ID: 1062650579

View in Genome Browser
Species Human (GRCh38)
Location 9:137574760-137574782
Sequence TTTCCCAGTGGACCAATCTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 87}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062650568_1062650579 9 Left 1062650568 9:137574728-137574750 CCCCTGACCAAGCCTGGCCCTTA 0: 1
1: 0
2: 1
3: 25
4: 182
Right 1062650579 9:137574760-137574782 TTTCCCAGTGGACCAATCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 87
1062650570_1062650579 7 Left 1062650570 9:137574730-137574752 CCTGACCAAGCCTGGCCCTTACC 0: 1
1: 0
2: 2
3: 17
4: 239
Right 1062650579 9:137574760-137574782 TTTCCCAGTGGACCAATCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 87
1062650574_1062650579 -9 Left 1062650574 9:137574746-137574768 CCTTACCTTCCAGTTTTCCCAGT 0: 1
1: 0
2: 1
3: 25
4: 373
Right 1062650579 9:137574760-137574782 TTTCCCAGTGGACCAATCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 87
1062650572_1062650579 -3 Left 1062650572 9:137574740-137574762 CCTGGCCCTTACCTTCCAGTTTT 0: 1
1: 0
2: 7
3: 30
4: 326
Right 1062650579 9:137574760-137574782 TTTCCCAGTGGACCAATCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 87
1062650569_1062650579 8 Left 1062650569 9:137574729-137574751 CCCTGACCAAGCCTGGCCCTTAC 0: 1
1: 0
2: 0
3: 10
4: 211
Right 1062650579 9:137574760-137574782 TTTCCCAGTGGACCAATCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 87
1062650571_1062650579 2 Left 1062650571 9:137574735-137574757 CCAAGCCTGGCCCTTACCTTCCA 0: 1
1: 0
2: 5
3: 57
4: 487
Right 1062650579 9:137574760-137574782 TTTCCCAGTGGACCAATCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 87
1062650573_1062650579 -8 Left 1062650573 9:137574745-137574767 CCCTTACCTTCCAGTTTTCCCAG 0: 1
1: 0
2: 2
3: 33
4: 371
Right 1062650579 9:137574760-137574782 TTTCCCAGTGGACCAATCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062650579 Original CRISPR TTTCCCAGTGGACCAATCTA GGG Exonic
902488982 1:16766754-16766776 TTTCAGAGTGGGACAATCTACGG - Intronic
906245112 1:44267877-44267899 TTTCCAAGTAGGGCAATCTAGGG + Intronic
906299674 1:44672918-44672940 TTTCACAGTGGAGGAATCTCAGG + Intronic
911410831 1:97504382-97504404 TTTTCCTGTGGACCAATTAAGGG + Intronic
911887066 1:103316253-103316275 TTTCCCAGTGGATCACTCTCTGG + Intergenic
920615951 1:207492738-207492760 TTTCCCAGTGGAAAAATCTAGGG + Intergenic
920793425 1:209114646-209114668 TTTCCAACTGTACCACTCTATGG - Intergenic
921536993 1:216363321-216363343 TTTCCCATAGGGCCAATGTAAGG - Intronic
922376576 1:224974325-224974347 TTTTGCAGTGTACCATTCTATGG + Intronic
923271200 1:232356720-232356742 TTTTCGAGTGGACCAAAGTATGG - Intergenic
923531454 1:234815770-234815792 TTTCACAGTGGGACAATCTATGG + Intergenic
1070219786 10:74428431-74428453 TTCCCCACTGGTCAAATCTAGGG + Intronic
1070734799 10:78856126-78856148 TTTTCCAGTGGATCCATCTGGGG - Intergenic
1072047031 10:91667204-91667226 TTTCCCAGAGGAGCCATCCAGGG + Intergenic
1076138435 10:128060931-128060953 TTTTCCAGATGACCATTCTAGGG + Exonic
