
1083828482 11:65216610-65216632 TGGGTGAGTGAGTGCGTGGGTGG + Intergenic
1083828509 11:65216738-65216760 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828515 11:65216762-65216784 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1083828523 11:65216786-65216808 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1083828537 11:65216834-65216856 TGGGTGAGTGAGTGGGTGGGTGG + Intergenic
1084196819 11:67527464-67527486 CAGGTGAATGGCTGGCTGGCTGG + Intergenic
1084303139 11:68264410-68264432 TGGGTGAGTGGATGGATGGATGG - Intronic
1084413461 11:69016971-69016993 TGGGTGAGTGGGTGGGTGGATGG - Intergenic
1084455018 11:69263401-69263423 TGGGTGAGTGGATGGATGGATGG - Intergenic
1084536821 11:69762291-69762313 TGGGTCACTGACTGGATGGCTGG + Intergenic
1084545906 11:69815024-69815046 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1084596345 11:70119121-70119143 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1084685718 11:70693962-70693984 TGGCTGAGTGAGTGGATGGCGGG + Intronic
1084699434 11:70776881-70776903 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1084699517 11:70777259-70777281 TGGGTGAGTGGATGGATGGATGG - Intronic
1084699522 11:70777279-70777301 TGGGTGAGTGGATGGATGACTGG - Intronic
1084739923 11:71133126-71133148 TGGGTGAATGAGTGGATGGAGGG + Intronic
1084739971 11:71133295-71133317 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1084739972 11:71133299-71133321 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1084739986 11:71133347-71133369 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1084792968 11:71486459-71486481 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1084949203 11:72655319-72655341 TGGCTGTGGCACTGGCTGGCTGG - Intronic
1085031470 11:73273471-73273493 TGTGTGTGTGACTGGCTGGGTGG + Intronic
1085034585 11:73292408-73292430 TGGGTGAGTGAATGGCTGGGAGG + Intronic
1085120167 11:73962438-73962460 TGGGTAAATGAATGGATGGCTGG + Intronic
1085228547 11:74944876-74944898 TGAATGAGTAACTTGCTGGCTGG + Intronic
1085464298 11:76713583-76713605 TGGATGAGTGAATGGGTGGGTGG + Intergenic
1085464302 11:76713595-76713617 TGGGTGGGTGGCTGGGTGGATGG + Intergenic
1085776730 11:79373295-79373317 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1085776731 11:79373299-79373321 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1085776732 11:79373303-79373325 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1085776733 11:79373307-79373329 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1085776734 11:79373311-79373333 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1085776751 11:79373407-79373429 TGGCTGGGTGACTGGCTGGCTGG + Intronic
1085776752 11:79373411-79373433 TGGGTGACTGGCTGGCTGGCTGG + Intronic
1085794017 11:79520323-79520345 TGGGAGAGAGACTGGGAGGCAGG - Intergenic
1085894492 11:80622263-80622285 TGGGTGGCTGGCTGGCTAGCTGG - Intergenic
1085894494 11:80622275-80622297 TGGATGAGTAGCTGGGTGGCTGG - Intergenic
1087010816 11:93512442-93512464 TGGGTGAGTCAGTGGCTGAGTGG - Intronic
1087713964 11:101585151-101585173 TGGGTGGGTGAGTGGGTGGGTGG + Intronic
1087713966 11:101585155-101585177 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1088526723 11:110763743-110763765 TTGGCCAGTGACTGGCTGCCAGG - Intergenic
1088858648 11:113779732-113779754 TGGGTCAGTGACTGGTTAGCAGG - Exonic
1089505214 11:118957958-118957980 TGGTTGGTTGGCTGGCTGGCTGG + Intronic
1089505215 11:118957962-118957984 TGGTTGGCTGGCTGGCTGGCTGG + Intronic
1089505216 11:118957966-118957988 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1089505217 11:118957970-118957992 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1089505218 11:118957974-118957996 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1089808736 11:121114697-121114719 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089808746 11:121114729-121114751 TGGGTGGGTGAATGGGTGGATGG - Intronic
1089808758 11:121114765-121114787 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1089808782 11:121114833-121114855 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089808812 11:121114949-121114971 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089808844 11:121115065-121115087 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1089808866 11:121115145-121115167 TGGGTGGGTGAATGGGTGGATGG - Intronic
1089808887 11:121115213-121115235 TGGGTGGGTGAATGGGTGGATGG - Intronic
1090406930 11:126481811-126481833 TGGGTGAATTACTGGTTGACTGG - Intronic
1091133616 11:133167828-133167850 TGGTTGGGTGACTGGGTGGGTGG - Intronic
1091323837 11:134669660-134669682 TGGGTAGGTGACTGCATGGCTGG - Intergenic
1091446728 12:548016-548038 TGGGAGGCTGACAGGCTGGCGGG - Exonic
1091670082 12:2446449-2446471 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1091832386 12:3559053-3559075 TGGCTGTCTGGCTGGCTGGCTGG - Intronic
1093088080 12:14889005-14889027 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1093088081 12:14889009-14889031 TGGATGGCTGGCTGGCTGGCTGG - Intronic
1093835019 12:23818482-23818504 TGGGTGAGTCAGTGAGTGGCAGG + Intronic
1093846635 12:23979878-23979900 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1093846636 12:23979882-23979904 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1093846637 12:23979886-23979908 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1093846638 12:23979890-23979912 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1093872383 12:24307524-24307546 TGGGTGAGTGGGTGGGTGGGGGG - Intergenic
1095733906 12:45535820-45535842 TGGGTGAATGAATGGGTGGATGG - Intergenic
1096585117 12:52614919-52614941 TGGCTGAATGACTGGCTGAGTGG - Intronic
1096863802 12:54549498-54549520 GGAGTGAGAGACTGGCGGGCAGG + Exonic
1097809128 12:63999535-63999557 TGGGTAATTGATTGGCTGGGTGG + Intronic
1097965744 12:65579216-65579238 TGGGTCAGTGATTGCCTGGGAGG + Intergenic
1099097163 12:78389032-78389054 TGGCTTAGTGACTAGGTGGCAGG + Intergenic
1099709887 12:86210281-86210303 TGGGGCAGTCACTGGCTTGCAGG + Intronic
1100207558 12:92367182-92367204 TGGGTGAGTGGTTGGTTGGTTGG + Intergenic
1100356737 12:93838240-93838262 TGGCTGAGAGACTGACTGCCTGG - Intronic
1100619154 12:96255157-96255179 TTGGTGACTGACTGGGTGGGAGG + Intronic
1101814707 12:108136936-108136958 TGGGTGACTGAATGGCTGGAGGG + Intronic
1102452737 12:113053879-113053901 TGGGTGAATGACTGGATGGATGG + Intergenic
1102507100 12:113390531-113390553 TGGATGAGTGAATGGGTGGATGG - Exonic
1102787885 12:115619202-115619224 TGGGTGGGGGGCTGGCAGGCGGG - Intergenic
1102894468 12:116587662-116587684 TGGATGGGTGACTGGATGGATGG - Intergenic
1102927743 12:116839534-116839556 GGGGTGAGTGACTGTATGGATGG + Intronic
1103002472 12:117395870-117395892 TGAGTGAATGAATGGATGGCTGG - Intronic
1103024015 12:117558799-117558821 TGGGTGGGTGGGTGGATGGCTGG + Intronic
1103024017 12:117558803-117558825 TGGGTGGGTGGATGGCTGGGTGG + Intronic
1103027213 12:117583350-117583372 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1103027224 12:117583394-117583416 TGGGTGAGTGAGTGGATGGATGG + Intronic
1103503434 12:121423321-121423343 TGGGAGGGTGGCTGGCTGACTGG + Intronic
1104113145 12:125723066-125723088 TGTGGCAGAGACTGGCTGGCTGG + Intergenic
1104542256 12:129676865-129676887 TGGGTGAGTGAGTAGATGGATGG - Intronic
1104754291 12:131259335-131259357 TGGGTGAGTGAGTGAATGGGTGG + Intergenic
1104754310 12:131259467-131259489 TGGGTGAGTGAGTGACTGAATGG + Intergenic
1104754332 12:131259591-131259613 TGGGTGAGTGAGTGACTGAGTGG + Intergenic
1104754362 12:131259771-131259793 TGGGTGAGTGAGTGACTGAGTGG + Intergenic
1104766120 12:131331326-131331348 TGGGTGGCTGGCTGGCTGGATGG - Intergenic
1104766121 12:131331330-131331352 TGGATGGGTGGCTGGCTGGCTGG - Intergenic
1104766122 12:131331334-131331356 TGGGTGGATGGGTGGCTGGCTGG - Intergenic
1104778663 12:131405600-131405622 TGGATGGGTGAGTGGATGGCTGG - Intergenic
1104854806 12:131896538-131896560 TGGCTGAGGGAAGGGCTGGCAGG + Intronic
1104896189 12:132166181-132166203 TGGGTGAATGAATGGATGGATGG - Intergenic
1104896275 12:132166538-132166560 TGGGTGGGTGGATGGATGGCTGG - Intergenic
1104896367 12:132166887-132166909 TGGGTGAATGGATGGATGGCTGG - Intergenic
1104906666 12:132217212-132217234 TGGATGAATGGATGGCTGGCTGG - Intronic
1104906677 12:132217253-132217275 TGGATGAGTGAATGGATGGATGG - Intronic
1104906712 12:132217462-132217484 TGGGTGAATGGATGGCTGGCTGG - Intronic
1104906713 12:132217466-132217488 TGGGTGGGTGAATGGATGGCTGG - Intronic
1104911912 12:132243817-132243839 TGGGTGATTGACGGGTGGGCTGG - Intronic
1104925689 12:132313061-132313083 TGGGTGAGTGGGTGGATGGATGG - Intronic
1104925690 12:132313065-132313087 TGGGTGGGTGAGTGGGTGGATGG - Intronic
1104925695 12:132313081-132313103 TGGGTGAGTGGGTGGATGGGTGG - Intronic
1104925765 12:132313321-132313343 TGGGTGAGTGGATGGGTGGATGG - Intronic
1104925778 12:132313369-132313391 TGAGTGAGTGAGTGGATGGGTGG - Intronic
1104925780 12:132313373-132313395 TGGGTGAGTGAGTGAGTGGATGG - Intronic
1104925796 12:132313441-132313463 TGGGTGAGTGGATGGATGGATGG - Intronic
1104925797 12:132313445-132313467 TGGGTGGGTGAGTGGATGGATGG - Intronic
1104925809 12:132313486-132313508 TGGGTGAATGGATGGATGGCTGG - Intronic
1104925810 12:132313490-132313512 TGGGTGGGTGAATGGATGGATGG - Intronic
1104925845 12:132313598-132313620 TGGGTGAGTGGATGTCTGGGTGG - Intronic
1104925847 12:132313602-132313624 TGGGTGGGTGAGTGGATGTCTGG - Intronic
1104925907 12:132313814-132313836 TGGGTGGGTGGCTGGGTGGGTGG - Intronic
1104954442 12:132457516-132457538 TGGGCGGGTGAGTGGCTGGGTGG + Intergenic
1104954444 12:132457520-132457542 CGGGTGAGTGGCTGGGTGGGCGG + Intergenic
1104954628 12:132458074-132458096 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1105279797 13:18956809-18956831 TGGGTGCGTGAGTGGATGGATGG - Intergenic
1105586019 13:21743476-21743498 TGGGTGAGTGGATGGGTGGATGG - Intergenic
1105637673 13:22231221-22231243 TGGGTGAGTGAGTGGATGGATGG - Intergenic
1105894861 13:24709266-24709288 TGGGTGGGGCACTGGCTGGATGG - Intronic
1106553698 13:30792405-30792427 TGGGTGAGTGGGTGCCTGACTGG - Intergenic
1106826620 13:33529497-33529519 TGAATGAATGACTGGCTGGCTGG - Intergenic
1107818726 13:44267187-44267209 TGGCTGGGTAGCTGGCTGGCTGG + Intergenic
1107818727 13:44267191-44267213 TGGGTAGCTGGCTGGCTGGCTGG + Intergenic
1107818741 13:44267259-44267281 TGGATGGATGGCTGGCTGGCTGG + Intergenic
1108475677 13:50814356-50814378 TGAGTGAGTGGACGGCTGGCTGG - Intronic
1108475678 13:50814360-50814382 TGAGTGAGTGAGTGGACGGCTGG - Intronic
1109180065 13:59202891-59202913 AGGGTTTGTGACTGGCAGGCAGG + Intergenic
1109645674 13:65251451-65251473 TGGGTGGGTGAGTGGCAGGTAGG + Intergenic
1110595856 13:77319807-77319829 TGGATTATTGGCTGGCTGGCTGG - Intronic
1112208129 13:97346108-97346130 TGGATGAATGAATGGCTGGCTGG + Intronic
1112850583 13:103701203-103701225 TTGGTGAATGAATGGATGGCTGG - Intergenic
1113215893 13:108040218-108040240 TAGGTGAGATACTGTCTGGCTGG - Intergenic
1113370202 13:109717589-109717611 TGAGTGAGTGAATGGTGGGCAGG + Intergenic
1113775674 13:112943634-112943656 CGGGTAAGGGACTGGCCGGCAGG - Intronic
1113912665 13:113851208-113851230 TGGGTGAGTGGATGGATGGATGG + Intronic
1116262930 14:42654172-42654194 TGTGTGTCTGGCTGGCTGGCTGG - Intergenic
1116371655 14:44141975-44141997 TGTGTATGTGATTGGCTGGCTGG - Intergenic
1118222448 14:63867762-63867784 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1118371603 14:65141934-65141956 TGGGTGGGTGGGTGGGTGGCTGG - Intergenic
1119410985 14:74430083-74430105 TGAGTGAGTGTGTGCCTGGCAGG - Intergenic
1119732473 14:76959534-76959556 TGGGTGAGTCACTAAGTGGCTGG - Intergenic
1120679644 14:87465037-87465059 TGGCTGAGAGAATGGATGGCTGG + Intergenic
1120693674 14:87620834-87620856 TGGGTGAGCGACCTGCTGGGAGG - Intergenic
1121029933 14:90649724-90649746 TGGGTGGGTGGTTGGCTGGGTGG - Intronic
1121087399 14:91157052-91157074 TGGGTGAGTGGGTGGATGGATGG + Intronic
1121277509 14:92678202-92678224 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1121338787 14:93092903-93092925 TGGGTGAGTCTGTGGCTGGTGGG - Intronic
1121346137 14:93137076-93137098 TGGTGCAGTGCCTGGCTGGCAGG + Intergenic
1121606638 14:95245621-95245643 TGGGTGAGTGGGTGGATGGATGG + Intronic
1121627203 14:95394580-95394602 TGGATGGGTGAATGGATGGCTGG + Intergenic
1122134905 14:99627224-99627246 TGGGTGAGTGGATGGATGGATGG - Intergenic
1122428623 14:101626002-101626024 TGGGTGGGTGAATGGATGGATGG + Intergenic
1122741710 14:103875399-103875421 TGGGTGAGTGAATGGATGGATGG + Intergenic
1122794267 14:104198127-104198149 TGGGTGAGTAAATGGATGGATGG - Intergenic
1122810966 14:104287693-104287715 TGGGTGAGGTGCTGGCTGGCTGG + Intergenic
1122811712 14:104292505-104292527 TATGTGAGGGACTGGCTGGAAGG + Intergenic
1122863338 14:104592428-104592450 TGTGCGAGTGACTGCCTGGGAGG - Intronic
1122867635 14:104614655-104614677 TGAGTGAGTGAGTGGGTGGGTGG + Intergenic
1122877531 14:104675714-104675736 TGGGTGAGTGGATGGATGGGTGG + Intergenic
1122923672 14:104890275-104890297 TGGATGAGTGAGTGGGTGGATGG + Intronic
1122923682 14:104890303-104890325 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1122923708 14:104890423-104890445 TGGATGAGTGAGTGGGTGGATGG + Intronic
