ID: 1062650783

View in Genome Browser
Species Human (GRCh38)
Location 9:137576076-137576098
Sequence TGACCTCAGATTCCACCAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 180}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062650780_1062650783 0 Left 1062650780 9:137576053-137576075 CCCACAGAACAAGTGCAAGTCAC 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG 0: 1
1: 0
2: 1
3: 19
4: 180
1062650773_1062650783 30 Left 1062650773 9:137576023-137576045 CCCAACCCTCTCTATTCAGGTCC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG 0: 1
1: 0
2: 1
3: 19
4: 180
1062650774_1062650783 29 Left 1062650774 9:137576024-137576046 CCAACCCTCTCTATTCAGGTCCC 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG 0: 1
1: 0
2: 1
3: 19
4: 180
1062650781_1062650783 -1 Left 1062650781 9:137576054-137576076 CCACAGAACAAGTGCAAGTCACT 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG 0: 1
1: 0
2: 1
3: 19
4: 180
1062650777_1062650783 9 Left 1062650777 9:137576044-137576066 CCCTTCTGCCCCACAGAACAAGT 0: 1
1: 0
2: 1
3: 17
4: 223
Right 1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG 0: 1
1: 0
2: 1
3: 19
4: 180
1062650778_1062650783 8 Left 1062650778 9:137576045-137576067 CCTTCTGCCCCACAGAACAAGTG 0: 1
1: 0
2: 1
3: 41
4: 214
Right 1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG 0: 1
1: 0
2: 1
3: 19
4: 180
1062650779_1062650783 1 Left 1062650779 9:137576052-137576074 CCCCACAGAACAAGTGCAAGTCA 0: 1
1: 0
2: 0
3: 8
4: 166
Right 1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG 0: 1
1: 0
2: 1
3: 19
4: 180
1062650775_1062650783 25 Left 1062650775 9:137576028-137576050 CCCTCTCTATTCAGGTCCCTTCT 0: 1
1: 0
2: 1
3: 30
4: 295
Right 1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG 0: 1
1: 0
2: 1
3: 19
4: 180
1062650776_1062650783 24 Left 1062650776 9:137576029-137576051 CCTCTCTATTCAGGTCCCTTCTG 0: 1
1: 0
2: 1
3: 17
4: 234
Right 1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG 0: 1
1: 0
2: 1
3: 19
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062650783 Original CRISPR TGACCTCAGATTCCACCAGG CGG Exonic
900875695 1:5340978-5341000 TGACCAAAGATTCCAGCAGCTGG - Intergenic
902757167 1:18556563-18556585 TGAGCTGACATTCCAGCAGGGGG + Intergenic
903885578 1:26539223-26539245 TGAACTCAGATGCCATCAGCTGG - Intronic
905870172 1:41399065-41399087 TGACCCCAAATTCCGCCGGGTGG + Intergenic
906259812 1:44378365-44378387 GTGCCTCAGATACCACCAGGGGG + Intergenic
906550350 1:46661023-46661045 TGACCTATGATTCCACAATGTGG - Intronic
908096309 1:60742666-60742688 TGAGCACAGGTTACACCAGGAGG - Intergenic
913183413 1:116344583-116344605 TGGCCTCAGGTTTCACCAGATGG + Intergenic
