ID: 1062651015

View in Genome Browser
Species Human (GRCh38)
Location 9:137577717-137577739
Sequence CTGCCTGGAAGGAGAACCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062651009_1062651015 19 Left 1062651009 9:137577675-137577697 CCAAGGAACTCAAAGGTTTGCCA 0: 1
1: 0
2: 9
3: 80
4: 403
Right 1062651015 9:137577717-137577739 CTGCCTGGAAGGAGAACCTCTGG 0: 1
1: 0
2: 3
3: 26
4: 267
1062651012_1062651015 -1 Left 1062651012 9:137577695-137577717 CCATGACTAAAGGAGTGGAATTC 0: 1
1: 0
2: 2
3: 16
4: 100
Right 1062651015 9:137577717-137577739 CTGCCTGGAAGGAGAACCTCTGG 0: 1
1: 0
2: 3
3: 26
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062651015 Original CRISPR CTGCCTGGAAGGAGAACCTC TGG Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
900679078 1:3906365-3906387 CTGCAGGGCAGGAGAACCTCGGG + Intergenic
900918895 1:5658503-5658525 AGGCCTGTAATGAGAACCTCAGG + Intergenic
900988969 1:6089188-6089210 CTGGGTGGAAGGAGAAGGTCAGG - Intronic
902120533 1:14161388-14161410 CATCTTGGAAGGAGAACCTTCGG - Intergenic
903534192 1:24055904-24055926 CAGCCTGGAAGGTGAGCCGCTGG + Intergenic
903725798 1:25443398-25443420 CTGCCTGAAAGGAGAGCCAGAGG + Intronic
905577716 1:39059048-39059070 CTGCCTAGAAGCAGAAGTTCTGG + Intergenic
906051812 1:42880706-42880728 CAGCCTGGAATGAGAACTTATGG - Intergenic
908270743 1:62419986-62420008 CTGCCTGGCAAGTGTACCTCTGG - Intergenic
909676704 1:78246309-78246331 CTGCAAGGCAGGAAAACCTCTGG - Intergenic
910759425 1:90719726-90719748 CTGCCGGGATGGAGCACGTCCGG - Intergenic
913670414 1:121093027-121093049 CTTCATGGAAGGAGAACCTCTGG + Exonic
914022181 1:143880468-143880490 CTTCACGGAAGGAGAACCTCTGG + Intergenic
914660666 1:149788397-149788419 CTTCACGGAAGGAGAACCTCTGG + Exonic
915229417 1:154434573-154434595 CTAACTGGCAGGAGAACTTCTGG - Exonic
915534847 1:156529118-156529140 CTTCCTGGCAGGAGAGCCTTAGG + Intronic
915599612 1:156913987-156914009 CTGCCTGGGGGGAGATCCTGAGG - Exonic
917942639 1:179937876-179937898 CAGCCTGGAAGAAGACCCTCAGG - Intergenic
918644089 1:186882581-186882603 CTGACTAGAGGGAGAACCTTGGG + Intronic
920765437 1:208828215-208828237 CTTCCTGGGAAGAGAACCTGGGG + Intergenic
921002305 1:211056175-211056197 CTGCCCTAAAGGAGAAACTCAGG + Intronic
924169542 1:241323729-241323751 TTGACTGGAATCAGAACCTCAGG - Intronic
1064567531 10:16657651-16657673 CTGTCTGGAGGCATAACCTCCGG - Intronic
1065287059 10:24196292-24196314 GTGCCTGGAAGGAGCACATTGGG + Intronic
1072487185 10:95866747-95866769 CTGGCTGAAAGAAGAATCTCAGG + Exonic
1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG + Intronic
1072664684 10:97384715-97384737 CAGCCTGGACGGAGACCCTGAGG + Intronic
1073008145 10:100340139-100340161 CTGCCTGAAAGGAGGACATGGGG + Intergenic
1073681962 10:105714656-105714678 CTGCATAGAAGTGGAACCTCTGG + Intergenic
1073989838 10:109250345-109250367 GTTCCTGGAAGTGGAACCTCTGG - Intergenic
1074230363 10:111527883-111527905 CTGCCTGGAATGATGAGCTCTGG + Intergenic
1075817000 10:125272037-125272059 CTACCTGGATGGAGAGCCTGAGG + Intergenic
1076053214 10:127351655-127351677 TTGCCTGGAAGCAGAACCCCGGG - Intronic