1122923715 14:104890443-104890465 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1122923752 14:104890587-104890609 TGGGTGAGTGAGTGGGTGGATGG + Intronic
1122923768 14:104890655-104890677 TGGATGAGTGAGTGGGTGGATGG + Intronic
1122923777 14:104890683-104890705 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1122923791 14:104890746-104890768 TGGATGAGTGAGTGGGTGGATGG + Intronic
1123058870 14:105585507-105585529 TGGGTGGGTAAATGGCTGGATGG - Intergenic
1123083200 14:105705753-105705775 TGGGTGGGTAAATGGCTGGATGG - Intergenic
1123417608 15:20104414-20104436 TGGCTGACTGGGTGGCTGGCGGG + Intergenic
1123417712 15:20104840-20104862 TGGCTGACTGGGTGGCTGGCGGG + Intergenic
1123417933 15:20105760-20105782 TGGCTGCCTGACTGGCTGGCTGG + Intergenic
1123417934 15:20105764-20105786 TGCCTGACTGGCTGGCTGGCTGG + Intergenic
1123417937 15:20105772-20105794 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1123417959 15:20105866-20105888 TGGCTGACTGGGTGGCTGGCAGG + Intergenic
1123447535 15:20341589-20341611 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1123447536 15:20341593-20341615 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1123447606 15:20341913-20341935 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1123447754 15:20342587-20342609 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1123447971 15:20343580-20343602 TGGTTGGCTGGCTGGCTGGCTGG - Intergenic
1123526678 15:21110396-21110418 TGGCTGCCTGACTGGCTGGCTGG + Intergenic
1123526679 15:21110400-21110422 TGCCTGACTGGCTGGCTGGCTGG + Intergenic
1123526682 15:21110408-21110430 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1123526683 15:21110412-21110434 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1123526706 15:21110506-21110528 TGGCTGACTGGGTGGCTGGCGGG + Intergenic
1123526982 15:21111692-21111714 TGGCTGACTGGGTGGCTGGCGGG + Intergenic
1123527274 15:21112850-21112872 TGGCTGCCTGACTGGCTGGCTGG + Intergenic
1123527275 15:21112854-21112876 TGCCTGACTGGCTGGCTGGCTGG + Intergenic
1123527278 15:21112862-21112884 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1123527279 15:21112866-21112888 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1124658692 15:31528029-31528051 TGGGTGGGTGGATGGCTGGATGG - Intronic
1125527290 15:40384804-40384826 TGGGAGAGGAACTGGATGGCTGG - Intronic
1126110629 15:45172815-45172837 TCGGGGAGGGACAGGCTGGCTGG - Intronic
1127544337 15:59976288-59976310 GGGCAGAGTGACTGGCAGGCAGG + Intergenic
1127898016 15:63319973-63319995 TGGGTGAGTGAGTGAGTGGAGGG - Intergenic
1127982438 15:64045166-64045188 GGGGTAAGTTCCTGGCTGGCAGG - Intronic
1128551574 15:68601097-68601119 TGGGTGTGTGAATGGTTGACAGG + Intronic
1129261396 15:74369899-74369921 TGGGTGACTGGGTGGCTGGGTGG + Intergenic
1129261402 15:74369919-74369941 TGGCTGGGTGACTGGGTGGCTGG + Intergenic
1129261404 15:74369923-74369945 TGGGTGACTGGGTGGCTGGGTGG + Intergenic
1129467660 15:75732921-75732943 TGGGAGAGGGACTGGCCGGCAGG + Intergenic
1129600322 15:76994883-76994905 AGGGTGCTGGACTGGCTGGCGGG + Intronic
1131617182 15:94028866-94028888 TGAATGACTGACTGGCAGGCTGG + Intergenic
1132114529 15:99125844-99125866 TTCGCGAGTGACTGGCTGACAGG + Intronic
1132644702 16:993581-993603 TGGGTGAGTGGATGGATGGGTGG - Intergenic
1132644719 16:993641-993663 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1132644738 16:993709-993731 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1132644747 16:993737-993759 TGGGTGAGTGGATGGATGGGAGG - Intergenic
1132644749 16:993741-993763 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1132644774 16:993829-993851 TGGGTGAGTGAGTGGGTGGACGG - Intergenic
1132644798 16:993927-993949 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1132644891 16:994250-994272 TGGGTGAGTGGATGGATGGGTGG - Intergenic
1132644893 16:994254-994276 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1132653738 16:1032947-1032969 TGGGTGAGTGGATGGATGGATGG - Intergenic
1132654049 16:1034428-1034450 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1132654050 16:1034432-1034454 TGAGTGGCTGGCTGGCTGGCTGG - Intergenic
1132654051 16:1034436-1034458 TGGATGAGTGGCTGGCTGGCTGG - Intergenic
1132654052 16:1034440-1034462 TGGTTGGATGAGTGGCTGGCTGG - Intergenic
1133057932 16:3156407-3156429 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1133057933 16:3156411-3156433 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1133057934 16:3156415-3156437 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1133081030 16:3320382-3320404 TGGGGGAGTGACTGTTTTGCTGG + Intergenic
1133191353 16:4135797-4135819 TGGGTGGGTGAATGGATGGATGG + Intergenic
1133204897 16:4227350-4227372 TGGGTGAATGGCTGGGTGGAAGG + Intronic
1133231475 16:4369082-4369104 TGAGTCAGTGGCTGGCTGGCTGG - Intronic
1133456139 16:5943995-5944017 TGGGTGAGTGGATGGATGGATGG - Intergenic
1133474563 16:6107690-6107712 TGGGTGGGTGAGTGGATGGATGG + Intronic
1133474564 16:6107694-6107716 TGGGTGAGTGGATGGATGGATGG + Intronic
1133739557 16:8640883-8640905 TGGGTGGGTGAATGGATGGATGG + Intronic
1133739574 16:8640943-8640965 TGGGTGGGTGGATGGCTGGCTGG + Intronic
1133739575 16:8640947-8640969 TGGGTGGATGGCTGGCTGGCTGG + Intronic
1133739576 16:8640951-8640973 TGGATGGCTGGCTGGCTGGCTGG + Intronic
1133739577 16:8640955-8640977 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1133739578 16:8640959-8640981 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1134106964 16:11492250-11492272 TGGGTGGCTGGCTGGCTGGCTGG - Intronic
1134106965 16:11492254-11492276 TGGGTGGGTGGCTGGCTGGCTGG - Intronic
1134106966 16:11492258-11492280 TGGGTGGGTGGGTGGCTGGCTGG - Intronic
1134106967 16:11492262-11492284 TGGGTGGGTGGGTGGGTGGCTGG - Intronic
1134224542 16:12380815-12380837 TGGGTGGGTGGATGGATGGCGGG - Intronic
1134224781 16:12381575-12381597 TGGATGAGTGAGTGGGTGGGTGG - Intronic
1135074681 16:19383161-19383183 TGGCTGAGTGAGAGGCTGGCTGG + Intergenic
1135220534 16:20611073-20611095 AGGCTGTGTGACAGGCTGGCTGG + Intronic
1135221027 16:20614077-20614099 TGTTTGAGAGACTGGCTGTCTGG + Intronic
1135221029 16:20614101-20614123 TGTTTGAGAGACTGGCTGTCTGG + Intronic
1135221072 16:20614415-20614437 TGGATGAGAGACTGACTGGGAGG + Intronic
1135221133 16:20614791-20614813 TGGCTGAGAGGCTGGCTGGGAGG + Intronic
1135221149 16:20614911-20614933 TTGCTAAGAGACTGGCTGGCAGG + Intronic
1135614221 16:23896976-23896998 TGGGTGGGTGAATGGATGGATGG - Intronic
1135661124 16:24297520-24297542 TGAGTGAGTGAGTGGGTGGGCGG - Intronic
1135793224 16:25417751-25417773 TGGATGGATGGCTGGCTGGCTGG - Intergenic
1135893068 16:26374480-26374502 TGGGTGAGTGGATGGGTGGATGG + Intergenic
1135903613 16:26489983-26490005 TGGGTGAGCCACTGTCTTGCCGG - Intergenic
1135994621 16:27238683-27238705 TGGGAGAGTGTCTGGCTGATAGG - Intronic
1136071757 16:27791645-27791667 TGGGTGACTGGGTGGCTGACAGG - Intronic
1136279090 16:29197578-29197600 TGCGTGAGTGAATGGGTGGGTGG + Intergenic
1136279097 16:29197613-29197635 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1136279207 16:29198106-29198128 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
1136290903 16:29270784-29270806 TGGATGAATGACTGGATGGGTGG + Intergenic
1136295504 16:29299244-29299266 TGGATGAGTGAGTGGGTGGATGG + Intergenic
1136608616 16:31352958-31352980 TGGGAGAGAGACGGGCAGGCCGG - Intergenic
1136822772 16:33336176-33336198 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1136822842 16:33336482-33336504 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1136983713 16:35081668-35081690 AGTGGGAGTGACTGGCTGGTGGG + Intergenic
1137271691 16:46906589-46906611 TGGGTGAGTGAGTGGATGAGTGG + Intronic
1137561743 16:49506791-49506813 TGGATGAGTGGATGGGTGGCTGG + Intronic
1137621287 16:49878063-49878085 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
1137625560 16:49905863-49905885 TGGCTGCATGGCTGGCTGGCTGG + Intergenic
1137625562 16:49905871-49905893 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1137720815 16:50626397-50626419 TGGGACAGAGACTGGCTGGAAGG + Intronic
1137765017 16:50971404-50971426 TGGGTGAGTGGATGGATGGATGG - Intergenic
1137765018 16:50971408-50971430 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1138345497 16:56317702-56317724 AGGATGTGTGGCTGGCTGGCTGG + Intronic
1138396929 16:56711587-56711609 GGGGTGAGGTACTGACTGGCAGG - Intronic
1138547598 16:57729055-57729077 TGGGTGAGTGAGTGAGTGGATGG + Intronic
1138547655 16:57729291-57729313 TGGATGAGTGAGTGGGTGGATGG + Intronic
1138547694 16:57729455-57729477 TGGATGAGTGAGTGGGTGGGTGG + Intronic
1138547716 16:57729531-57729553 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1138547737 16:57729603-57729625 TGGGTGAGTGAGTGGGTGGGTGG + Intronic
1139345560 16:66300772-66300794 TGGGTAGGGGACTGGCTGGCTGG - Intergenic
1140067670 16:71625324-71625346 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1140067671 16:71625328-71625350 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
1140067678 16:71625352-71625374 TGGATGAGTGAATGGGTGGGTGG + Intergenic
1140067714 16:71625476-71625498 TGGGTGGGTGAGTGGGTGGATGG + Intergenic
1140067716 16:71625480-71625502 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1140067780 16:71625698-71625720 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1140067791 16:71625733-71625755 TGGGTGGGTGAGTGGGTGGATGG + Intergenic
1140067793 16:71625737-71625759 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1140067798 16:71625753-71625775 TGGGTGGGTGAGTGGGTGGATGG + Intergenic
1140067800 16:71625757-71625779 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1140267746 16:73435067-73435089 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1140456855 16:75110809-75110831 TGGAAGAGTGGGTGGCTGGCTGG + Exonic
1140456856 16:75110813-75110835 AGAGTGGGTGGCTGGCTGGCTGG + Exonic
1140456857 16:75110817-75110839 TGGGTGGCTGGCTGGCTGGCTGG + Exonic
1140663566 16:77210096-77210118 TGGATGTGTGAGTTGCTGGCTGG - Intronic
1140853243 16:78954250-78954272 TGGTTGAGTGAGTGGGTGGATGG + Intronic
1140913498 16:79474410-79474432 TGAGCAAGTGCCTGGCTGGCTGG + Intergenic
1141042912 16:80687547-80687569 TGGATGGATGGCTGGCTGGCTGG + Intronic
1141042913 16:80687551-80687573 TGGATGGCTGGCTGGCTGGCTGG + Intronic
1141048868 16:80742735-80742757 TGGGTGAGTGAGTGGGTGGATGG + Intronic
1141420807 16:83914321-83914343 TGAGTGAGCGACTAGCTGCCCGG - Intronic
1141430302 16:83967808-83967830 TGGGTGGGTGAATGGATGGATGG + Intergenic
1141488247 16:84355158-84355180 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1141488321 16:84355406-84355428 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1141650008 16:85387913-85387935 TGGGTGAGTGGATGGATGGATGG + Intergenic
1141650025 16:85387973-85387995 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650047 16:85388057-85388079 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650070 16:85388157-85388179 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1141650100 16:85388273-85388295 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650147 16:85388461-85388483 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141650175 16:85388569-85388591 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1141658063 16:85426583-85426605 TGGGTGAATGAATGGATGGATGG + Intergenic
1141690890 16:85595684-85595706 TGGGTGGGTGAGTGGATGGGAGG - Intergenic
1141759845 16:86020934-86020956 AGGCTGAGGGACTGGCAGGCTGG + Intergenic
1141823889 16:86465760-86465782 TGGGTGAGTGAATGGATGAATGG + Intergenic
1141904400 16:87014243-87014265 TGAGTGAGTGAATGACTGGGTGG - Intergenic
1141943480 16:87294111-87294133 TGGGTGGGTGAGTGGGTGGATGG + Intronic
1141943481 16:87294115-87294137 TGGGTGAGTGGGTGGATGGATGG + Intronic
1141982398 16:87558730-87558752 TGGATGGCTGGCTGGCTGGCTGG - Intergenic
1141982399 16:87558734-87558756 TGGGTGGATGGCTGGCTGGCTGG - Intergenic
1142083490 16:88163706-88163728 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1142083597 16:88164207-88164229 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
1142096782 16:88244298-88244320 TGGGTGAGTGGATGGTTGGATGG + Intergenic
1142101375 16:88273130-88273152 TGGATGAGTGAGTGGGTGGATGG + Intergenic
1142122813 16:88395362-88395384 TGGGTGGATGGCTGGATGGCTGG + Intergenic
1142124064 16:88401508-88401530 TGGGTGAGTGGATGGATGGATGG + Intergenic
1142124086 16:88401608-88401630 TGGGTGAGTGGATGGATGGATGG + Intergenic
1142124100 16:88401668-88401690 TGGGTGAGTGCATGGATGGATGG + Intergenic
1142124154 16:88401889-88401911 TGGGTGAGTGGATGGATGGAGGG + Intergenic
1142124190 16:88402041-88402063 TGGGTGAGTGCATGGATGGATGG + Intergenic
1142128747 16:88422737-88422759 TGGATGAGTGAATGGATGGATGG + Intergenic
1142128778 16:88422865-88422887 TGGATGAGTGAATGGATGGATGG + Intergenic
1142190664 16:88715913-88715935 CGGGTGAGTGAGTGGCTGGGGGG - Exonic
1142214874 16:88825374-88825396 TGGCTGGGTGTCTGGGTGGCCGG + Intronic
1142244728 16:88964838-88964860 TGGGTGAGTGGATGGATGGGTGG - Intronic