917692292 1:177481984-177482006 AGATCTCAGATTCCAGCATGAGG - Intergenic
918251700 1:182708734-182708756 TGAGCTCTGATTCCCCCATGCGG - Intergenic
918524202 1:185447264-185447286 GGACCTCAGATGCTACCAGGTGG - Intergenic
920642281 1:207764110-207764132 AGACCTCAGATCCCCTCAGGTGG + Intronic
920844743 1:209584343-209584365 TGTCCACAGACTCCTCCAGGAGG - Intronic
921001801 1:211051607-211051629 TGACCTCAGCATCAGCCAGGAGG - Intronic
921653639 1:217708121-217708143 TAACCTCAGATTGCACCTGGAGG + Intronic
922234587 1:223713128-223713150 TGCCCTCAGATCCCACTAGCAGG + Intronic
922732491 1:227958378-227958400 TGTCCTCATCTTCCACCATGAGG - Intergenic
1063759676 10:9058659-9058681 TGAGTTCAGTTTCCTCCAGGAGG - Intergenic
1064322187 10:14315963-14315985 TGATCTCCAATTCTACCAGGTGG + Intronic
1066333612 10:34452765-34452787 TGATCTCAGTTTCCAACAAGAGG + Intronic
1066349511 10:34624589-34624611 TGAGCCCAGAAGCCACCAGGAGG + Intronic
1067475211 10:46560445-46560467 TGACTCCAGATCCCAACAGGAGG + Intergenic
1068190407 10:53644492-53644514 TGGCCTAAGATTCCAACAGAAGG + Intergenic
1069590606 10:69639411-69639433 TGTCCAAAAATTCCACCAGGTGG - Intergenic
1071227977 10:83553666-83553688 TCACCTCAGAATTCTCCAGGAGG + Intergenic
1073044033 10:100625790-100625812 TGAGCTCCGAGACCACCAGGCGG - Intergenic
1073582372 10:104680480-104680502 TGACTTCAGAGTCCACACGGGGG - Intronic
1073755076 10:106572732-106572754 TGACTTCAGTTTCAACCTGGTGG + Intergenic
1073949225 10:108786791-108786813 TGATATCAGCTTCCACTAGGAGG - Intergenic
1075002766 10:118810246-118810268 GGACTGCAGTTTCCACCAGGGGG - Intergenic
1075700167 10:124464172-124464194 TGACCTGGGATGCCAACAGGAGG - Intronic
1076978042 11:190122-190144 TGTCCTCAGCTGCCAGCAGGCGG - Intronic
1079257453 11:18844464-18844486 CTGCCTCAGATTCCACTAGGGGG + Intergenic
1079401148 11:20107462-20107484 TGATCCCTGATTCCACCTGGGGG - Intronic
1084672436 11:70615249-70615271 TCATCACAGAGTCCACCAGGAGG - Intronic
1085370675 11:76001714-76001736 TGATCCCAGATTCAACCAGTGGG - Intronic
1087241686 11:95789023-95789045 TGTCCTCTTCTTCCACCAGGAGG - Intronic
1087655217 11:100914567-100914589 TCACTTCAGAGTACACCAGGAGG - Intronic
1088785326 11:113176542-113176564 TGACCTCAGAGTAGACCAGATGG - Intronic
1090262714 11:125332987-125333009 TGCCCTCAGCTTCCACCGCGAGG - Intronic
1091424813 12:378310-378332 TGACCTCTGATTGCACCACCTGG - Intronic
1096344025 12:50829200-50829222 TGACCTCAGGTGACACCAGCTGG - Intergenic
1098051624 12:66460124-66460146 TCACCTCTGACTCCACCACGTGG - Intronic
1100088907 12:90946437-90946459 TGACCACAGATTCCACCAACTGG - Intronic
1100610620 12:96189283-96189305 AGACCGCAGACTCCAACAGGGGG + Intergenic
1104730370 12:131102453-131102475 TGACCTCAGCTCCCACCTGGTGG + Intronic