1076942767 10:133620877-133620899 TTTCCCAGTTGAATAATCCAGGG - Intergenic
1078439717 11:11354289-11354311 TTTCCCAGGTGAGCAAACTAAGG + Intronic
1081691446 11:45081114-45081136 TTTGGAAGTGGACCCATCTAGGG + Intergenic
1081707384 11:45191574-45191596 GTTCCCACTGGCCAAATCTAGGG - Intronic
1081776318 11:45678192-45678214 TTTCCCAGAAGACCAAACTCAGG + Intergenic
1085115889 11:73931331-73931353 TTTCACAGTGGACAAGGCTATGG - Intergenic
1085424535 11:76392137-76392159 TTTCCCAGAGGACAGAGCTAAGG + Intronic
1088586762 11:111366633-111366655 TTTCCCAGGGGACCTGCCTATGG - Intronic
1092800480 12:12160555-12160577 TTGCCCAGTGGACACATCAAGGG - Intronic
1098536001 12:71594207-71594229 TGTCTCAGTGGACAAATCTGCGG - Intergenic
1105950181 13:25223264-25223286 TTTACCAATGACCCAATCTAAGG - Intergenic
1106203916 13:27571117-27571139 TTTCCCAAAGGTTCAATCTATGG - Intronic
1106234759 13:27852457-27852479 TTTGCCACTGGCCCCATCTAAGG - Intergenic
1110909588 13:80939842-80939864 GGTCCCAGTGGACCAATTTTGGG + Intergenic
1113257773 13:108525686-108525708 TTCCTCAGTGGACCACTCTCTGG + Intergenic
1114810680 14:25895296-25895318 TTTCCCAGTGGCCCAATGAAGGG + Intergenic
1115880156 14:37906999-37907021 TCTCCCAATGGACAAATCTAAGG + Intronic
1123509975 15:20988442-20988464 TTTCCAAGTGGACTCATCTAGGG + Intergenic
1123567191 15:21562188-21562210 TTTCCAAGTGGACTCATCTAGGG + Intergenic
1123603454 15:21999481-21999503 TTTCCAAGTGGACTCATCTAGGG + Intergenic
1124050133 15:26189505-26189527 TTTCCCTGTGGACCTCTCTGGGG + Intergenic
1130226442 15:82062110-82062132 TTTCCCAGTGGAAGAAACTGAGG - Intergenic
1202975555 15_KI270727v1_random:289282-289304 TTTCCAAGTGGACTCATCTAGGG + Intergenic
1140890911 16:79284380-79284402 TTACCCAGTGGAACCCTCTAAGG - Intergenic
1143703374 17:8678799-8678821 TTTCCTAGTGGACCAGCCTGGGG - Intergenic
1150072851 17:62167445-62167467 CTTCCCAGTTTTCCAATCTAAGG + Intergenic
1157713272 18:49864456-49864478 TTTCCCAGTGGACAAAAGAAGGG - Intronic
1159644154 18:70897817-70897839 TTTAACTGAGGACCAATCTAAGG - Intergenic
927196569 2:20551797-20551819 TGCCACAGTGGACCCATCTATGG + Intergenic
938630000 2:133156152-133156174 TTTCCCATTGGACTACTCTTTGG + Intronic
944972145 2:205005283-205005305 TTTCCCAGTGTAACAAACTTTGG - Intronic
945179244 2:207075048-207075070 TTCCCCAGTGAAACAAGCTAAGG + Exonic
945929884 2:215844152-215844174 TTTCACAGTGGATCATTTTAGGG - Intergenic
946326454 2:218986914-218986936 GTTCCCTGTGGACCAAACTCAGG + Intergenic
947759640 2:232594474-232594496 TGTCTCAGAGGACAAATCTAGGG - Intergenic
1178597816 21:33970695-33970717 CTTCCCAGTTTACCATTCTAGGG + Intergenic
1181925557 22:26355816-26355838 AGTCCCAGGGGACCAAACTATGG - Intronic
1182433134 22:30312489-30312511 TGACCCAGTGGCCCAGTCTAGGG - Intronic
1183687395 22:39368982-39369004 TTTTACAGAGGACCAATCTGAGG + Intronic
953081905 3:39628815-39628837 TTGCCCAGAGGACCATTCTTGGG - Intergenic
955005519 3:54965216-54965238 TTCACCATTGGACCAATCTCTGG + Intronic
955199825 3:56841159-56841181 TGTCACAGTGGGCAAATCTAGGG - Intronic
955616466 3:60812894-60812916 TTTGCCAGTGGAAGAATCTATGG - Intronic