1142248299 16:88979699-88979721 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
1142248314 16:88979750-88979772 TGGATGAGTGAATGGGTGGATGG + Intergenic
1142248327 16:88979806-88979828 TGGGTGAGTGAGTGAGTGGGTGG + Intergenic
1142248328 16:88979810-88979832 TGAGTGAGTGAGTGGGTGGATGG + Intergenic
1142255309 16:89011129-89011151 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255345 16:89011281-89011303 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255363 16:89011353-89011375 TGGGTGAGTGTGTGGGTGGGTGG - Intergenic
1142255391 16:89011461-89011483 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255410 16:89011533-89011555 TGGGTGAGTGTGTGGGTGGGTGG - Intergenic
1142255437 16:89011641-89011663 TGGGTGAGTGCGTGGGTGGGTGG - Intergenic
1142255593 16:89012295-89012317 TGGGTGGGTGAATGGGTGGATGG - Intergenic
1142255626 16:89012422-89012444 TGGGTGGGTGAATGGGTGGATGG - Intergenic
1142355057 16:89598120-89598142 TGGGTGAGTGGATGGATGGGTGG - Intergenic
1203010515 16_KI270728v1_random:233039-233061 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1143544676 17:7589124-7589146 TGGGTGAGTGCCTGGGAAGCGGG - Exonic
1143682560 17:8488194-8488216 AGAGTGAGTGAGTGGCTGACAGG - Intronic
1144782842 17:17816564-17816586 TGGGTGGGCCGCTGGCTGGCAGG - Exonic
1144837986 17:18167553-18167575 TGGGTGAGGGGCTGCCAGGCAGG - Intronic
1145240021 17:21235739-21235761 TGAGTGGATGGCTGGCTGGCTGG - Intergenic
1145240022 17:21235743-21235765 TGGATGAGTGGATGGCTGGCTGG - Intergenic
1145240035 17:21235799-21235821 TGGGTGAATGGATGGCTGGGTGG - Intergenic
1145240041 17:21235819-21235841 TGGGTGGGTGACTGGATGAATGG - Intergenic
1145240072 17:21235935-21235957 TGGGTGGATGAATGGCTGGGTGG - Intergenic
1145240096 17:21236033-21236055 TGGATGAGTGAGTGGGTGGATGG - Intergenic
1145240183 17:21236417-21236439 TGGGTGAATGGCTGGGTGGATGG - Intergenic
1145240184 17:21236421-21236443 TGGATGGGTGAATGGCTGGGTGG - Intergenic
1145271549 17:21407483-21407505 TGGGTGAGTGAATGAGTGGATGG - Intronic
1145271590 17:21407647-21407669 TGGGTGGGTGACTGAGTGGATGG - Intronic
1145309763 17:21694931-21694953 TGGGTGAGTGAATGAGTGGATGG - Intronic
1145778588 17:27546632-27546654 TGGGTGAGTGCGTGCCTGGTGGG + Intronic
1146173942 17:30652959-30652981 TTGTTGAGTGAATGGATGGCAGG + Intergenic
1146347398 17:32068981-32069003 TTGTTGAGTGAATGGATGGCAGG + Intergenic
1146504749 17:33395144-33395166 TGGGTGGGTGAGTGGGTGGGGGG - Intronic
1148083050 17:44977926-44977948 TGGGAGAGGCACTAGCTGGCTGG + Intergenic
1148345914 17:46903744-46903766 TGGGTGGGTGAGTGGATGGATGG + Intergenic
1148345916 17:46903748-46903770 TGGGTGAGTGGATGGATGGGTGG + Intergenic
1148346075 17:46904367-46904389 TGGGTGGGTGGCTGACTGGCTGG + Intergenic
1148346076 17:46904371-46904393 TGGGTGGCTGACTGGCTGGCTGG + Intergenic
1148346089 17:46904415-46904437 TGGGTGCGTGGGTGGCTGGGTGG + Intergenic
1148346090 17:46904419-46904441 TGCGTGGGTGGCTGGGTGGCTGG + Intergenic
1148346091 17:46904427-46904449 TGGCTGGGTGGCTGGCTGACTGG + Intergenic
1148752240 17:49951952-49951974 TGGCTGGGTGACAGCCTGGCAGG + Intergenic
1148865914 17:50628527-50628549 TGGCTAGGTGACAGGCTGGCTGG - Intergenic
1148989092 17:51649969-51649991 TGGCTGACTGGCTGGCTGGATGG - Intronic
1148989093 17:51649973-51649995 TGGCTGGCTGACTGGCTGGCTGG - Intronic
1148989096 17:51649989-51650011 TGGGTGGCTGGCTGGCTGGCTGG - Intronic
1148989097 17:51649993-51650015 TGGGTGGGTGGCTGGCTGGCTGG - Intronic
1149418301 17:56483339-56483361 AGGGTGAGTGAGTGGGTGGGTGG + Intronic
1150439130 17:65177333-65177355 TGGGTGAGTGGATGGATGGATGG - Intronic
1150439131 17:65177337-65177359 TGGGTGGGTGAGTGGATGGATGG - Intronic
1151317807 17:73334847-73334869 TGGGTGAGGGGCTGGTGGGCAGG - Exonic
1151973215 17:77469773-77469795 TGGGTGAGTGAGTGGATGGGTGG - Intronic
1151973271 17:77470055-77470077 TGGGTGAATGAGTGGATGGGTGG - Intronic
1151973368 17:77470574-77470596 TGGATGAATGACTGGATGGATGG - Intronic
1151973386 17:77470674-77470696 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1152034060 17:77861183-77861205 TGGGTGGGTGAATGGATGGATGG + Intergenic
1152038093 17:77885492-77885514 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1152133241 17:78489840-78489862 TGGGTGAGTGGGTGGGTGGGCGG + Intronic
1152141601 17:78540412-78540434 TGGGTGAGTGGGTGGATGGATGG + Intronic
1152141631 17:78540500-78540522 TGGGTGGGTGACTGGGTGGGTGG + Intronic
1152141636 17:78540516-78540538 TGGGTGGGTGAGTGGATGGGTGG + Intronic
1152141637 17:78540520-78540542 TGGGTGAGTGGATGGGTGGATGG + Intronic
1152141688 17:78540736-78540758 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1152141906 17:78541304-78541326 TGGGTGAGTGAGTGGATGGGTGG + Intronic
1152232373 17:79120452-79120474 TGGATGAGTGAATGGATGGATGG + Intronic
1152269593 17:79316220-79316242 TGGCTTTGTGACTGTCTGGCAGG + Intronic
1152301790 17:79499132-79499154 TGGATGAGTGAATGGATGGGTGG - Intronic
1152353465 17:79795693-79795715 TGGGTGGGTGGGTGGATGGCTGG + Intronic
1152766976 17:82147110-82147132 TGGATGAGTGACTGGATGATTGG + Intronic
1152767410 17:82148737-82148759 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1152803271 17:82341991-82342013 TGGGTGGCTGACTTGCTGCCTGG - Intergenic
1153227245 18:2908286-2908308 TGGGTGGGTGGCTGGATGGAAGG - Intronic
1153881602 18:9426072-9426094 TGGGTGTGTGATTGGTTGCCAGG + Intergenic
1154947814 18:21179604-21179626 TGGGTGAATGAGTGGATGGATGG + Intergenic
1154958531 18:21284103-21284125 GGGGTGTGTGACAGGCTGACAGG - Intronic
1155203577 18:23538036-23538058 TGGGTAACTGGCTGCCTGGCTGG + Intronic
1157287426 18:46386558-46386580 TGGGTGGGTGAATGGATGGATGG - Intronic
1157299866 18:46471975-46471997 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1157299867 18:46471979-46472001 TGGGTGGCTGGCTGGCTGGCTGG - Intergenic
1157299868 18:46471983-46472005 TGGCTGGGTGGCTGGCTGGCTGG - Intergenic
1157299869 18:46471987-46472009 TGGGTGGCTGGGTGGCTGGCTGG - Intergenic
1157299870 18:46471991-46472013 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
1157299873 18:46471999-46472021 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
1157299876 18:46472007-46472029 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
1157299880 18:46472019-46472041 TGGGTGAATGGGTGGCTGGGTGG - Intergenic
1157299882 18:46472023-46472045 TGGGTGGGTGAATGGGTGGCTGG - Intergenic
1157429678 18:47614366-47614388 TGGATGTGTCATTGGCTGGCTGG + Intergenic
1157429679 18:47614370-47614392 TGTGTCATTGGCTGGCTGGCTGG + Intergenic
1157444332 18:47733477-47733499 TGGGTGAGAGATTAGTTGGCTGG - Intergenic
1157554393 18:48603564-48603586 TGGGGGGGTGGATGGCTGGCTGG + Intronic
1157554430 18:48603717-48603739 TGGGTGGCTGGCTTGCTGGCTGG + Intronic
1157557758 18:48623866-48623888 TGGATGGATGGCTGGCTGGCTGG + Intronic
1157559356 18:48635819-48635841 TGGGTGACTGGCTGGGAGGCTGG - Intronic
1158446738 18:57528653-57528675 TGGGTGAGTGGATGGATGGATGG - Intergenic
1158556220 18:58476958-58476980 TGGATGCGTGGCTGGCTAGCTGG - Intergenic
1158562247 18:58524548-58524570 TGGGTGAGTGAATGGTTCGATGG - Intronic
1158889260 18:61858286-61858308 TGGGGGAGGGAGGGGCTGGCAGG - Intronic
1158889287 18:61858390-61858412 TGGGGGAGGGAAGGGCTGGCAGG - Intronic
1159006900 18:63021419-63021441 TGGTTGACTGACTGGCTGGCTGG - Intergenic
1160229167 18:77033595-77033617 TGGGTGAGTGAATGCATGGATGG - Intronic
1160229198 18:77033786-77033808 TGGGTGAGTGGGTGGATGGATGG - Intronic
1160297333 18:77650423-77650445 TGGGTGGGTGAATGGATGGGTGG - Intergenic
1160687220 19:442616-442638 TGGATGAGTGAATGGGTGGATGG + Intronic
1160687324 19:442936-442958 TGGGTGGGTGAATGGATGGATGG + Intronic
1160692129 19:465025-465047 TGGATGAGTGAGTGGATGGGTGG + Intronic
1160692148 19:465096-465118 TGGGTGAGTGGGTGGATGGATGG + Intronic
1160692162 19:465144-465166 TGGGTGGGTGGGTGGATGGCTGG + Intronic
1160692164 19:465148-465170 TGGGTGGGTGGATGGCTGGGTGG + Intronic
1160692254 19:465492-465514 TGGATGGGTGAATGGTTGGCTGG + Intronic
1160692255 19:465496-465518 TGGGTGAATGGTTGGCTGGATGG + Intronic
1160692426 19:466134-466156 TGGATGAGTGAATGGATGGGTGG + Intronic
1160692494 19:466379-466401 TGGATGAGTGAATGGATGGGTGG + Intronic
1160692516 19:466466-466488 TGGATGAGTGAATGGATGGGTGG + Intronic
1160926604 19:1549680-1549702 TGGGTGAGTGGATGGATGGGAGG - Intergenic
1160926736 19:1550128-1550150 TGGGTGGGTGAATGGATGGGTGG - Intergenic
1160940674 19:1619142-1619164 AGGGAGGGTGCCTGGCTGGCTGG + Exonic
1160958393 19:1705894-1705916 TGGATGAGTGGGTGGGTGGCTGG + Intergenic
1160960225 19:1717654-1717676 TGGGTGAGTGAGTGGATGGATGG + Intergenic
1160960292 19:1717939-1717961 TGGGTGAGTGTCTTGATGGAGGG + Intergenic
1160960335 19:1718137-1718159 TGGGTGAGTGTCTTGATGGAGGG + Intergenic
1160960395 19:1718298-1718320 TGGGTGAGTGGGTGGGTGGTGGG + Intergenic
1161090403 19:2357315-2357337 TGGGTGTGTGGATGGGTGGCTGG - Intergenic
1161227664 19:3154613-3154635 TGGATGAGTGAATGGCTGGATGG + Intronic
1161227684 19:3154700-3154722 TGGATGAGTGAATGGCTGGATGG + Intronic
1161287668 19:3477261-3477283 TGGGTGAGTGGATGGATGGATGG + Intronic
1161287770 19:3477651-3477673 TGGGTGAGTGGGTGGATGGGTGG + Intronic
1161347804 19:3776833-3776855 TGGGTGGGTGAATGGATGGGTGG + Intergenic
1161372921 19:3923761-3923783 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1161372923 19:3923781-3923803 TGGATGAGTGAGTGACTGGATGG + Intronic
1161372925 19:3923785-3923807 TGAGTGAGTGACTGGATGGGTGG + Intronic
1161373013 19:3924153-3924175 CGGATGAGTGAGTGGCTGGATGG + Intronic
1161373015 19:3924157-3924179 TGAGTGAGTGGCTGGATGGGTGG + Intronic
1161373027 19:3924218-3924240 TGGGTGAGTGAGTGTGTGGATGG + Intronic
1161489339 19:4553372-4553394 TGGGTGAGTGGATGGATGGATGG + Intronic
1161489356 19:4553441-4553463 TGGGTGAGTGGATGGATGGATGG + Intronic
1161498917 19:4602594-4602616 TGGATGAGTGAATGGATGGGAGG + Intergenic
1161499029 19:4603150-4603172 TGGGTGAGTGGATGGATGGATGG + Intergenic
1161633158 19:5369549-5369571 TGGATGAGTGAGTGGTTGGGTGG - Intergenic
1161694951 19:5761446-5761468 TGGCTGGCTGCCTGGCTGGCTGG + Intronic
1161766154 19:6210036-6210058 TGGGTGGGTGAGTGGATGGGTGG - Intergenic
1161916061 19:7229116-7229138 TGGGTGAGTGAATGGATGAAGGG + Intronic
1161933735 19:7358117-7358139 TGGCTGATTGGCTGGTTGGCTGG - Intronic
1161974312 19:7600107-7600129 TGGGTGGGTGGATGGCTGGGTGG - Intronic
1161974585 19:7600930-7600952 TGGGTGGGTGAATGGATGGATGG - Intronic
1161977606 19:7615141-7615163 TGGGGGAGGGGGTGGCTGGCTGG + Intronic
1162065205 19:8121238-8121260 TGGGTCGGTGACTGCCGGGCAGG - Exonic
1162299844 19:9838339-9838361 AGGGTGAGGGCCTGGCTTGCAGG - Intronic
1162388837 19:10377509-10377531 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1162388981 19:10377959-10377981 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1162988471 19:14287077-14287099 TTGTTGAGTGAATGGATGGCAGG - Intergenic
1163050798 19:14682290-14682312 TGGGTGAGTGGATGGATGGATGG - Intronic
1163252055 19:16131811-16131833 TGGGTGAGTGGATGGATGGATGG + Intronic
1163350674 19:16774692-16774714 TGGGTGAGTGGATGGATGGAAGG - Intronic
1163404291 19:17112820-17112842 TGGGTGAGTGCCTGGCTGGGAGG - Intronic
1163451042 19:17377530-17377552 TGGGTGGGGCGCTGGCTGGCTGG + Intergenic
1163493896 19:17633478-17633500 TGGGTGAATGAATGGATGGAAGG - Intronic
1164634930 19:29785156-29785178 TGGGTGAGTGATTAGATGGATGG + Intergenic
1164701480 19:30287719-30287741 TGGGTGGGTGGGTGGCTGGATGG + Intronic
1164701482 19:30287723-30287745 TGGGTGGGTGGCTGGATGGGTGG + Intronic
1164797436 19:31045286-31045308 TGGATGAGTGAATGGATGGATGG + Intergenic
1164999213 19:32747075-32747097 AGGGAGAGTGACTGGCTGATGGG + Intronic
1165381678 19:35485990-35486012 TGGGTGGGTGGATGGCTGGGTGG + Intergenic
1165735888 19:38175321-38175343 TGGGTGGGTGACAGGCTCTCAGG - Intronic
1165759055 19:38309992-38310014 TGGGTGGGTGGATGGATGGCTGG - Intronic
1165845101 19:38812979-38813001 AGGGTAAGGGAGTGGCTGGCAGG + Exonic
1166389915 19:42403071-42403093 TGGTTGTGTGTGTGGCTGGCAGG + Intronic
1166470378 19:43074864-43074886 TGGGTGAGTGTCTGTGAGGCAGG + Intronic
1167101373 19:47406231-47406253 TGGGTGAGTGAGTGGGTAGATGG + Intronic
1167146766 19:47685516-47685538 TGGGTGTGTGACTGGGTGATTGG + Intronic
1167331966 19:48861600-48861622 AGGGTCAGTGGCTGGCTGGCTGG - Exonic
1167468342 19:49662105-49662127 TGGGTGGGGGACTGGCTCTCTGG - Exonic
1167600589 19:50452245-50452267 CGGATGAGTTACTGGCTGGCTGG - Intronic
1167610853 19:50507131-50507153 TGGGTGAATGGCTGGCTGGGTGG - Intronic
1167634166 19:50644285-50644307 TGGATGAGTGAATGGCTGGATGG + Intronic
1167634189 19:50644451-50644473 TGGATGAGTGAATGGCTGGATGG + Intronic
1167776273 19:51559679-51559701 TGGATGGATGAGTGGCTGGCTGG - Intergenic
1168148760 19:54433896-54433918 AGGGTCAGTGTCTGCCTGGCAGG + Intronic
1168267111 19:55229090-55229112 CGGGAGAGGGGCTGGCTGGCAGG + Exonic
1168319290 19:55499723-55499745 TGGGTGAGTGACTGGAGAGAAGG + Intronic
1168326934 19:55543272-55543294 TGGGTGAGTGGATGGATGGATGG - Intronic
1168330943 19:55568141-55568163 TGGGTGAATGAATGGATGGATGG + Intergenic
1168681297 19:58317958-58317980 TGGTAAAGTGACTGGCAGGCGGG - Intergenic