1104989103 12:132615075-132615097 TCTGCTCAGATGCCACCAGGTGG - Intergenic
1107218360 13:37949232-37949254 TGATCCCAGGTTCCACTAGGAGG - Intergenic
1107710178 13:43143711-43143733 TGACCGGAGATTCCACCTTGGGG - Intergenic
1111819847 13:93199299-93199321 TGACCTCAAATTATACCATGAGG + Intergenic
1112904755 13:104403115-104403137 AGACTTCAGATTCCCCCAGCTGG - Intergenic
1113999785 14:16403325-16403347 TGGACTCAGATTCAGCCAGGAGG - Intergenic
1115778610 14:36744275-36744297 TGACTTCAGATTACACTAGAAGG + Intronic
1119144992 14:72304073-72304095 TGTCCTCAGGTTCCTACAGGAGG - Intronic
1119226416 14:72947695-72947717 TGCCCTCAGCTTCCCCTAGGAGG - Intronic
1120764368 14:88315212-88315234 TGGCCTCAAATTCCACCATGAGG + Intronic
1121512295 14:94521528-94521550 GGACCTGAAATGCCACCAGGGGG + Intergenic
1123129673 14:105974878-105974900 TGTGCTCAGACACCACCAGGGGG + Intergenic
1124249726 15:28098950-28098972 TGACCTCATGGCCCACCAGGGGG + Intronic
1127355007 15:58189607-58189629 GGACCTTCTATTCCACCAGGAGG - Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128380319 15:67107481-67107503 TGACCACAGACTGCATCAGGAGG - Intronic
1128662447 15:69512370-69512392 TGACCTCTGATGTGACCAGGAGG + Intergenic
1128667277 15:69547717-69547739 TGACCCCTGGTTCCACCATGTGG - Intergenic
1128887772 15:71304113-71304135 TCATCCCAGATACCACCAGGAGG + Intronic
1129744015 15:78005550-78005572 TGGCCTAATATTCCATCAGGTGG - Intronic
1132309239 15:100844863-100844885 TGACCTCAGATGACACCTGGAGG + Intergenic
1132546039 16:533899-533921 GCACCTCAGCTTCCACCAGGAGG - Intronic
1133033416 16:3022188-3022210 TGTCCTGAAATTCCACCACGGGG + Exonic
1133806227 16:9127737-9127759 TGACCTCAGATGCCCCCGTGGGG - Intergenic
1135554443 16:23424408-23424430 TGGCGGCAGATTACACCAGGAGG - Intronic
1137392358 16:48092242-48092264 TGAACCCAGATTGTACCAGGAGG + Intronic
1137527583 16:49249857-49249879 ATGCCTCAAATTCCACCAGGAGG + Intergenic
1138129689 16:54469328-54469350 TGCTCTCTGATTCCACCAGCTGG + Intergenic
1138497567 16:57417456-57417478 TGTCCTCTGAATCCACCGGGAGG + Intergenic
1138867122 16:60835361-60835383 TTACTTCAGATTCCCCCAGAGGG + Intergenic
1141065751 16:80912296-80912318 TGTGCTCAGACTGCACCAGGGGG - Intergenic
1141125298 16:81396886-81396908 TGAGCTGAGATTGCATCAGGAGG - Intergenic
1142143593 16:88483332-88483354 TGACCTCAGAGGCCACGGGGAGG - Intronic
1142465467 17:134587-134609 TGTCCTCAGCTGCCAGCAGGCGG - Intergenic
1143252779 17:5535382-5535404 TGGCCTCCCATTCCTCCAGGAGG + Intronic
1144741280 17:17583793-17583815 TGACCTCAGATTCCAGCATCGGG - Intronic
1145104202 17:20101587-20101609 TGTGCTCAGATACCACAAGGAGG - Intronic
1145263883 17:21370228-21370250 TGGCCTGGGATCCCACCAGGTGG + Intergenic
1146370323 17:32262094-32262116 TGACCTCATTTTCCCCCAGGAGG + Intergenic