956216990 3:66859001-66859023 AATCCCAGTGGACCCATGTAAGG - Intergenic
956696615 3:71923985-71924007 TGCCCCAGTGGCACAATCTAAGG + Intergenic
956731342 3:72199446-72199468 TTTCCCACTGGACCACTATTTGG - Intergenic
960336934 3:116428836-116428858 ATTCCCAGTGGAAACATCTATGG - Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
967777863 3:193402985-193403007 TTGACCACTGGACCAATCTAAGG + Intronic
968035033 3:195541216-195541238 TTTCCCGTGGGCCCAATCTATGG - Intronic
970070137 4:12148873-12148895 TTTCCCAGTTGACCCAGCTAAGG - Intergenic
970316043 4:14829118-14829140 TTTCCCTGTAGACAAATGTAAGG - Intergenic
971736795 4:30463933-30463955 TTTCCCAGTGGCCCCATTTGTGG + Intergenic
979836352 4:125372770-125372792 TTTCTCACTGGACCATTGTAAGG - Intronic
984035071 4:174657079-174657101 TTTCCCAGGGTACCAATCACTGG + Intronic
986925455 5:12743254-12743276 TTTCCCTGTGGACAGACCTAGGG - Intergenic
992165541 5:74046959-74046981 TTTCCCAGAGCACCAAACAAAGG - Intergenic
992446516 5:76839147-76839169 TCTACCAGTGGGTCAATCTATGG + Intergenic
992465382 5:76999065-76999087 TTGCCCCGTGGACCACTCCAGGG - Intergenic
995448583 5:112274596-112274618 TTTCCCAGTGAACCCATATTAGG - Intronic
995778193 5:115747893-115747915 TTGCTCAGTGTCCCAATCTAAGG + Intergenic
998267020 5:140673850-140673872 TTCCCCAGCAGACCAATGTAGGG - Exonic
999492691 5:152067015-152067037 TTGCCCAGGGGACTAATGTAGGG + Intergenic
1002269129 5:178058192-178058214 CTTCCCAGTTGAACAATCCAGGG - Intergenic
1002967943 6:1985999-1986021 TATGCCAGTGTACCAAGCTAAGG - Intronic
1004716662 6:18222911-18222933 TTTTCCAGTGGACCTGCCTATGG - Exonic
1011285749 6:85720632-85720654 TTACCCAGTAGACTAAACTATGG - Intergenic
1014206205 6:118658005-118658027 TTACCCAGTGGAAGAATGTAGGG + Intronic
1016360531 6:143262765-143262787 TTTCCCAAAGGGCCAATCCAGGG + Intronic
1019095683 6:169577384-169577406 TTTCCCTGTGGGCGAATCTGTGG - Intronic
1020459706 7:8415057-8415079 TTTTCCAGAAGACCTATCTAAGG + Intergenic
1020509411 7:9034592-9034614 TTTCCCTGAGGAAGAATCTAAGG - Intergenic
1020769464 7:12369950-12369972 TTTCCCAGAGGACCATGCTGAGG - Exonic
1022037396 7:26547597-26547619 TTTACCAGTACACCATTCTAAGG - Intergenic
1023597088 7:41841837-41841859 TTCACCAGTGAACCCATCTAGGG + Intergenic
1024311771 7:47975989-47976011 ATTCCCCCTGGACCAATATAGGG - Intronic
1040788507 8:51196224-51196246 TTTCCCTGTGGACAACTTTATGG + Intergenic
1049049121 8:140179191-140179213 TTTCCCAGTGTAAGCATCTATGG + Intronic
1052728578 9:32259749-32259771 TTTCCTAGAAGACAAATCTAGGG - Intergenic
1055392054 9:75833484-75833506 TTTCCCATTGGACAAAGCAAAGG - Intergenic
1055579129 9:77689726-77689748 TTGCCCAGTGAAACAATCTGGGG + Intergenic
1059783616 9:117556305-117556327 TATCCCTGTGGATCAAGCTAAGG - Intergenic
1060734188 9:126055858-126055880 TTGCCCAGTGCACTACTCTAAGG + Intergenic
1062650579 9:137574760-137574782 TTTCCCAGTGGACCAATCTAGGG + Exonic
1062729164 9:138099027-138099049 TTTCCCAGGGGACCACTCTATGG + Intronic
1197529546 X:127606147-127606169 TTTCCCATTGGAACAAGCCAAGG + Intergenic