1202686530 1_KI270712v1_random:55036-55058 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1202687025 1_KI270712v1_random:57252-57274 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
1202687026 1_KI270712v1_random:57256-57278 TGGCTGGCTGCCTGGCTGGCTGG + Intergenic
1202687180 1_KI270712v1_random:57943-57965 TGGCTGACTGGCTGGCCGGCTGG + Intergenic
924966402 2:80493-80515 TGAGTGTGTGACTTGCTGGCTGG + Intergenic
925095320 2:1193979-1194001 TGGGAGACAGACTGGCTGGAGGG - Intronic
925216627 2:2101716-2101738 TGGGTGAGTGGATGGATGGATGG - Intronic
925263749 2:2549946-2549968 TGGATGGATGAGTGGCTGGCTGG + Intergenic
925263750 2:2549950-2549972 TGGATGAGTGGCTGGCTGGCTGG + Intergenic
925263751 2:2549954-2549976 TGAGTGGCTGGCTGGCTGGCTGG + Intergenic
925263752 2:2549958-2549980 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
925347767 2:3182921-3182943 TAGGTGAGTGGGTGGCTGGATGG - Intergenic
925347843 2:3183189-3183211 TGGGTGAGTGGATGGGTGGATGG - Intergenic
925347861 2:3183245-3183267 TGGGTGAGTGGGTGGATGGCGGG - Intergenic
926050299 2:9740245-9740267 TGGGTGGGTGAATGGATGGGTGG - Intergenic
926151728 2:10429297-10429319 TGGGTGGGTGAATGGATGGGTGG + Intergenic
926151818 2:10429593-10429615 TGGGTGGGTGAATGGTTGGGTGG + Intergenic
926151858 2:10429717-10429739 TGGGTGGGTGGCTGGATGGATGG + Intergenic
926151876 2:10429781-10429803 TGGGTGGGTGATTGGTTGGATGG + Intergenic
926162375 2:10498045-10498067 TGGGTGGGTGACAGGCAGCCGGG + Intergenic
926223287 2:10950117-10950139 TGGGTGAGTGGGTGGATGGATGG + Intergenic
926451917 2:13014350-13014372 TAGTTGAGTGAATGCCTGGCCGG + Intergenic
927800714 2:26096411-26096433 TGGATGGATGGCTGGCTGGCTGG + Intronic
927848893 2:26486439-26486461 TGGGTGGGTGAGTGGATGGATGG + Intronic
928061977 2:28123202-28123224 TAGGTGAGTTCCTGGCAGGCTGG - Intronic
928083212 2:28328006-28328028 TGAGTGAGTGACTGGCACGATGG - Intronic
928169415 2:28993786-28993808 TGGGTGGGGCAGTGGCTGGCTGG + Intronic
928333046 2:30372312-30372334 TGGGAGAGAGAGTGGCTGGAAGG - Intergenic
928615441 2:33034054-33034076 TGGGTTTGTGACTGGCTGTTAGG + Intronic
929606752 2:43239848-43239870 TGGGTGAGTGGGTGGATGGGTGG - Intronic
930098955 2:47588457-47588479 TGGGTGTGTGATTGGTTGCCAGG + Intergenic
931246994 2:60499971-60499993 GGGGTGAGTGCCTGGCTGGAGGG - Intronic
931496200 2:62809641-62809663 TGGGGGAGTGACAGGGTGGTAGG - Intronic
931963743 2:67510065-67510087 TGGGTGAGTCAGTGGGTGACGGG - Intergenic
932039893 2:68288065-68288087 TGGCTGGCTGGCTGGCTGGCCGG - Intronic
932039894 2:68288069-68288091 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
932338136 2:70942729-70942751 TGGGTCAGCCACAGGCTGGCAGG - Intronic
932508749 2:72263913-72263935 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
933759949 2:85666240-85666262 TGTGTGTGTGTCTGGCTGGCTGG + Intronic
933759978 2:85666436-85666458 TGTGTGTGTGTCCGGCTGGCTGG + Intronic
933759989 2:85666512-85666534 TGTGTGTGTGTCTGGCTGGCTGG + Intronic
933959236 2:87398006-87398028 TGGGTGGCTGGCTGCCTGGCTGG - Intergenic
933959237 2:87398010-87398032 TGGCTGGGTGGCTGGCTGCCTGG - Intergenic
933959250 2:87398065-87398087 TGGGTGGCTGGCTGCCTGGCTGG - Intergenic
933959251 2:87398069-87398091 TGGCTGGGTGGCTGGCTGCCTGG - Intergenic
933959268 2:87398128-87398150 TGGCTGCCTGGCTGGCTGGCTGG - Intergenic
933959348 2:87398468-87398490 TGGGTGGCTGGCTGCCTGGCTGG - Intergenic
933959375 2:87398562-87398584 TGGCTGCCTGGCTGGCTGGCTGG - Intergenic
933959566 2:87399396-87399418 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933959567 2:87399400-87399422 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933960891 2:87407402-87407424 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933961572 2:87410498-87410520 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933961710 2:87411139-87411161 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933962109 2:87413074-87413096 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933962432 2:87414512-87414534 TGGGTGGCTGGCTGGCTGGCTGG - Intergenic
933962433 2:87414516-87414538 TGGCTGGGTGGCTGGCTGGCTGG - Intergenic
933962434 2:87414520-87414542 TGGGTGGCTGGGTGGCTGGCTGG - Intergenic
933962435 2:87414524-87414546 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
933962463 2:87414621-87414643 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933962464 2:87414625-87414647 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933962465 2:87414629-87414651 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933962495 2:87414736-87414758 TGGCTGCCTGGCTGGCTGGCTGG - Intergenic
933962675 2:87415523-87415545 TGGCTGACTGGGTGGCTGGCTGG - Intergenic
933962724 2:87415742-87415764 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933963025 2:87417117-87417139 TGGCTGCCTGGCTGGCTGGCTGG - Intergenic
933963160 2:87417720-87417742 TGGGTGGCTGGCTGGGTGGCTGG - Intergenic
933963161 2:87417724-87417746 TGGCTGGGTGGCTGGCTGGGTGG - Intergenic
933963365 2:87418559-87418581 TGGCTGACTGGGTGGCTGGCTGG - Intergenic
933963439 2:87418881-87418903 TGGGTGGCTGGGTGGCTGGCTGG - Intergenic
933963632 2:87419733-87419755 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933963826 2:87420626-87420648 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933964782 2:87425072-87425094 GGCTTGAGTGGCTGGCTGGCTGG - Intergenic
933964895 2:87425581-87425603 GGCTTGAGTGGCTGGCTGGCTGG - Intergenic
933965626 2:87428915-87428937 TGGGTGGCTGGCTGCCTGGCTGG - Intergenic
933965638 2:87428967-87428989 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933965665 2:87429070-87429092 TGGCTGGCTGGCTGGCTGGCGGG - Intergenic
933965683 2:87429138-87429160 TGGGTGGCTGGCTGCCTGGCTGG - Intergenic
933965695 2:87429190-87429212 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
933965787 2:87429587-87429609 TGGGTGGCTGGCTGCCTGGCTGG - Intergenic
933965788 2:87429591-87429613 TGGCTGGGTGGCTGGCTGCCTGG - Intergenic
933965805 2:87429650-87429672 TGGCTGCCTGGCTGGCTGGCTGG - Intergenic
933965934 2:87430220-87430242 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
934243189 2:90289240-90289262 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
934243394 2:90290211-90290233 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
934243698 2:90291549-90291571 TGGGTGGCTGGCTGCCTGGCTGG - Intergenic
934243856 2:90292257-90292279 TGGGTGGCTGGCTGCCTGGCTGG - Intergenic
934243961 2:90292697-90292719 TGGGTGGCTGGCTGCCTGGCTGG - Intergenic
934243962 2:90292701-90292723 TGGCTGGGTGGCTGGCTGCCTGG - Intergenic
934243979 2:90292760-90292782 TGGCTGCCTGGCTGGCTGGCTGG - Intergenic
934244133 2:90293440-90293462 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
934244134 2:90293444-90293466 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
934244617 2:90296491-90296513 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
934244824 2:90297477-90297499 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
934244856 2:90297602-90297624 TGGCTGACTGGGTGGCTGGCTGG - Intergenic
934245020 2:90298374-90298396 TGGGTGGCTGGGTGGCTGGCTGG - Intergenic
934263722 2:91498655-91498677 TGGGTGGCTGGGTGGCTGGCTGG + Intergenic
934263883 2:91499401-91499423 TGGCTGACTGGGTGGCTGGCTGG + Intergenic
934263942 2:91499623-91499645 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934263943 2:91499627-91499649 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934263944 2:91499631-91499653 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934263968 2:91499747-91499769 TGGCTGACTGGGTGGCTGGCTGG + Intergenic
934264018 2:91499943-91499965 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934264019 2:91499947-91499969 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934264237 2:91500977-91500999 TGGTTGGCTGGCTGGCTGGCTGG + Intergenic
934264717 2:91503987-91504009 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934264718 2:91503991-91504013 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934264884 2:91504707-91504729 TGGCTGGGTGGCTGGCTGCCTGG + Intergenic
934264885 2:91504711-91504733 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934264927 2:91504874-91504896 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934265040 2:91505400-91505422 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934265042 2:91505404-91505426 TGGCTGGCTGGCTGGCTGGCGGG + Intergenic
934265220 2:91506168-91506190 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934265328 2:91506677-91506699 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934265330 2:91506681-91506703 TGGCTGGCTGGCTGGCTGGCGGG + Intergenic
934265469 2:91507281-91507303 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934265566 2:91507729-91507751 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934265568 2:91507733-91507755 TGGCTGGCTGGCTGGCTGGCGGG + Intergenic
934265972 2:91509491-91509513 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934266397 2:91511441-91511463 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934266642 2:91512534-91512556 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934266751 2:91513043-91513065 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934266753 2:91513047-91513069 TGGCTGGCTGGCTGGCTGGCGGG + Intergenic
934266892 2:91513647-91513669 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934266989 2:91514094-91514116 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934266991 2:91514098-91514120 TGGCTGGCTGGCTGGCTGGCGGG + Intergenic
934267129 2:91514694-91514716 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934267898 2:91518162-91518184 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934268051 2:91518824-91518846 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934268082 2:91518947-91518969 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934268231 2:91519611-91519633 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934268465 2:91520666-91520688 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934268527 2:91520949-91520971 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934268529 2:91520953-91520975 TGGCTGGCTGGCTGGCTGGCGGG + Intergenic
934268723 2:91521840-91521862 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934268725 2:91521844-91521866 TGGCTGGCTGGCTGGCTGGCGGG + Intergenic
934268862 2:91522431-91522453 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934269110 2:91523540-91523562 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934269359 2:91524649-91524671 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934269469 2:91525157-91525179 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934269471 2:91525161-91525183 TGGCTGGCTGGCTGGCTGGCGGG + Intergenic
934269602 2:91525709-91525731 TGGCTGGGTGGCTGGGTGGCTGG + Intergenic
934269603 2:91525713-91525735 TGGGTGGCTGGGTGGCTGGCTGG + Intergenic
934269613 2:91525756-91525778 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934269857 2:91526857-91526879 TGGGTGGCTGGCTGCCTGGCTGG + Intergenic
934270206 2:91528410-91528432 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
934523895 2:95037038-95037060 TGGGTGAGTGAGTGACTGAGTGG + Intronic
934523901 2:95037098-95037120 TGGGTGAGTGAGTGACTGAGTGG + Intronic
934523909 2:95037266-95037288 TGGGTGAGTGAGTGACTGACTGG + Intronic
934523950 2:95038873-95038895 TGGGTGAGTGAGTGACTGAGTGG + Intronic
934658555 2:96130707-96130729 TGTATGCGTGGCTGGCTGGCTGG - Intronic
934768588 2:96894343-96894365 TGGGTGAGTGGGTGGGTGTCAGG - Intronic
934780808 2:96968557-96968579 TCAGTGAGTGGCTGGCTAGCAGG - Intronic
934884752 2:98014576-98014598 TGGGCTAGTGACTGGTGGGCTGG - Intergenic
935211768 2:100944871-100944893 AGGCTGAGTGGCTGCCTGGCCGG - Intronic
936957002 2:118032467-118032489 TGGGTGGGTGGATGGATGGCTGG + Intergenic
936964985 2:118118514-118118536 TGGGTGAGTTACTCGCAGACTGG + Intergenic
937085484 2:119169077-119169099 TGGCTGAGTGGCTGGGGGGCTGG - Intergenic
937234084 2:120419889-120419911 TGGGTGAGTGGGTGGATGGATGG - Intergenic
937234146 2:120420181-120420203 TGGGTGGGTAACTGGATGGCTGG - Intergenic
937236906 2:120436699-120436721 GGGGTGGGTGGCTGGCTGGAGGG - Intergenic
937268500 2:120632349-120632371 TGGGTGGGTGAGTGGATGGATGG + Intergenic
937383429 2:121403359-121403381 TGGGTGAATGAATGGGTGGATGG + Intronic
937441083 2:121916818-121916840 TGGGACAGTCACTGGCTGCCAGG - Intergenic
937956709 2:127425901-127425923 TGACTGACTGACTGGCTGACTGG + Intronic
937977060 2:127588761-127588783 TGGGTGAGTGGATGGATGGGTGG + Intronic
937977080 2:127588816-127588838 TGGGTGGGTGAGTGGATGGGTGG + Intronic
937977081 2:127588820-127588842 TGGGTGAGTGGATGGGTGGATGG + Intronic
937977127 2:127588997-127589019 TGGGTGAGTGAGTGGATGGGTGG + Intronic
937977141 2:127589036-127589058 TGGGTGGGTGAGTGGATGGGTGG + Intronic
937977142 2:127589040-127589062 TGGGTGAGTGGATGGGTGGATGG + Intronic
937977199 2:127589252-127589274 TGGGTGGGTGAGTGGATGGATGG + Intronic
937977201 2:127589256-127589278 TGGGTGAGTGGATGGATGGGTGG + Intronic
937977224 2:127589332-127589354 TGGGTGAGTGGATGGATGGATGG + Intronic