1149291055 17:55218039-55218061 TGACCTCAGTTGCCACTTGGTGG + Intergenic
1153914390 18:9732988-9733010 TGAGCTGAGCTTTCACCAGGTGG + Intronic
1156578211 18:38344371-38344393 AAACCCCAGATTCCACCAGAAGG + Intergenic
1156803484 18:41147479-41147501 TGGCCTGAGATTCCACCAGAAGG + Intergenic
1157573635 18:48729989-48730011 TCACCTGAGACTCCACCTGGAGG - Intronic
1159020313 18:63137959-63137981 TGATCCTAGATTCCACCAAGAGG + Intronic
1161507569 19:4652169-4652191 GGCCGTCAGCTTCCACCAGGTGG + Exonic
1162453805 19:10770278-10770300 TGGCCTCAACGTCCACCAGGAGG - Intronic
1163298215 19:16426181-16426203 TGACATCACGTTCCCCCAGGTGG + Intronic
1165930791 19:39357058-39357080 TGGCCTCCGACTCCAGCAGGTGG - Exonic
1166959244 19:46488021-46488043 TGCCCGCTGATTCCACCAGGAGG - Intronic
1168478224 19:56693675-56693697 GGCCCTCAGATCCCAACAGGAGG - Intergenic
925285677 2:2714207-2714229 TGACTCCAGCTCCCACCAGGTGG - Intergenic
931927463 2:67088824-67088846 TGAACTCTGATTTCAACAGGAGG + Intergenic
936068153 2:109347733-109347755 TGACCTCAAGTTCAACAAGGGGG + Exonic
936598149 2:113869038-113869060 TGAACTTAAATGCCACCAGGTGG - Intergenic
937090700 2:119204563-119204585 TGACCTCACAGTCAGCCAGGTGG + Intergenic
938588137 2:132711841-132711863 TGAGCTTACATTCCACTAGGGGG + Intronic
940730044 2:157378052-157378074 TGACCTCAGAAACCATCTGGAGG + Intergenic
942788446 2:179730169-179730191 TGACCACACATTCCAGCATGAGG + Intronic
943022612 2:182593262-182593284 TGATCCCAAATTCCACCAGCAGG - Intergenic
945528234 2:210916076-210916098 TGAACTGACATTCCACAAGGAGG - Intergenic
945972417 2:216243609-216243631 AGACATGAGATTCCTCCAGGAGG + Intergenic
946201414 2:218072867-218072889 TGAACTCAGAGCTCACCAGGTGG + Exonic
946311548 2:218884830-218884852 TGACCTCCGTTTCCTCCAAGTGG + Intronic
947129321 2:226905100-226905122 TGACCTCTCATTCCAGAAGGTGG - Intronic
947914493 2:233822659-233822681 TAAGATCAGATCCCACCAGGAGG - Intronic
1170211148 20:13847290-13847312 GGACCTCAGAATCCACCACCTGG + Intergenic
1170773151 20:19351721-19351743 TCACCTCAGTTTCCACCAGGTGG + Intronic
1171035242 20:21708418-21708440 TGGCCTGACACTCCACCAGGAGG - Intronic
1171727205 20:28635476-28635498 TGGACTCAGATTCAGCCAGGAGG - Intergenic
1171751045 20:29049140-29049162 TGGACTCAGATTCAACCAGGAGG + Intergenic
1171856417 20:30348095-30348117 TGGACTCAGATTCAGCCAGGAGG + Intergenic
1172044959 20:32073774-32073796 AGACCTCAGCTTCCAGAAGGGGG + Exonic
1173338194 20:42130342-42130364 TGGCTTCAGGTTCCAGCAGGTGG - Intronic
1176313724 21:5221789-5221811 TGGACTCAGATTCAGCCAGGAGG - Intergenic
1179558089 21:42193534-42193556 TGACCTCAGACTGCACCAGCAGG + Intergenic
1179834966 21:44025051-44025073 ACAACTCAAATTCCACCAGGAGG - Intronic
1180391545 22:12287898-12287920 TGGACTCAGATTCAGCCAGGAGG - Intergenic
1180408200 22:12576856-12576878 TGGACTCAGATTCAGCCAGGAGG + Intergenic
1182100031 22:27651202-27651224 TGCCCTCAGAGACAACCAGGGGG + Intergenic
1182130170 22:27844876-27844898 TGACCTCGAGTTCCACCAGCAGG + Intergenic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
950010660 3:9721284-9721306 TGCCCCCAGATTCCCCCAGAGGG - Intronic
950978305 3:17274243-17274265 TGACCTCTGATTAAACAAGGAGG - Intronic
955200855 3:56851063-56851085 TTCCCTCAGATTCCACCTGAGGG + Intronic
957243549 3:77689717-77689739 TCAGGTCAGATTCCACCAGCAGG - Intergenic
957688750 3:83539465-83539487 TGACCTAAGTTTCCATCAGTGGG + Intergenic
965942829 3:174206432-174206454 TTACCTCATACTACACCAGGGGG + Intronic
966882431 3:184357910-184357932 TGGCCTCCTCTTCCACCAGGAGG + Intronic
966953506 3:184847805-184847827 TCACCTCTGATTTCTCCAGGAGG - Intronic
967245092 3:187478559-187478581 TGTCTTCAGATTACACCTGGTGG - Intergenic
968866099 4:3212899-3212921 TGACCTCACAGGCCACCATGAGG - Intronic
975307677 4:72867627-72867649 TGACCTCAAATTCACCAAGGTGG + Intergenic
978491518 4:109316017-109316039 TGATATCAGTCTCCACCAGGGGG - Intergenic
980236896 4:130119647-130119669 TGACCTCAGATTACACTACGAGG + Intergenic
981957171 4:150492504-150492526 TGACCAGAGATACCACCAGTTGG + Intronic
982223324 4:153143110-153143132 TATCCACAGATTCCACAAGGTGG + Intergenic
982737148 4:159018669-159018691 TGACCTCAAATTTTGCCAGGGGG - Intronic
984999460 4:185470053-185470075 TGTCCTCAGATTCCCCTAGCTGG + Intronic
985242681 4:187947185-187947207 TGACCACATCTTCCACCAGTGGG - Intergenic
989197605 5:38731221-38731243 TGACTTCAGACTCCACCTTGAGG + Intergenic
990272879 5:54163959-54163981 TGACCTCAGCTTCCACCTTAGGG - Intronic
993087077 5:83376556-83376578 TGGCCTCAGTCTCCACCAAGGGG + Intergenic
994559734 5:101352291-101352313 TGACTTCAGATTCTACCACAAGG + Intergenic
996623594 5:125541184-125541206 TGACCTCTGGTTCCCACAGGAGG + Intergenic
996711090 5:126544298-126544320 TGGCCTCAGAGTCCTCCAGCAGG + Exonic
997364402 5:133316512-133316534 TGAACAGAGATTCCACCAGGAGG + Exonic
998867931 5:146523895-146523917 TGACTACAGAATCCAGCAGGTGG + Intergenic
999810328 5:155121396-155121418 TGGCCTCAGAGTCTACCTGGGGG - Intergenic
1001460826 5:171912312-171912334 TGACACCAGGTACCACCAGGGGG + Intronic
1001586391 5:172835868-172835890 TGACCTTGAATTCCACCAGAGGG - Intronic
1002885823 6:1292940-1292962 TGAGGCCAGATTCCATCAGGAGG + Intergenic
1003253717 6:4456289-4456311 TGATCCTAGATTCCAGCAGGTGG + Intergenic
1007485197 6:42176056-42176078 GGAGCTCACATTCCAGCAGGGGG - Intronic
1008480196 6:51978023-51978045 AGACCTAAGATCCCAGCAGGAGG + Intronic
1008598653 6:53066835-53066857 GGGCCTCAGATGCCACCTGGAGG - Intronic