937977284 2:127589549-127589571 TGGGTGAGTGGGTGGATGGGTGG + Intronic
937977295 2:127589588-127589610 TGGGTGAGTGGGTGGATGGGTGG + Intronic
937977369 2:127589830-127589852 TGGGTGAGTGGGTGGATGGGTGG + Intronic
938108170 2:128547269-128547291 TGGGTGGGTGGGTGGCTGGGTGG - Intergenic
938188789 2:129255880-129255902 TGGGTGAGTGGGTGTCTAGCTGG - Intergenic
938540395 2:132280163-132280185 TGGGTCAGTGGGTGGCAGGCGGG - Intergenic
938730205 2:134141501-134141523 TGGGTGGGTGGGTGGGTGGCTGG + Intronic
938730206 2:134141505-134141527 TGGGTGGGTGGGTGGCTGGATGG + Intronic
944831197 2:203535283-203535305 TGACTGACTGACTGACTGGCGGG + Exonic
945977747 2:216283779-216283801 TGGGTGAGTGATGGGCGGGAGGG + Intronic
946197293 2:218042102-218042124 TTGATGAGTGAGTGGCTGGTGGG + Intronic
947520801 2:230844635-230844657 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
947520803 2:230844643-230844665 TGAATGAATGGCTGGCTGGCTGG - Intergenic
947520804 2:230844647-230844669 TGGCTGAATGAATGGCTGGCTGG - Intergenic
947812897 2:233015361-233015383 TGGGTGGATGACTGGATGGGTGG - Intronic
947836040 2:233176418-233176440 TGGGTGGGTGAATGGATGGATGG + Intronic
947980830 2:234408230-234408252 TGGGTGAATGAGTGACTGGTGGG - Intergenic
948366413 2:237457763-237457785 TGGGTGGGTGAATGGGTGGATGG + Intergenic
948366419 2:237457779-237457801 TGGATGGGTGGCTGGGTGGCTGG + Intergenic
948366435 2:237457839-237457861 TGGGTGGGTGAATGGGTGGATGG + Intergenic
948463528 2:238141526-238141548 GGGGTGAGTGAGCGGCTGGGAGG + Exonic
948568902 2:238905045-238905067 TAGGTGGGTGGCTGGCTGGGTGG + Intronic
948700281 2:239755287-239755309 TGGGTGAGTGGATGGATGGATGG + Intergenic
948815672 2:240509194-240509216 TGGGTGGGTGAGTGGATGGGTGG + Intronic
948815673 2:240509198-240509220 TGGGTGAGTGGATGGGTGGATGG + Intronic
948818792 2:240527844-240527866 TGGGTGGGTGATTGGGTGGGTGG + Intronic
948857538 2:240736998-240737020 TGGCTGAGGGCCTGGCAGGCTGG + Intronic
1168842691 20:919838-919860 TTGGTGAGGGACAGGCAGGCAGG - Intergenic
1168998432 20:2149310-2149332 TGGGTGAGTGCCAGGCGGGCTGG + Intronic
1169142896 20:3236102-3236124 AGGGTGAGTCACTCCCTGGCAGG - Intronic
1169267210 20:4174061-4174083 TGGCTGAGGGACTGGGTGGCTGG + Intronic
1169320247 20:4626343-4626365 TGGATGGGTGACTGGTTGCCAGG - Intergenic
1169934411 20:10867348-10867370 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1170853419 20:20024737-20024759 TATGTCAGTGGCTGGCTGGCAGG + Intronic
1171253346 20:23667476-23667498 TGAGTGAGGAACCGGCTGGCAGG + Intergenic
1171259821 20:23722730-23722752 TGAGTGAGGGACTGGCCGGCAGG + Intergenic
1171268897 20:23798261-23798283 TGAGTGAGGGACCGGCCGGCAGG + Intergenic
1172123788 20:32613425-32613447 TGGATGAGAGGCTGGCTGGATGG + Intergenic
1172123837 20:32613661-32613683 TGGATGGATGAATGGCTGGCTGG + Intergenic
1172123843 20:32613705-32613727 TGGATGAGAGGCTGACTGGCTGG + Intergenic
1172123917 20:32614065-32614087 TGGATGAGAGGCTGACTGGCTGG + Intergenic
1172184012 20:33020253-33020275 TGGGTGGGAGGCTGGGTGGCTGG + Intronic
1172193172 20:33074630-33074652 TGGGAGGCTGGCTGGCTGGCTGG - Intergenic
1172193173 20:33074634-33074656 TGGATGGGAGGCTGGCTGGCTGG - Intergenic
1172196203 20:33093379-33093401 TGGGTGGGTGGATGGATGGCTGG - Intronic
1172196274 20:33093685-33093707 TGGGTGAGTGAGTGGATAGGTGG - Intronic
1172583297 20:36065054-36065076 TGGCTGACTGGCTGACTGGCTGG + Intergenic
1172583298 20:36065058-36065080 TGACTGGCTGACTGGCTGGCTGG + Intergenic
1172583301 20:36065078-36065100 TGGTTGACTGGCTGGCTGACTGG + Intergenic
1172583302 20:36065086-36065108 TGGCTGGCTGACTGGCTGCCTGG + Intergenic
1172583303 20:36065090-36065112 TGGCTGACTGGCTGCCTGGCTGG + Intergenic
1172583305 20:36065098-36065120 TGGCTGCCTGGCTGGCTGGCTGG + Intergenic
1172779842 20:37430048-37430070 TGGGTGTGTGAATGGATGGATGG - Intergenic
1172779875 20:37430185-37430207 TGGATGAGTGAGTGGGTGGATGG - Intergenic
1172779901 20:37430343-37430365 TGGATGAGTGAGTGGGTGGGTGG - Intergenic
1172899116 20:38321070-38321092 TGGGTGAATGAATGGATGGGAGG + Intronic
1172939449 20:38644543-38644565 TGGGTGAGTGGGTGGATGGATGG - Intronic
1172939467 20:38644610-38644632 TGGGTGAGTGGGTGGGTGACGGG - Intronic
1172939509 20:38644774-38644796 TGGGTGAATGAGTGGGTGGATGG - Intronic
1173071809 20:39775356-39775378 AGGGTGAGTGACTGACTCCCTGG - Intergenic
1173181159 20:40807315-40807337 CTGGAGAGTGAATGGCTGGCAGG + Intergenic
1173863407 20:46298673-46298695 TGGATGAGTGGATGGATGGCTGG + Intronic
1173976481 20:47190485-47190507 TGGATGAGTGAATGGCTGGGTGG + Intergenic
1174195012 20:48766811-48766833 TTGGTGAGTGAGTGGATGGACGG + Intronic
1174279714 20:49430407-49430429 TGGGTGAATGAATGGATGGATGG - Intronic
1174289802 20:49500003-49500025 TGGCTGAGTGAGGGGGTGGCAGG - Intergenic
1174302403 20:49592204-49592226 TGGGTGGGTGAATGGATGGCTGG - Intergenic
1174368697 20:50071851-50071873 TGGGTGAATGGCTGGCTGGAAGG - Intergenic
1174368698 20:50071855-50071877 TGAATGGGTGAATGGCTGGCTGG - Intergenic
1174459377 20:50672031-50672053 TGGGTGGGTGATTGGATGGATGG + Intronic
1174512103 20:51061143-51061165 TGGGTGAGTGGATGGATGGATGG - Intergenic
1174512104 20:51061147-51061169 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1174564643 20:51456121-51456143 TGGGTGGGTGAGTGGATGGATGG + Intronic
1174564645 20:51456125-51456147 TGGGTGAGTGGATGGATGGGTGG + Intronic
1174734004 20:52946890-52946912 TTAGTGAGTGACTGACAGGCGGG + Intergenic
1175189765 20:57203406-57203428 TGGGTGAATGAGTGGATGGATGG + Intronic
1175215215 20:57389094-57389116 TGGGTGAATGACTGATTGTCAGG + Intergenic
1175302395 20:57952227-57952249 TGGGTGTGTGAATGGGTGGATGG - Intergenic
1175375308 20:58519947-58519969 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
1175375323 20:58520011-58520033 TGGGTGAGTGGATGGGTGGATGG + Intergenic
1175407492 20:58744436-58744458 TGGGTGAGTGGATGGATGGGTGG + Intergenic
1175526560 20:59638570-59638592 TGGGTGCGTGAGTGGATGGATGG + Intronic
1175526631 20:59638878-59638900 TGGGTGGGTGAGTGGATGGGTGG + Intronic
1175526632 20:59638882-59638904 TGGGTGAGTGGATGGGTGGATGG + Intronic
1175658642 20:60793363-60793385 TGGCTGAGGGTCTGGCTGGCTGG + Intergenic
1175721082 20:61287745-61287767 AGGGGGAGTGGCTGGCAGGCAGG - Intronic
1175742425 20:61429532-61429554 TGGGTGTGTGAGTGGATGGATGG + Intronic
1175772529 20:61632713-61632735 TGAATGAGTGAGTGGCTGGTTGG - Intronic
1175817286 20:61889879-61889901 TGGGTGAGTGAATGGATGGATGG + Intronic
1175817294 20:61889933-61889955 TGGATGAGTGAGTGGATGGTTGG + Intronic
1175817367 20:61890330-61890352 TGGGTGAGTGAATGGATGTATGG + Intronic
1175818031 20:61893683-61893705 TGGGTGAGTGGATGGATGGATGG + Intronic
1175818044 20:61893730-61893752 TGGGTGGGTGAGTGGATGGATGG + Intronic
1175818045 20:61893734-61893756 TGGGTGAGTGGATGGATGGATGG + Intronic
1175818058 20:61893781-61893803 TGGGTGGGTGAGTGGATGGATGG + Intronic
1175818059 20:61893785-61893807 TGGGTGAGTGGATGGATGGATGG + Intronic
1175901170 20:62360430-62360452 TGGGTGAGTGGGTGGGTGGAGGG + Intronic
1176057837 20:63158222-63158244 TAGGTGAATGACTGGGTGGGTGG + Intergenic
1176131257 20:63497769-63497791 TGGGAGTGTGAGGGGCTGGCGGG + Exonic
1176170050 20:63692661-63692683 TGCCTGAGAAACTGGCTGGCTGG - Intronic
1176421462 21:6519561-6519583 TGGGTGAGTGGATGGATGGATGG - Intergenic
1179474776 21:41636163-41636185 TGGGTGAGTGGATGGATGGATGG - Intergenic
1179483540 21:41693970-41693992 TGGATGAGTGAATGGATGGATGG - Intergenic
1179696952 21:43127877-43127899 TGGGTGAGTGGATGGATGGATGG - Intergenic
1179899455 21:44381435-44381457 TGGGTGGGTGTGTGGATGGCTGG + Intronic
1179899456 21:44381439-44381461 TGGGTGTGTGGATGGCTGGATGG + Intronic
1180024995 21:45155955-45155977 TGGGTGGGTGGGTGGATGGCTGG - Intronic
1180025071 21:45156255-45156277 TGGGTGGGTGGATGGATGGCTGG - Intronic
1180025156 21:45156603-45156625 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1180046503 21:45308727-45308749 TGGGGCAGTGCCTGGCAGGCTGG + Intergenic
1180086046 21:45508355-45508377 TGGGTGAGTGGATGGGTGGATGG + Intronic
1180086068 21:45508444-45508466 TGGGTGAGTGGATGGGTGGATGG + Intronic
1180086077 21:45508472-45508494 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1180182484 21:46124195-46124217 TGGGTTAGTGGGTGGCTGGGTGG + Intronic
1180182492 21:46124226-46124248 TGGATGGGTGACTGGGTGGATGG + Intronic
1180182501 21:46124254-46124276 TGGGTTAGTGGGTGGCTGGGTGG + Intronic
1180553998 22:16561328-16561350 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1180554026 22:16561439-16561461 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1180554264 22:16562837-16562859 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1180554320 22:16563099-16563121 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1180554364 22:16563291-16563313 TGGCTGGTTGGCTGGCTGGCTGG - Intergenic
1180554448 22:16563658-16563680 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1180555454 22:16567938-16567960 TGGCTGGTTGGCTGGCTGGCAGG - Intergenic
1181441525 22:22938332-22938354 TGGGTGGGTGAGTGGATGGCTGG + Intergenic
1181580058 22:23823193-23823215 TGTGTTAGTGACTGAATGGCAGG + Intronic
1181822584 22:25487431-25487453 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1181900139 22:26147063-26147085 TGGGTGAGTGGATGGATGGATGG + Intergenic
1182009405 22:26987700-26987722 TGGGTGGATGAATGGCTGGCTGG + Intergenic
1182009406 22:26987704-26987726 TGGATGAATGGCTGGCTGGCTGG + Intergenic
1182009418 22:26987752-26987774 TGGGTGAGTGGATGGGTGGATGG + Intergenic
1182060664 22:27394877-27394899 TGAGTGAGTGAGTGGTTGGATGG + Intergenic
1182086619 22:27565421-27565443 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
1182410685 22:30182917-30182939 TGGCTGAGGGACTGGGTGGGAGG - Intergenic
1182458117 22:30465446-30465468 TATTTGACTGACTGGCTGGCTGG - Intronic
1182474528 22:30569410-30569432 CTGTTGGGTGACTGGCTGGCTGG + Intronic
1182897623 22:33872114-33872136 TGGGCGAGTGACTGGCTGAAAGG - Intronic
1183077904 22:35438335-35438357 TGGGTGAGTGGATGGATGGATGG - Intergenic
1183077905 22:35438339-35438361 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1183082220 22:35463728-35463750 TGGATGAGTGAATGGATGGGTGG - Intergenic
1183100008 22:35578222-35578244 TGGATGGATGGCTGGCTGGCTGG + Intergenic
1183741201 22:39669578-39669600 TGAATGGGTGGCTGGCTGGCTGG + Intronic
1183741202 22:39669582-39669604 TGGGTGGCTGGCTGGCTGGCTGG + Intronic
1184123665 22:42471534-42471556 TGGGTGAGTGGATGGATGGATGG - Intergenic
1184123671 22:42471558-42471580 TGGATGAGTGAGTTGTTGGCTGG - Intergenic
1184321265 22:43743877-43743899 TGGGTGGGTGAGTGGATGGATGG + Intronic
1184321266 22:43743881-43743903 TGGGTGAGTGGATGGATGGATGG + Intronic
1184356031 22:43980152-43980174 TGGGTGGGTGAATGGATGGATGG - Intronic
1184410055 22:44321204-44321226 TGGGTTAGTTACTGGATTGCTGG - Intergenic
1184434296 22:44460682-44460704 TGGTTGAGTGACTGGATGGATGG - Intergenic
1184444538 22:44539641-44539663 TGGGTGGGTGAGTGGATGGATGG + Intergenic
1184444539 22:44539645-44539667 TGGGTGAGTGGATGGATGGATGG + Intergenic
1184444639 22:44540035-44540057 TGGGTGGGTGAGTGGGTGGATGG + Intergenic
1184444640 22:44540039-44540061 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1184444683 22:44540195-44540217 TAGGTGAGTGAATGGATGGATGG + Intergenic
1184609689 22:45594787-45594809 TGGGTGGGTGAATGGATGGATGG + Intronic
1184649566 22:45913407-45913429 TGGTGGAGGGACTGGCTAGCCGG - Intergenic
1184731258 22:46372312-46372334 GGGGTGAGTGAGTGGATGGATGG - Intronic
1184731271 22:46372364-46372386 GGGGTGAGTGAGTGGATGGATGG - Intronic
1184849741 22:47113329-47113351 GGTGTCTGTGACTGGCTGGCTGG + Intronic
1184855044 22:47142238-47142260 TGGGTGGGTGAATGGATGGATGG - Intronic
1184855098 22:47142411-47142433 TGGGTGGGTGAATGGATGGGTGG - Intronic
1184855107 22:47142435-47142457 TGGGTGGGTGAATGGATGGGTGG - Intronic
1184964639 22:47962231-47962253 TGGGTGGGTGAATGGATGGGTGG + Intergenic
1184979266 22:48084596-48084618 TTGGAGAGCGACTGGTTGGCTGG + Intergenic
1184991065 22:48170381-48170403 TGGGTGAGTGAATGGGCGGATGG - Intergenic
1184991151 22:48170832-48170854 TGGGTGAGTGATTGGAGGACAGG - Intergenic
1185108618 22:48888192-48888214 TGGGTGAGTGGATGGATGGAGGG - Intergenic
1185108620 22:48888196-48888218 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1185160422 22:49224386-49224408 CGGATGGATGACTGGCTGGCTGG + Intergenic
1185160423 22:49224390-49224412 TGGATGACTGGCTGGCTGGCTGG + Intergenic
1185165603 22:49260512-49260534 TGAGTGAGTGAATGGATGGATGG - Intergenic
1185211431 22:49572896-49572918 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1185211457 22:49572980-49573002 TGGGTGGGTGAATGGGTGGGTGG + Intronic
1185211474 22:49573040-49573062 TGGGTGAATGGGTGGCTGGGTGG + Intronic
1185212560 22:49579128-49579150 TGGGGGAGGGACTGGGTGGGAGG - Intronic
1185352584 22:50345926-50345948 TGGGTGGGTCACTGACTGGAGGG - Intronic
1185352619 22:50346050-50346072 TGGGTGGGTCACTGACTGGAGGG - Intronic
949289257 3:2444732-2444754 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
949289258 3:2444736-2444758 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
949289259 3:2444740-2444762 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