1012436192 6:99217413-99217435 GGACCTCAGAATCCACGTGGTGG + Intergenic
1014219762 6:118788242-118788264 TGACCTCAGCTTCCAGCCCGTGG + Intergenic
1016120457 6:140337147-140337169 TAACATCAGTCTCCACCAGGAGG + Intergenic
1018033443 6:159862655-159862677 TTATCTCAGTTTCCACCAGTTGG + Intergenic
1019389501 7:778062-778084 GGACCTCAGAGTTCAGCAGGCGG - Intronic
1019767625 7:2863350-2863372 TGACCTCAGAGACCCCCAGAAGG + Intergenic
1022284935 7:28947737-28947759 TGATCCTAGATTGCACCAGGAGG + Intergenic
1022826078 7:34015450-34015472 TAACCTCAAATTCCAATAGGTGG - Intronic
1022833147 7:34088316-34088338 TGATCTCACAGTCCAACAGGAGG + Intronic
1023457314 7:40354430-40354452 TGACCACAGCTTTAACCAGGTGG - Intronic
1027960132 7:84935236-84935258 TGACCTCAGAATTCACCTGGAGG + Intergenic
1028250910 7:88539454-88539476 TGAGCTCAGACACCACCAGGTGG - Intergenic
1033134547 7:138773813-138773835 TTACCCCAGCTTCCTCCAGGCGG + Intronic
1033293215 7:140106803-140106825 TGAACTCAGCTTGCACCAAGTGG - Intronic
1034184755 7:149166843-149166865 TTATCTCAGATTCAACCAGAAGG + Exonic
1034629751 7:152521876-152521898 AGGCCTCAGTTTCCACCATGTGG + Intergenic
1035790580 8:2300478-2300500 TGCCCTCTGATGCCACCAGAAGG + Intergenic
1035802225 8:2421227-2421249 TGCCCTCTGATGCCACCAGAAGG - Intergenic
1037292954 8:17370463-17370485 TGAGCTGAGATTGCACCAGGAGG + Intronic
1037950173 8:23014525-23014547 TGACGTCTGCTGCCACCAGGGGG - Intronic
1039619732 8:38985550-38985572 TGCCCTCTGATTTCACTAGGGGG - Intronic
1044464771 8:92490079-92490101 AGACCCCAGATCCCACCAGAAGG - Intergenic
1049954843 9:683051-683073 TGATCTCAGAAAACACCAGGTGG - Intronic
1050085639 9:1962703-1962725 TGATCTCAGATTCCCAAAGGAGG + Intergenic
1051455169 9:17247291-17247313 TGAACTCAGATTCCAACTGCTGG + Intronic
1051820903 9:21166420-21166442 TGACTTTGGATTCCCCCAGGAGG - Exonic
1051825755 9:21217113-21217135 TGATTTCGGATTCCCCCAGGAGG - Exonic
1051837015 9:21350695-21350717 TGACTTCAGATTTCCCCAGGAGG - Exonic
1053722543 9:40961626-40961648 TGGACTCAGATTCAGCCAGGAGG + Intergenic
1055140505 9:72871776-72871798 TGGCCTCTGACTCCACCTGGTGG - Intergenic
1060821280 9:126662809-126662831 TGGCCTAAGCTTCCTCCAGGTGG + Intronic
1062650783 9:137576076-137576098 TGACCTCAGATTCCACCAGGCGG + Exonic
1203490033 Un_GL000224v1:96050-96072 TGACCCCAGGCGCCACCAGGAGG + Intergenic
1203502656 Un_KI270741v1:37933-37955 TGACCCCAGGCGCCACCAGGAGG + Intergenic
1186128839 X:6444712-6444734 TGACCTCATATTGTACCATGAGG - Intergenic
1187224383 X:17361820-17361842 TTACTTCCGGTTCCACCAGGGGG + Intergenic
1188848924 X:35108489-35108511 TGACCTCAAACTCTACCATGAGG + Intergenic
1197355873 X:125437042-125437064 TGATATTAGCTTCCACCAGGGGG + Intergenic
1199195329 X:145022699-145022721 TGAGCTCATTTTCCACAAGGGGG + Intergenic