949741250 3:7237138-7237160 TGACAGAGTGACTTGCTGGCAGG - Intronic
950005173 3:9686863-9686885 TGGGCGAGGCACTGGCTGGAAGG + Intronic
950025776 3:9819079-9819101 TGGATGAGTGGATGGATGGCTGG - Intronic
950122032 3:10488337-10488359 TGGGTGAGTGAATGGATGGATGG - Intronic
950146205 3:10651659-10651681 AGGGTGGGTGAATGGCTGGGTGG + Intronic
950210715 3:11120885-11120907 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
950210718 3:11120897-11120919 TGGATGAATCAATGGCTGGCTGG - Intergenic
950281537 3:11711850-11711872 TGGGTGATACACTGGCTGTCAGG + Intronic
950451220 3:13066902-13066924 TGGGTGAGTGATCGGCAGGATGG + Intronic
950541265 3:13614682-13614704 TGGGTGAGTGAATGGGTGGATGG - Intronic
950541759 3:13617374-13617396 TGGGTGAGTGGGTGGATGGGTGG - Intronic
950541817 3:13617627-13617649 TGGGTGAATGAATGGGTGGGTGG - Intronic
950541874 3:13617796-13617818 TGGGTGAGTGAGTGGATGGGTGG - Intronic
950721131 3:14883418-14883440 TGAGTGGGTGAAAGGCTGGCTGG - Intronic
950767043 3:15280598-15280620 TGGCTGTGTGGCTGGCTGGCAGG - Intronic
951876062 3:27427202-27427224 TGGCTGGGTGATTGGGTGGCAGG - Intronic
952005236 3:28835899-28835921 AGGGTGAGCGGCTGGCTGGCTGG - Intergenic
952772408 3:37014185-37014207 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
952846054 3:37688971-37688993 TGAGTGGATGACTGGCTGGGTGG + Intronic
952846059 3:37688995-37689017 TGGGTGTGTGAGTGGATGGCTGG + Intronic
952846060 3:37688999-37689021 TGTGTGAGTGGATGGCTGGCTGG + Intronic
952846068 3:37689031-37689053 TGGATGGGTGAGTGGATGGCTGG + Intronic
952846069 3:37689035-37689057 TGGGTGAGTGGATGGCTGGCTGG + Intronic
952960277 3:38584945-38584967 TGAGTGAGTGAATGGATGGATGG + Intronic
953705501 3:45226870-45226892 GTGGAGAGTGACTGGCTGGGGGG + Intergenic
954033329 3:47836075-47836097 TGCCTGGCTGACTGGCTGGCTGG + Intronic
954127571 3:48540468-48540490 TGGGTCAGTGCCTGGCTGGATGG - Intronic
954634193 3:52062733-52062755 TGGGTGAGTGAGTAACTGGCTGG - Intergenic
954750191 3:52809228-52809250 TGGGTGAGTGAATGGATGGATGG - Intergenic
954876213 3:53804704-53804726 TGGGTGAGAGCCTGGCTCACAGG + Intronic
954954852 3:54510167-54510189 TGGGTGAGTGAGTGGAGGGATGG + Intronic
955810440 3:62782299-62782321 TGCATGAGTGGCTCGCTGGCTGG - Intronic
956700508 3:71954900-71954922 AGGGTGAGTGACAGGTAGGCTGG + Intergenic
957437928 3:80203122-80203144 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
957464999 3:80577679-80577701 TGGGTGGTTGGCTGGTTGGCTGG - Intergenic
958911510 3:99999415-99999437 TGGGTGGGTGAGTGGTTGGGAGG + Intronic
959911476 3:111768606-111768628 TGGGTGAGGGACGGACTGGCTGG - Intronic
960252537 3:115472369-115472391 TGGGTGACTGAGTGGATGGGAGG - Intergenic
960947665 3:122978059-122978081 TGGGGGCAGGACTGGCTGGCTGG - Intronic
961315259 3:126030720-126030742 TGGGTGAGTGGCTGGGTTGATGG + Intronic
961358400 3:126352836-126352858 TGGGTGATAGGCTGGTTGGCCGG - Exonic
961500018 3:127325782-127325804 TGGGTGGGTGGCCAGCTGGCTGG + Intergenic
961615950 3:128181150-128181172 TGGGTGTGTGGCTGGCTCCCTGG + Intronic
961661244 3:128469896-128469918 TGGGTGTGTGGGTGGCTGGGTGG - Intergenic
961661256 3:128469928-128469950 TGGGTGAGTGGCTGGCTGGGTGG - Intergenic
961661258 3:128469932-128469954 TGGGTGGGTGAGTGGCTGGCTGG - Intergenic
961661268 3:128469968-128469990 TGTATGAGTGGCTGGGTGGCTGG - Intergenic
961661269 3:128469972-128469994 TGGGTGTATGAGTGGCTGGGTGG - Intergenic
961661274 3:128469992-128470014 TGGGTGGGTGGCTGGGTGGCTGG - Intergenic
961661275 3:128469996-128470018 TGGGTGGGTGGGTGGCTGGGTGG - Intergenic
961661292 3:128470040-128470062 TGGCTGGGTGGCTGGGTGGCTGG - Intergenic
961661303 3:128470072-128470094 TGTGTGGGTGGCTGGGTGGCTGG - Intergenic
961661304 3:128470076-128470098 TGGGTGTGTGGGTGGCTGGGTGG - Intergenic
961661326 3:128470144-128470166 TGTGTGGGTGGCTGGGTGGCTGG - Intergenic
961661327 3:128470148-128470170 TGGGTGTGTGGGTGGCTGGGTGG - Intergenic
961661342 3:128470200-128470222 TGTGTGGGTGGCTGGGTGGCTGG - Intergenic
961661343 3:128470204-128470226 TGGGTGTGTGGGTGGCTGGGTGG - Intergenic
961736376 3:129004379-129004401 TGGGTGAGTGGATGGATGGGTGG - Intronic
961736401 3:129004487-129004509 TGGGTGGGTGAGTGGATGGGTGG - Intronic
962816405 3:139005303-139005325 TGGTTGGTTGGCTGGCTGGCTGG - Intergenic
963071539 3:141309047-141309069 TGAGTAATTGACTGGCTGGTTGG + Intergenic
964455979 3:156866704-156866726 TGGCTGGATGGCTGGCTGGCTGG + Intronic
964747629 3:160026927-160026949 TTGGTCAGTGACTGGCTTACAGG - Intronic
964875605 3:161365242-161365264 TGACTGAGTGGCTAGCTGGCTGG - Intronic
965258439 3:166446485-166446507 TGGGTGAGTCACTGGGTGAGTGG + Intergenic
965422713 3:168481897-168481919 ATGGTGAGTGACTGGCTGTGAGG + Intergenic
967739698 3:192991338-192991360 TGGTTGATTGATTGGTTGGCTGG - Intergenic
967982758 3:195075660-195075682 TGGGTGCCCGAGTGGCTGGCAGG + Intronic
968008345 3:195257697-195257719 TGGGTGAGTGTGTGGCTCTCTGG - Intronic
968282296 3:197486166-197486188 TGGGTGAATAACAGGCTGTCAGG + Intergenic
968360138 3:198140904-198140926 TGGGGGAGTGTCTGTCTGCCGGG + Intergenic
968598479 4:1497596-1497618 TGGGTGAGTGGGTGGATGGAAGG + Intergenic
968598487 4:1497624-1497646 TGGGTGAGTGGGTGGATGGAAGG + Intergenic
968762039 4:2447622-2447644 TGGGTGAATGAATGGATGGGTGG + Intronic
968762091 4:2447910-2447932 TGGGTGAATGAATGGATGGGTGG + Intronic
968928124 4:3560701-3560723 TGGGTGGGTGAATGGGTGGATGG - Intergenic
968930948 4:3578457-3578479 TGGGTGAGTGAATGGATGGGTGG - Intronic
968946147 4:3665525-3665547 TGGGTGGATGACTGGATGGGTGG - Intergenic
968946163 4:3665581-3665603 TGGGTGGGTGAATGGATGGGTGG - Intergenic
968946182 4:3665645-3665667 TGGGTGGGTGAATGGATGGGTGG - Intergenic
969216717 4:5729076-5729098 TGGGTGAATGAATGGGTGGGTGG - Intronic
969268127 4:6079313-6079335 TGGGTGAGTGGATGGATGGATGG + Intronic
969499418 4:7543864-7543886 TGGGTGGGTGGCTGGATGGATGG - Intronic
969499419 4:7543868-7543890 TGGGTGGGTGGGTGGCTGGATGG - Intronic
969499420 4:7543872-7543894 TGGGTGGGTGGGTGGGTGGCTGG - Intronic
969499467 4:7544020-7544042 TGGGTGGGTGGCTGGATGGATGG - Intronic
969499474 4:7544040-7544062 TGGGTGGGTGGCTGGATGGATGG - Intronic
969501568 4:7556668-7556690 TAGGTGGGTGACTGGATGGATGG - Intronic
969510374 4:7614266-7614288 TGGGTGAGTGGATGGGTGGATGG - Intronic
969524044 4:7695297-7695319 TGGGTGAGTGAATGGGTGGGTGG + Intronic
969524103 4:7695477-7695499 TGGGTGAGTGGATGGGTGGGTGG + Intronic
969524108 4:7695493-7695515 TGGGTGGGTGAGTGGATGGGTGG + Intronic
969524110 4:7695497-7695519 TGGGTGAGTGGATGGGTGGGTGG + Intronic
969524115 4:7695513-7695535 TGGGTGGGTGAGTGGATGGGTGG + Intronic
969524117 4:7695517-7695539 TGGGTGAGTGGATGGGTGGGTGG + Intronic
969571572 4:8012048-8012070 TGGGTGGATGGCTGGCTGGCTGG - Intronic
969571573 4:8012052-8012074 TGGATGGGTGGATGGCTGGCTGG - Intronic
969571616 4:8012233-8012255 TGGATGGGTGCCTGGCTGGCTGG - Intronic
969571729 4:8012754-8012776 TGGGTGAGTGGGTGGATGGATGG - Intronic
969687446 4:8683583-8683605 TGGGTGAGTGGGTGGATGGGTGG + Intergenic
969687525 4:8683955-8683977 TGGGTGGGTGAATGGGTGGGTGG + Intergenic
970019097 4:11546968-11546990 TGTGTGTGTGAGTGGCTGGCTGG + Intergenic
970652476 4:18193688-18193710 TGGGTGGGTGGGTTGCTGGCTGG + Intergenic
971198507 4:24491698-24491720 TGGGTGGGTGACTGGATGGATGG + Intergenic
971198596 4:24492100-24492122 TGGGTGTGTGAGTGACTGGATGG + Intergenic
971198597 4:24492104-24492126 TGTGTGAGTGACTGGATGGATGG + Intergenic
971198614 4:24492176-24492198 TGGGTGGGTGACTGGATGAATGG + Intergenic
972169309 4:36325646-36325668 TGTGTGTGGGACTGGGTGGCAGG + Intronic
974496136 4:62630824-62630846 AGGTTGAGTGACTGGCTGGAAGG - Intergenic
976311146 4:83614821-83614843 TGGTTTGGTGACTGGCTTGCTGG + Intergenic
976651882 4:87444424-87444446 TGGGTGAGTAAGTGGATGGATGG - Intronic
977796171 4:101167760-101167782 TATGTGGGTGACAGGCTGGCTGG + Intronic
977796172 4:101167764-101167786 TGGGTGACAGGCTGGCTGGCTGG + Intronic
978735503 4:112079807-112079829 TGGATGAGTCAAGGGCTGGCAGG - Intergenic
979382849 4:120029019-120029041 GGGGTGAGTGACTGCTTGACAGG - Intergenic
982166336 4:152616988-152617010 TGGGTGAGTGGATGGGTGGGTGG - Intergenic
982172599 4:152676215-152676237 TGGGTCAGAGACTGGCTGAGAGG - Intronic
982936213 4:161479933-161479955 TGGGTGAGTGAATGGATGGATGG + Intronic
985380546 4:189390301-189390323 TGGGTGAGTGGGTGGATGGATGG + Intergenic
985547533 5:517506-517528 TGGATGAGTGAATGGATAGCTGG - Intronic
985547548 5:517586-517608 TGGGTGAGTGAGTGGATGGATGG - Intronic
985560531 5:583943-583965 TGGGTGGTTGAGTGGCTGGGTGG + Intergenic
985560532 5:583947-583969 TGGTTGAGTGGCTGGGTGGATGG + Intergenic
985560555 5:584023-584045 TGGGTGAGTGGATGGGTGGGCGG + Intergenic
985560567 5:584055-584077 TGGGTGGGTGAGTGGGTGGGTGG + Intergenic
985560568 5:584059-584081 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
985560580 5:584091-584113 TGGGTGGGTGGTTGGCTGGGTGG + Intergenic
985560585 5:584107-584129 TGGGTGGGTGAGTGGATGGGTGG + Intergenic
985560586 5:584111-584133 TGGGTGAGTGGATGGGTGGACGG + Intergenic
985560612 5:584195-584217 TGGGTGGGTGGATGGGTGGCTGG + Intergenic
985560613 5:584199-584221 TGGGTGGATGGGTGGCTGGCTGG + Intergenic
985560614 5:584203-584225 TGGATGGGTGGCTGGCTGGATGG + Intergenic
985560621 5:584235-584257 TGGGTGGGTGAGTGGATGGATGG + Intergenic
985560623 5:584239-584261 TGGGTGAGTGGATGGATGGGTGG + Intergenic
985560637 5:584294-584316 TGGGTGGGTGAGTGGATGGCTGG + Intergenic
985560700 5:584546-584568 TGGATGGGTGAGTGGCTGGCTGG + Intergenic
985560701 5:584550-584572 TGGGTGAGTGGCTGGCTGGTTGG + Intergenic
985560709 5:584570-584592 TGGGTGGGTGGCTGGATGGGTGG + Intergenic
985560720 5:584606-584628 TGGGTGGGTGAATGGGTGGCTGG + Intergenic
985560721 5:584610-584632 TGGGTGAATGGGTGGCTGGATGG + Intergenic
985560728 5:584630-584652 TGGGTGGGTGGATGGCTGGATGG + Intergenic
985560732 5:584646-584668 TGGATGGGTGAGTGGCTGGCTGG + Intergenic
985560733 5:584650-584672 TGGGTGAGTGGCTGGCTGGTTGG + Intergenic
985560741 5:584670-584692 TGGGTGGGTGGCTGGATGGGTGG + Intergenic
985560752 5:584706-584728 TGGGTGGGTGAATGGGTGGCTGG + Intergenic
985560753 5:584710-584732 TGGGTGAATGGGTGGCTGGATGG + Intergenic
985560763 5:584742-584764 TGGATGGGTGAGTGGCTGGATGG + Intergenic
985560767 5:584758-584780 TGGATGGGTGAGTGGCTGGATGG + Intergenic
985560769 5:584762-584784 TGGGTGAGTGGCTGGATGGGTGG + Intergenic
985560773 5:584778-584800 TGGGTGGGTGAGTGGATGGATGG + Intergenic
985560839 5:585006-585028 TGGGTGGGTGGGTGGCTGGCTGG + Intergenic
985560840 5:585010-585032 TGGGTGGGTGGCTGGCTGGCTGG + Intergenic
985560841 5:585014-585036 TGGGTGGCTGGCTGGCTGGATGG + Intergenic
985560853 5:585058-585080 TGGGTGGGTGGTTGGGTGGCTGG + Intergenic
985560896 5:585202-585224 TGGGTGGGTGAGTGGATGGATGG + Intergenic
985560897 5:585206-585228 TGGGTGAGTGGATGGATGGATGG + Intergenic
985662854 5:1166007-1166029 TGGGTGAGTGGGTGGATGGATGG - Intergenic
985662855 5:1166011-1166033 TGGGTGGGTGAGTGGGTGGATGG - Intergenic
985662866 5:1166051-1166073 TGGGTGAGTGGGTGGATGGATGG - Intergenic
985662867 5:1166055-1166077 TGGGTGGGTGAGTGGGTGGATGG - Intergenic
985797876 5:1977054-1977076 TGAGTGAGTGAGTGAATGGCTGG + Intergenic
985821099 5:2160862-2160884 TGGGTGGGTGAATGGATGGACGG - Intergenic
985829658 5:2219156-2219178 TGGGTGAGTGAATGGATGGGTGG - Intergenic
985829771 5:2219692-2219714 TGGGTGGGTGAATGGATGGGTGG - Intergenic
985837208 5:2280299-2280321 TGGGTGAGTGAGTGGTTGGGTGG + Intergenic
985837376 5:2280999-2281021 TGGGTGGGTGAATGGGTGGGTGG + Intergenic
985837508 5:2281498-2281520 TGGGTGGATGACTGGGTGGGTGG + Intergenic
985874412 5:2584509-2584531 TGGGTGAGTGGGTGGATGGATGG + Intergenic
985874479 5:2584844-2584866 TGGTTGAGTGGATGGATGGCTGG + Intergenic
985874674 5:2585681-2585703 TGGGTGGGTGATTGGGTGGGTGG + Intergenic
986020272 5:3795148-3795170 TGGGTGGGTGGCTGAGTGGCTGG + Intergenic
986020273 5:3795156-3795178 TGGCTGAGTGGCTGGCTGCCTGG + Intergenic
986020282 5:3795184-3795206 TGGGTGGGTGAATGGGTGGATGG + Intergenic
986020476 5:3796842-3796864 AGGGTGGCTGGCTGGCTGGCTGG + Intergenic
986020487 5:3796893-3796915 TGGATGGGTGAATGGCTGGATGG + Intergenic
986020498 5:3796922-3796944 TGGGTGGGTGGTTGGCTGGCTGG + Intergenic
986020520 5:3797021-3797043 TGGGTGCATGGCTGGCTGGATGG + Intergenic
986020530 5:3797072-3797094 TGGATGAGTGAATGGCTGGATGG + Intergenic
986176432 5:5355961-5355983 TGAATGAGTGGCTGGCTGGATGG + Intergenic
986237444 5:5925474-5925496 TGAGTGGGTTTCTGGCTGGCTGG - Intergenic
986361213 5:6980022-6980044 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
987067964 5:14308380-14308402 TGGGTGACTGAATGGATGGATGG - Intronic
987068075 5:14308927-14308949 TGGTTGGGTGACTGGGTGGATGG - Intronic
988443235 5:31256245-31256267 TGAGTGATTTACTGGCTGTCAGG + Intronic
989164141 5:38418253-38418275 TGGGTAAGTGGCTGCCTGGTGGG + Exonic
990165876 5:52992624-52992646 TGAGGGACTGACTGGGTGGCAGG - Intronic
990871772 5:60439755-60439777 TAGGTGAGAGACTGCATGGCCGG - Intronic
991538297 5:67697617-67697639 TGACAGAGTGACTGGCTGGGTGG - Intergenic
992069574 5:73136504-73136526 TGGGTGAGTGAGTAGGTCGCGGG + Intergenic
992830709 5:80590746-80590768 TGGGTGAATGACCGGGTGGAGGG + Intergenic
995138559 5:108706721-108706743 TGAATGAATGGCTGGCTGGCTGG + Intergenic
995589271 5:113682161-113682183 TGGGTGAGTGATTGGGTGAGTGG - Intergenic
997185496 5:131877767-131877789 TGGATGGGTGACTGGGGGGCAGG - Intronic
997231905 5:132251552-132251574 TGACTGAGTCACAGGCTGGCGGG - Intronic
997659712 5:135579695-135579717 TGTGTGAGTGTCTGGGTGGTGGG + Intergenic
998164518 5:139835345-139835367 TGGGTGAGTGAATGGATGGATGG - Intronic
998164544 5:139835555-139835577 TGGGTAAGTGAGTGGGTGGGTGG - Intronic
998407308 5:141881408-141881430 TGGGTCAGTGACGAGCTGGGTGG + Intergenic
998583060 5:143401362-143401384 TGGATGTGTGACTAGCTGGTAGG - Intronic
999304696 5:150511968-150511990 TGGGGGTGTGACTGGCTGGGAGG + Intronic
999451162 5:151679338-151679360 TGAGTGAGTGACTGGGTGGCAGG + Intronic
1000474960 5:161695624-161695646 TGGGTGAGTGATTGACTGTCAGG - Intronic
1001029257 5:168250069-168250091 TGGATGGCTGACTGGATGGCTGG + Intronic
1001029258 5:168250073-168250095 TGGCTGACTGGATGGCTGGCTGG + Intronic
1001029290 5:168250209-168250231 TGGGTGGGTGAATGGATGGATGG + Intronic
1001053565 5:168431459-168431481 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1001053566 5:168431463-168431485 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1001053567 5:168431467-168431489 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1001053568 5:168431471-168431493 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1001053569 5:168431475-168431497 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1001053570 5:168431479-168431501 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1001329822 5:170754320-170754342 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
1001329878 5:170754520-170754542 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1001329895 5:170754572-170754594 TGGGTGAGTGGGTGGGTGGGTGG + Intergenic
1001646329 5:173284717-173284739 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1001646356 5:173284840-173284862 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1001646415 5:173285114-173285136 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1001686462 5:173597883-173597905 TGGGTGGGTGAGTGGATGGAGGG - Intergenic
1001686494 5:173597967-173597989 TGGGTGGGTGAGTGGATGGAGGG - Intergenic
1001702805 5:173719830-173719852 AGCCTTAGTGACTGGCTGGCAGG - Intergenic
1001778488 5:174347308-174347330 TGGGTGGGTGAGTGGATGGATGG + Intergenic
1001833711 5:174811685-174811707 TGGGCGACTGGCTGGCTGGATGG - Intergenic
1001833712 5:174811689-174811711 TGGGTGGGCGACTGGCTGGCTGG - Intergenic
1001900132 5:175420404-175420426 TGGGTGAGTGTGTGGGTGGATGG - Intergenic
1002067633 5:176660104-176660126 TGGGTGGGTGACTGGATGAATGG - Intergenic
1002095549 5:176828778-176828800 TGGATGGGTGATTGGATGGCTGG + Intronic
1002095551 5:176828782-176828804 TGGGTGATTGGATGGCTGGGTGG + Intronic
1002917978 6:1544268-1544290 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1003459523 6:6317551-6317573 TGGGCAAGTGTCTGGCTTGCTGG + Intronic
1003667973 6:8129227-8129249 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1004314389 6:14573030-14573052 TGGGTGTTTTAGTGGCTGGCTGG - Intergenic
1004424849 6:15500356-15500378 TGTGTGAGTGAGTGGGTGGATGG + Intronic
1004585912 6:17000148-17000170 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1004585913 6:17000152-17000174 TGGTTGGCTGGCTGGCTGGCTGG - Intergenic
1004585915 6:17000160-17000182 TGGATGAATGGTTGGCTGGCTGG - Intergenic
1006287171 6:33105456-33105478 TGGGTGAGTGAATAGATGGATGG + Intergenic
1006299809 6:33187697-33187719 TGGGTGAATGACTGGTCGGATGG + Intronic
1006299840 6:33187856-33187878 TGGGTGAGTGAATAGCTGGATGG + Intronic
1006316498 6:33294957-33294979 GGGGTGAGTGACTAGCGGGGTGG - Exonic
1006505256 6:34485142-34485164 TTGGTGAGTCACTCGCTGGAGGG + Intronic
1007424261 6:41736505-41736527 TGGGTGGGTGGGTGGCGGGCCGG - Intergenic
1007847977 6:44776493-44776515 TGGCTGAGTGAGTGGATGGATGG + Intergenic
1008335498 6:50299381-50299403 TGGATGGCTGGCTGGCTGGCTGG + Intergenic
1008604926 6:53131102-53131124 TGGGTGAGAGGCAGGCAGGCAGG - Intronic
1008604927 6:53131106-53131128 TGGGTGGGTGAGAGGCAGGCAGG - Intronic
1009738258 6:67707489-67707511 TGGATGGATGTCTGGCTGGCTGG - Intergenic
1010186180 6:73146008-73146030 TGGGGGAGGGACTGGGTGGGAGG - Intronic
1010749925 6:79606522-79606544 TTGGTGCCTGGCTGGCTGGCTGG + Intergenic
1013254378 6:108369921-108369943 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1013254379 6:108369925-108369947 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1015226175 6:130859937-130859959 CGGGAGAGTGAATGGCTGGAGGG + Intronic
1015937116 6:138415305-138415327 TGAGTGACTCACTGTCTGGCTGG + Exonic
1017065784 6:150527875-150527897 TGGGTGAGGCAGTGGCTGACAGG + Intergenic
1017171857 6:151463577-151463599 GAGGTGACTGACTGGCTGGAAGG + Intronic
1017821675 6:158053693-158053715 TGGGTGGATGACTGGATGGATGG - Intronic
1017821696 6:158053769-158053791 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1017986394 6:159446465-159446487 TGTGTGAGTGTCTGGTTGTCTGG - Intergenic
1018027949 6:159820169-159820191 TGGGTGAGGTTCTGGCTTGCGGG + Intronic
1018610466 6:165643220-165643242 TAGGTGAGTGAGTGGGTGGGTGG + Intronic
1019103419 6:169650109-169650131 TGGATGAGTGAGTGGATGGATGG - Intronic
1019259859 7:75727-75749 TGGGGGAGTGTCTGTCTGCCGGG - Intergenic
1019399269 7:842273-842295 TTGCTGCGTGACTGGCTGGTAGG + Intronic
1019510663 7:1415858-1415880 TGGGTGAGTGGGTGGGTGGATGG + Intergenic
1019510762 7:1416187-1416209 TGGGTGGGTGAGTGGATGGATGG + Intergenic
1019510764 7:1416191-1416213 TGGGTGAGTGGATGGATGGGTGG + Intergenic
1019542821 7:1559261-1559283 AGGGTGTGGGACTGGCTGGGCGG - Intronic
1019567245 7:1690386-1690408 TAGGTGAGTGGCTGGATGGGTGG + Intronic
1019625959 7:2015748-2015770 TGGGTGGGTGTCTGGAGGGCTGG - Intronic
1019676534 7:2316781-2316803 TGAGTGAGTGAGTGGGTGGGTGG - Intronic
1019704657 7:2491753-2491775 TGGGTGGGTGAGTGGGTGGGTGG - Intergenic
1019704720 7:2492048-2492070 TGGGTGAGTGGGTGGGTGGGTGG - Intergenic
1019704722 7:2492052-2492074 TGGGTGGGTGAGTGGGTGGGTGG - Intergenic
1019704737 7:2492107-2492129 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1019704794 7:2492374-2492396 TGGATGGATGGCTGGCTGGCAGG - Intergenic
1019704795 7:2492378-2492400 TGGGTGGATGGATGGCTGGCTGG - Intergenic
1019704797 7:2492386-2492408 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1019704798 7:2492390-2492412 TGGGTGGGTGAGTGGGTGGATGG - Intergenic
1019914652 7:4124995-4125017 TGGATGAGTGAATGGATGGATGG + Intronic
1019914672 7:4125093-4125115 TGGATGAGTGAATGGATGGATGG + Intronic
1019932017 7:4230109-4230131 TGGATGAGTGGGTGGCTGGTGGG + Intronic
1020110929 7:5447352-5447374 TGGGTGAGTGGATGGATGGATGG + Intronic
1020192346 7:6009618-6009640 TGAGTGAGTCCCTGGCCGGCCGG - Intronic
1022495942 7:30853203-30853225 TATGTGAGTGAAAGGCTGGCCGG - Intronic
1022531882 7:31071991-31072013 TGGGTGGGTGGCTGGATGGATGG - Intronic
1022531883 7:31071995-31072017 TGGGTGGGTGGGTGGCTGGATGG - Intronic
1022531884 7:31071999-31072021 TGGGTGGGTGGGTGGGTGGCTGG - Intronic
1023820379 7:43977368-43977390 TGGGTGAGTGGAGGGCTGCCTGG + Intergenic
1023956856 7:44893497-44893519 AGGGTCAGGGACAGGCTGGCAGG + Intergenic
1024338185 7:48230763-48230785 TGGATGAGTGAGTGGATGGATGG - Intronic
1024903951 7:54354593-54354615 TAGCCGTGTGACTGGCTGGCTGG + Intergenic
1024989716 7:55223673-55223695 TGGGTGGATGGCTGGCTGGATGG - Intronic
1024989717 7:55223677-55223699 TGGATGGGTGGATGGCTGGCTGG - Intronic
1025211597 7:57022247-57022269 TGGCTGGGTGACTGGGAGGCAGG - Intergenic
1025660359 7:63554580-63554602 TGGCTGGGTGACTGGGAGGCAGG + Intergenic
1026091361 7:67303038-67303060 TGGGTGAGTCCCTGGCCGGCCGG - Intergenic
1026319630 7:69257575-69257597 TAGATGATTGATTGGCTGGCTGG + Intergenic
1026319631 7:69257579-69257601 TGATTGATTGGCTGGCTGGCTGG + Intergenic
1026319644 7:69257645-69257667 TGGGTGAATGAGTGGATGGATGG + Intergenic
1026745061 7:73005434-73005456 TGGGTGAGCCCCTGGCCGGCCGG + Intergenic
1026873434 7:73866880-73866902 TGGGTGGGTGAATGGATGGGTGG - Intergenic
1026873473 7:73867044-73867066 TGGGTGGGTGAATGGATGGGTGG - Intergenic
1026903580 7:74050161-74050183 TGGGTGAGTGGATGGATGGATGG - Intronic
1027031173 7:74890129-74890151 TGGGTGAGCCCCTGGCCGGCCGG + Intergenic
1027163787 7:75820763-75820785 TGGGTGGGTGAATGGATGGATGG - Intronic
1027459454 7:78434892-78434914 TGAGGGAGTTGCTGGCTGGCTGG + Intronic
1027839036 7:83283907-83283929 TGGGTGAGTGAGTGAGTGACTGG - Intergenic
1029117043 7:98242892-98242914 TGGGTGGGTGAGTGGGTGGGTGG - Intronic
1029218151 7:98967215-98967237 TGGCTGCATGGCTGGCTGGCCGG - Intronic
1029623172 7:101702650-101702672 AGGGTTAGTGACTGGCTTGCTGG + Intergenic
1029748663 7:102530889-102530911 TGGGTGAGTGGAGGGCTGCCTGG + Intergenic
1029766610 7:102629973-102629995 TGGGTGAGTGGAGGGCTGCCTGG + Intronic
1029807150 7:103009767-103009789 GGGTTGAGTGGCTGGCTGGCTGG - Intronic
1030555044 7:111013456-111013478 TGGGTGACTGCCTGGATGGGAGG + Intronic
1031356753 7:120796796-120796818 TGGGTGGGTGAGTGGGTGGATGG - Intronic
1031865550 7:127035404-127035426 TGATTGATTGACTGGCTGGTTGG + Intronic
1031922543 7:127612544-127612566 TGGGTGGGTGACTGGCTGGCTGG + Intronic
1031922544 7:127612548-127612570 TGGGTGACTGGCTGGCTGGATGG + Intronic
1032077056 7:128840968-128840990 TGGGTAAGTGGCTGGGGGGCAGG + Exonic
1032192121 7:129771353-129771375 TGGGTAAGTGACTGGCGGTCTGG - Intergenic
1032891356 7:136199071-136199093 TGGGTGAGTGAGAGGCTGCCTGG + Intergenic
1033264457 7:139872858-139872880 TGGGTGAGTGAATGGATGACAGG - Intronic
1033555347 7:142484149-142484171 GGGCAGAGTCACTGGCTGGCAGG + Intergenic
1033557507 7:142501650-142501672 GGGCAGAGTCACTGGCTGGCAGG + Intergenic
1033559951 7:142521687-142521709 GGGCAGAGTCACTGGCTGGCAGG + Intergenic
1034270494 7:149801302-149801324 TAGGTGAGTGAATGGATGGATGG - Intergenic
1034344713 7:150379269-150379291 CGGGTGCCTGATTGGCTGGCGGG - Intronic
1034845821 7:154443537-154443559 TGGATGAGTGAATGGATGGACGG + Intronic
1034939328 7:155220276-155220298 TGGCTGAGTGAATGGAGGGCTGG - Intergenic
1035058823 7:156054081-156054103 TGGGTGAGTGGATGGATGGATGG - Intergenic
1035318551 7:158013711-158013733 TGAGTGGGTGGCTGGCTGGATGG - Intronic
1035318552 7:158013715-158013737 TGGATGAGTGGGTGGCTGGCTGG - Intronic
1035318553 7:158013719-158013741 TGGGTGGATGAGTGGGTGGCTGG - Intronic
1035318578 7:158013800-158013822 TGGGTGAGTGGGTGGGTGGATGG - Intronic
1035318593 7:158013844-158013866 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1035318595 7:158013848-158013870 TGGGTGGGTGAGTGGGTGGGTGG - Intronic
1035318614 7:158013924-158013946 TGGGTGGGTGATTGGATGGATGG - Intronic
1035318631 7:158014012-158014034 TGGATGGGTGGCTGGCTGGATGG - Intronic
1035318638 7:158014036-158014058 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1035318640 7:158014040-158014062 TGGGTGGGTGAGTGGGTGGGTGG - Intronic
1035318659 7:158014116-158014138 TGGGTGGGTGATTGGATGGATGG - Intronic
1035330321 7:158092403-158092425 TGGGTGGATGGCTGGCTGGATGG + Intronic
1035521484 8:277933-277955 TGGGAGAGGCACTGGCTGTCGGG - Intergenic
1035673317 8:1436717-1436739 TGGGTGAGTGAATGGGTGAGTGG - Intergenic
1038077379 8:24091563-24091585 TGTGTGTGTGGCTGGCTGGCCGG + Intergenic
1038485387 8:27931433-27931455 GGGGTGAGGCACTGGGTGGCTGG - Intronic
1038493229 8:27984544-27984566 TGGGTGAATGAATGGATGGATGG - Intronic
1038493243 8:27984624-27984646 TGGGTGAATGAATGGATGGATGG - Intronic
1039516157 8:38135554-38135576 TGGGTGAGTGACTAGCAGTCTGG + Intronic
1039602384 8:38851033-38851055 TGGGTAGGTCACTGGCTGGAAGG - Exonic
1039782506 8:40799056-40799078 TGGCTGGTTGGCTGGCTGGCTGG + Intronic
1039782507 8:40799060-40799082 TGGTTGGCTGGCTGGCTGGCTGG + Intronic
1040518122 8:48150923-48150945 TGGGTGAGTGACAGACAGGTGGG + Intergenic
1040584530 8:48726909-48726931 TGGGTGGGTGAATGGATGGGTGG - Intronic
1040731645 8:50454543-50454565 TGTCTGAGTGGCTGGGTGGCAGG + Intronic
1042104182 8:65307211-65307233 TGGGGGAGGGACTGGGTGGGAGG - Intergenic
1042226477 8:66518827-66518849 AGGGTGAGAGACTAGCAGGCTGG - Intergenic
1045384512 8:101658382-101658404 TGGGTGAGTTACTTACTGACTGG + Intronic
1047208948 8:122825311-122825333 TGGCTTAGTGCCTGGCTGCCTGG + Intronic
1047500985 8:125441232-125441254 TGGGTGGGTGAATGGATGGATGG + Intergenic
1047657364 8:126992459-126992481 TGGGTGAGTGAATGGGTGGGTGG + Intergenic
1047694374 8:127388462-127388484 TGGGTGGAAGAGTGGCTGGCTGG + Intergenic
1047694375 8:127388466-127388488 TGGAAGAGTGGCTGGCTGGCTGG + Intergenic
1048568637 8:135630845-135630867 TGGGTGAGTGAGTGAGTGGGTGG + Intronic
1048979842 8:139697332-139697354 TGGGTGAGTGGATGGTTGGATGG + Intronic
1049017131 8:139928636-139928658 TGGGTGAGTGCGTGGCTGGGAGG + Intronic
1049087193 8:140487986-140488008 TGGGTGAGTCAGTGGCCTGCGGG + Intergenic
1049236563 8:141515162-141515184 TGGGTGAGTGAATGGATGGCTGG - Intronic
1049236571 8:141515198-141515220 TGGGTGGGTGAATGGGTGGGTGG - Intronic
1049348237 8:142150323-142150345 TGGGTGGGTGAATGGATGGGTGG + Intergenic
1049359851 8:142207271-142207293 TGGGTGGGTGAGTGGATGGATGG + Intergenic
1049371946 8:142272196-142272218 TGGGTGAGTGGCTGGGTGGATGG - Intronic
1049374986 8:142285162-142285184 TGGGTGAGTGGATGGATGGGTGG + Intronic
1049416108 8:142496083-142496105 TGGATGGGTGGGTGGCTGGCTGG + Intronic
1049416162 8:142496313-142496335 TGGATGGGTGGGTGGCTGGCTGG + Intronic
1049464948 8:142746835-142746857 TGGGTGAGTGGATGGATGGGTGG + Intergenic
1049464988 8:142747005-142747027 TGGATGAGTGAATGGATGGATGG + Intergenic
1049474796 8:142791879-142791901 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1049474901 8:142792579-142792601 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1049477091 8:142801842-142801864 TGGGTGGGTGAGTGGGTGGAAGG + Intergenic
1049554043 8:143273503-143273525 CGGGTGAGTGAGTGGCTGGCTGG + Intronic
1049567273 8:143347692-143347714 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1049567274 8:143347696-143347718 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1049567275 8:143347700-143347722 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1049567276 8:143347704-143347726 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1049567277 8:143347708-143347730 TGGCTGGCTGGCTGGCTGGCTGG - Intronic
1049582346 8:143418385-143418407 TGGATGAGTGAGTGGATGGGTGG - Intergenic
1051495135 9:17712851-17712873 TGGATGAGTGAGTGGGTGGGTGG - Intronic
1051865057 9:21670851-21670873 TGGGAGAGAGACAGACTGGCTGG - Intergenic
1052944724 9:34159118-34159140 GTGGTGAGTGACTGGTTGGTTGG - Intergenic
1053802992 9:41775811-41775833 TGGGTGGGTGAATGGATGGATGG - Intergenic
1054142270 9:61539311-61539333 TGGGTGGGTGAATGGATGGATGG + Intergenic
1054191282 9:61987121-61987143 TGGGTGGGTGAATGGATGGATGG - Intergenic
1054459177 9:65453489-65453511 TGGGTGAGTGAATGGATGGGTGG + Intergenic
1054462019 9:65470458-65470480 TGGGTGGGTGAATGGGTGGATGG + Intergenic
1054647086 9:67600596-67600618 TGGGTGGGTGAATGGATGGATGG + Intergenic
1055056609 9:72029953-72029975 TGGGCAAGTGATTGGCTGGTTGG - Intergenic
1055056616 9:72029981-72030003 TGGGTGAGTGGTTGGTTGGCTGG - Intergenic
1055173319 9:73287372-73287394 TGGTTGAGTAACTGGTTGGGAGG + Intergenic
1055582472 9:77721681-77721703 TGGGTGGGTGCCTGGGTGGGTGG - Intronic
1055641229 9:78320368-78320390 TGGGTGGGTGAATGGATGGATGG - Intronic
1055964747 9:81854920-81854942 TGGGTGAGTGAGTGGGTGAGTGG + Intergenic
1056303348 9:85264811-85264833 TATTTGAGTGACTGACTGGCTGG - Intergenic
1056303365 9:85265191-85265213 TATATGACTGACTGGCTGGCTGG - Intergenic
1056776887 9:89519411-89519433 TGGGTGAGTCACCGGATGGCTGG + Intergenic
1057008698 9:91583212-91583234 TGGGTGGATGACTGGATGGATGG + Intronic
1057213074 9:93211412-93211434 TGGGTGAGTGAATGAGTGGTGGG - Intronic
1057309999 9:93936531-93936553 TATCTGACTGACTGGCTGGCTGG - Intergenic
1057310003 9:93936647-93936669 TGACTGAGTGACTGACTGACTGG - Intergenic
1057310010 9:93936771-93936793 TGACTGACTGACTGACTGGCTGG - Intergenic
1057310011 9:93936775-93936797 TGGCTGACTGACTGACTGACTGG - Intergenic
1057434823 9:95030190-95030212 TGGTTGAGTGACTGGATTACTGG - Intronic
1058435668 9:104960926-104960948 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1058435669 9:104960930-104960952 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1058886097 9:109322059-109322081 TGTGTGCATGACTGGCAGGCAGG + Intergenic
1059409080 9:114120776-114120798 TGGGTAGATGGCTGGCTGGCTGG + Intergenic
1059454320 9:114390033-114390055 TGAGTGAGTGACAGGGTGTCAGG - Intronic
1059566905 9:115391654-115391676 TGAGTGCATGACTCGCTGGCTGG - Intronic
1060883285 9:127133553-127133575 TGGGTGAGTGGGTGGCAGGGTGG - Intronic
1060889128 9:127177181-127177203 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1060995459 9:127873006-127873028 TGGGTGAGTTGCGGGCAGGCGGG - Exonic
1061159233 9:128883574-128883596 GGGATGAGTGACTGGGTGGCTGG + Intronic
1061256617 9:129457207-129457229 TGGGTGAGTGGATGGATGGGTGG + Intergenic
1061285251 9:129619101-129619123 TGGGTGAGTGAATGTATGGATGG + Intronic
1061288589 9:129638265-129638287 TGGGTGAGGGACTCGTGGGCTGG + Exonic
1061387601 9:130299707-130299729 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1061387613 9:130299743-130299765 TAGGTGAGTGAATGGGTGGGTGG - Intronic
1061387631 9:130299839-130299861 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1061387638 9:130299863-130299885 TGGGTGAGTGAATGGGTGGGTGG - Intronic
1061387658 9:130299959-130299981 TGGGTGAGTGAGCGGGTGGGTGG - Intronic
1061402100 9:130373977-130373999 TGGGTGGGTGAATGGGTGGATGG + Intronic
1061584498 9:131557151-131557173 TGGGTGAGTGGATGGATGGATGG - Intergenic
1061643542 9:131979832-131979854 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1061643543 9:131979836-131979858 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1061643544 9:131979840-131979862 TGGCTGGCTGGCTGGCTGGCTGG + Intronic
1061715985 9:132519177-132519199 TGGGTGAATGAATGGATGGATGG + Intronic
1061716009 9:132519257-132519279 TGGATGAGTGAGTGGGTGGGTGG + Intronic
1061716023 9:132519313-132519335 TGGGTGAATGAATGGATGGATGG + Intronic
1061846724 9:133392468-133392490 TGGGTGGGTGAGTGGATGGATGG + Intronic
1061846739 9:133392524-133392546 TGGGTGGGTGAGTGGATGGATGG + Intronic
1061846740 9:133392528-133392550 TGGGTGAGTGGATGGATGGATGG + Intronic
1061846769 9:133392644-133392666 TGGGTGGGTGAGTGGATGGGTGG + Intronic
1061846771 9:133392648-133392670 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061846798 9:133392756-133392778 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061846807 9:133392784-133392806 TGGGTGGGTGAGTGGATGGATGG + Intronic
1061846808 9:133392788-133392810 TGGGTGAGTGGATGGATGGATGG + Intronic
1061846823 9:133392840-133392862 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061847028 9:133393634-133393656 TGGGTGAGTGGATGGGTGGGTGG + Intronic
1061932134 9:133838680-133838702 TGGCTGAGTGGCTAGCTGGGTGG + Intronic
1061934837 9:133851725-133851747 TGGGTGAATGAATGGGTGGATGG + Intronic
1061938306 9:133870889-133870911 TGGGTGAGTGCGTGGGTGGGTGG + Intronic
1061938380 9:133871181-133871203 TGGGTGGATGAATGGATGGCTGG + Intronic
1061938381 9:133871185-133871207 TGGATGAATGGATGGCTGGCTGG + Intronic
1062051979 9:134452118-134452140 TGGGTGAGTGAATGGGTGGATGG - Intergenic
1062051997 9:134452190-134452212 TGGGTGAGTGAATGGGTGGTTGG - Intergenic
1062089687 9:134668987-134669009 TGGGTGAGTGGGTGGGTGGGTGG - Intronic
1062100699 9:134726924-134726946 TGGGTGGGTGAATGGATGGAAGG + Intronic
1062112622 9:134790410-134790432 TGGGTGGGTGGCTGGATGGCTGG - Intronic
1062112630 9:134790434-134790456 TGGGTGAGTGGGTGGATGGATGG - Intronic
1062112636 9:134790454-134790476 TGGGTGGGTGGCTGGATGGATGG - Intronic
1062112637 9:134790458-134790480 TGGGTGGGTGGGTGGCTGGATGG - Intronic
1062148491 9:135004726-135004748 TGGATGAGTGAATGGATGGATGG + Intergenic
1062201246 9:135303974-135303996 TGGATGAGTGAATGGTTGGATGG + Intergenic
1062205434 9:135334182-135334204 TGGGTGGGTGATTGGATGGACGG + Intergenic
1062247708 9:135577993-135578015 TGGGTGAGTGGATGGGTGGGTGG - Intergenic
1062247732 9:135578084-135578106 TGGGTGATTGAGTGGATGGATGG - Intergenic
1062247775 9:135578327-135578349 TGGGTGGGTGAGTGGGTGGCAGG - Intergenic
1062247844 9:135578673-135578695 TGGGTGGGTGAGTGGGTGGCAGG - Intergenic
1062520767 9:136956990-136957012 TGGGTGGGTGGGTGGATGGCTGG + Intronic
1062520768 9:136956994-136957016 TGGGTGGGTGGATGGCTGGTTGG + Intronic
1062538293 9:137030432-137030454 TGGGTGGGTGAAGGCCTGGCTGG - Exonic
1062649740 9:137569434-137569456 TGAGTGACTGGCTGGCTGGATGG - Intronic
1062649741 9:137569438-137569460 TGGGTGAGTGACTGGCTGGCTGG - Intronic
1062649785 9:137569599-137569621 TGGGTGAGTGGCTGGCTGGCTGG - Intronic
1062649786 9:137569603-137569625 ATGGTGGGTGAGTGGCTGGCTGG - Intronic
1062649861 9:137569901-137569923 TGGGTGAGTGGATGGATGGTGGG - Intronic
1062744841 9:138204732-138204754 TGGGGGAGTGTCTGTCTGCCGGG + Intergenic
1185495147 X:549152-549174 TGGGTGAGTGGGTGGATGGATGG - Intergenic
1185495307 X:550067-550089 TGGGTGAGTGGGTGGGTGGATGG - Intergenic
1185497292 X:565250-565272 TGGATGAGTGAATGGATGGATGG + Intergenic
1185497498 X:566396-566418 TGGGTGAATGAGTGGATGGATGG + Intergenic
1185497562 X:566713-566735 TAGGTGAATGAGTGGATGGCTGG + Intergenic
1185547114 X:954469-954491 TGGGTAGGTGGCTGGCTGGCTGG - Intergenic
1185583149 X:1226427-1226449 TGGGTGGGTGAATGGATGGATGG + Intergenic
1185583217 X:1226706-1226728 TGGGTGAGTGGGTGGATGGATGG + Intergenic
1185583266 X:1226938-1226960 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1185583307 X:1227122-1227144 TGGGTGAGTGGATGGGTGGGTGG + Intergenic
1185583318 X:1227170-1227192 TGGGTGAGTGGATGGATGGGTGG + Intergenic
1185616155 X:1423540-1423562 TGGGTGAGTGGGTGGATGGATGG - Intronic
1185616156 X:1423544-1423566 TGGGTGGGTGAGTGGGTGGATGG - Intronic
1185616262 X:1423990-1424012 TGGATGAGTGATTGGATGGGTGG - Intronic
1185616299 X:1424144-1424166 TGGATGAGTGATTGGATGGGTGG - Intronic
1185616405 X:1424580-1424602 TGGGTGAGTGGATGGGTGGCTGG - Intronic
1185624438 X:1472572-1472594 TGGGTGAGTGGGTGGATGGCTGG + Intronic
1185624552 X:1473034-1473056 TGGGTGAGTGGGTGGGTGGATGG + Intronic
1185624630 X:1473366-1473388 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1185624735 X:1473809-1473831 TGGGTGAGTGGGTGGGTGGGTGG + Intronic
1185639166 X:1577218-1577240 TGGATGGGTGACTGGATGGATGG + Intergenic
1185639177 X:1577258-1577280 TGGGTGGGTGAATGGATGGTTGG + Intergenic
1185639190 X:1577314-1577336 TGGATGGGTGACTGGATGGATGG + Intergenic
1185639220 X:1577470-1577492 TGGGTGGGTGAATGGATGGATGG + Intergenic
1185639272 X:1577717-1577739 TGGATGGGTGACTGGATGGATGG + Intergenic
1185689237 X:2139576-2139598 TGGATGGGTGGCTGGCTGTCCGG - Intergenic
1185755475 X:2650000-2650022 TGGATGAGTGAATGGCTGAGTGG + Intergenic
1185759728 X:2681192-2681214 TGGGTGAGTGGATGGATGGGTGG - Intergenic
1185759730 X:2681196-2681218 TGGGTGGGTGAGTGGATGGATGG - Intergenic
1185883201 X:3758907-3758929 TGGTTGGCTGGCTGGCTGGCTGG - Intergenic
1185883202 X:3758911-3758933 TGGCTGGTTGGCTGGCTGGCTGG - Intergenic
1185883203 X:3758915-3758937 TGGGTGGCTGGTTGGCTGGCTGG - Intergenic
1185883204 X:3758919-3758941 TGGTTGGGTGGCTGGTTGGCTGG - Intergenic
1185883270 X:3759252-3759274 TGGGTGAGTGGATGGGTGGCTGG - Intergenic
1185883289 X:3759346-3759368 TGGGTTAGTGAATGGATGGATGG - Intergenic
1185883295 X:3759379-3759401 TGGGTGAGTGGATGGGTGGGTGG - Intergenic
1185883359 X:3759777-3759799 TGGCTGGCTGGCTGGCTGGCTGG - Intergenic
1186447560 X:9644568-9644590 TGGGTTAATTAGTGGCTGGCTGG - Intronic
1186508870 X:10115946-10115968 TGGGTGGGTGGCTAGATGGCTGG - Intronic
1186508872 X:10115958-10115980 TGGGTGGGTGGCTGGGTGGGTGG - Intronic
1186508893 X:10116014-10116036 TGGGTTGGTGGATGGCTGGCTGG - Intronic
1186508900 X:10116038-10116060 TGGGTGGGTGGCTGGATGGGTGG - Intronic
1186508908 X:10116058-10116080 TGGATGGGTGGCTGGGTGGCTGG - Intronic
1186508912 X:10116070-10116092 TGGGTGGGTGGCTGGATGGGTGG - Intronic
1186508914 X:10116074-10116096 TGGGTGGGTGGGTGGCTGGATGG - Intronic
1186508920 X:10116090-10116112 TGGGTGGGTGGCTGGATGGGTGG - Intronic
1186508926 X:10116106-10116128 TGGGTGGGTGGCTGGATGGGTGG - Intronic
1188008590 X:25035657-25035679 TGGCAGAGTGGCTGGCTGGAAGG + Intergenic
1189491503 X:41474489-41474511 TGGCTGAGGGACTGGATGGAGGG + Exonic
1189686155 X:43565367-43565389 TGGATGAGTGGGTGGCTGGGGGG + Intergenic
1190245390 X:48687358-48687380 TGGGTGAGTGGATGGGTGGATGG + Intronic
1190432861 X:50394413-50394435 TTGGTGCATGACTGGCTAGCTGG - Intronic
1192235664 X:69294063-69294085 GGGGAGACAGACTGGCTGGCAGG + Intergenic
1192706261 X:73530592-73530614 TGGGTGTGTGATTGGTTGCCAGG - Intergenic
1194265324 X:91746029-91746051 TGGGCGAGTGACTGGGAGGTGGG - Intergenic
1195672833 X:107483986-107484008 AGGGTGAGTGAGTGTCTGGTGGG - Intergenic
1196018494 X:110964856-110964878 TGGCTGACTGACTGACTGGCTGG + Intronic
1196144140 X:112298013-112298035 TGGTTGGTTGATTGGCTGGCTGG + Intergenic
1196144141 X:112298017-112298039 TGGTTGATTGGCTGGCTGGTTGG + Intergenic
1196653211 X:118189846-118189868 TGTTTGAGTAGCTGGCTGGCTGG + Intergenic
1197751664 X:129968262-129968284 TTGTTGAGTGAGTGTCTGGCAGG + Intergenic
1197770042 X:130083801-130083823 TGGGTGGGTGGGTGGATGGCTGG + Intronic
1197770043 X:130083805-130083827 TGGGTGGGTGGATGGCTGGATGG + Intronic
1197809946 X:130432399-130432421 TGAGTAACTGAATGGCTGGCTGG - Intergenic
1198102717 X:133436061-133436083 TGGCTGGTTGGCTGGCTGGCTGG + Intergenic
1199069059 X:143455247-143455269 TGGCTGGCTGGCTGGCTGGCTGG + Intergenic
1200216276 X:154369472-154369494 TGGGAGACTGTCTGGCTGGATGG + Intronic
1200582475 Y:4966491-4966513 TGGGCGAGTGACTGGGAGGTGGG - Intergenic
1200781580 Y:7221109-7221131 TGGATGAGTGAGTGGATGGATGG + Intergenic
1201144716 Y:11057968-11057990 TGGGTGAATGAGTGGATGGAGGG + Intergenic
1201540193 Y:15097732-15097754 TGGGTGAGTCAGTGGCTGAGCGG + Intergenic
1202359958 Y:24097239-24097261 TGGCTGCCTGGCTGGCTGGCTGG - Intergenic
1202359959 Y:24097243-24097265 TGGCTGGCTGCCTGGCTGGCTGG - Intergenic
1202510818 Y:25572871-25572893 TGGCTGGCTGCCTGGCTGGCTGG + Intergenic
1202510819 Y:25572875-25572897 TGGCTGCCTGGCTGGCTGGCTGG + Intergenic