1076329959 10:129656875-129656897 CAGCATGAAAGGAGAACCTTGGG - Intronic
1076691691 10:132226952-132226974 CGTCCTGGAAGGAGTACCTGTGG + Exonic
1076720455 10:132390083-132390105 CTGCCTGGAGGGAGCAGCACAGG + Intergenic
1076912917 10:133401157-133401179 CTGCGTGGAAGGAGCAGCTCAGG + Intronic
1077850077 11:6067471-6067493 ATGCATGGATGGAGAACATCTGG + Intergenic
1078741036 11:14066604-14066626 ATGCCTGTAAGGTGAAGCTCAGG - Intronic
1078874309 11:15378258-15378280 CAGCCTGGAGGGAGAACTTATGG + Intergenic
1079032098 11:16993469-16993491 CTGCCAGCAAGGAGAGCCACAGG - Intronic
1081049198 11:38316140-38316162 CTTCCTGTAAGGAGAGACTCAGG + Intergenic
1081380319 11:42407018-42407040 GTGCCTGAAATGAGAACCTCAGG + Intergenic
1083184036 11:61007358-61007380 CTGACTCTAAGGAGAACCACAGG + Intronic
1083242245 11:61397558-61397580 CAGACTGGAAGCAGGACCTCTGG + Intronic
1084072124 11:66743668-66743690 CTGGCTGACAGGAGAAGCTCTGG - Intergenic
1085981662 11:81733248-81733270 CTGCCTTGAAGGAGAAGCTTCGG - Intergenic
1086942875 11:92816460-92816482 CTGCCCAGAAGGAGTCCCTCAGG + Intronic
1087718721 11:101637922-101637944 CTGCCTGGAAAGAGTTCCTGAGG + Intronic
1088540739 11:110911212-110911234 CGCCCTGAAAGGAGAAGCTCAGG + Intergenic
1091698515 12:2643996-2644018 CTGGCTGGATGGAGACCTTCAGG + Intronic
1094267173 12:28572414-28572436 CTGGCTGGAAGGTGAACGTGAGG + Intronic
1095148705 12:38764018-38764040 CTGCCTGGAAGGAGAAGGCACGG - Intronic
1095719170 12:45381646-45381668 CAGCCTTGAAGGAAAACCCCTGG - Intronic
1096276398 12:50211978-50212000 CTGACAGGAAGGAGGACTTCAGG - Intronic
1097725170 12:63066973-63066995 CTGCTTGGATGGGGAACGTCTGG + Intergenic
1098802459 12:74978986-74979008 CTACCTGGATGGGGAACCTATGG + Intergenic
1100939169 12:99706599-99706621 TTGAGTGGAAGCAGAACCTCTGG + Intronic
1101138625 12:101771979-101772001 GTGCCTGGGAGGAGCACCTTCGG + Intronic
1101973140 12:109331581-109331603 CACCCTGGAAGGAGGACTTCGGG + Intergenic
1103921901 12:124403529-124403551 CTGCCTGCAGGGAGGACCTTGGG - Intronic
1104055795 12:125228967-125228989 CTGCCTGGATGCAGACCCTGAGG + Intronic
1104843690 12:131836226-131836248 CTTCCTGGAAGGGGGATCTCGGG + Intronic
1105987873 13:25587028-25587050 ATGACTGAGAGGAGAACCTCTGG - Intronic
1107028630 13:35828816-35828838 CTGGGTGGATAGAGAACCTCAGG - Intronic
1112491188 13:99865744-99865766 CTGTCTGGATGGAGAACTTGGGG - Intronic
1112580658 13:100674454-100674476 CTGCCCGGGCGGAGAAGCTCAGG + Intronic
1113362586 13:109645066-109645088 CTGACTGGAAGGACACCTTCAGG + Intergenic
1113572799 13:111370738-111370760 CTGCAGGGACGGAGAACCCCAGG - Intergenic
1114447594 14:22801274-22801296 GTGCCTGAAAGGAGCACTTCTGG + Intronic
1117953330 14:61104003-61104025 CTGCCAGGAAGAAAAACCCCAGG - Intergenic
1125627073 15:41117150-41117172 CTGCCTGGAAGGATCACCTCAGG + Intergenic
1126225402 15:46263148-46263170 ATGCCTGGAAGTAGAACTCCTGG + Intergenic
1126507933 15:49429777-49429799 CTGCCAGGGATGAGAACCACTGG + Intronic
1127583934 15:60364012-60364034 CTACCTGGAGGGAGAGCTTCTGG - Intronic
1128308861 15:66617942-66617964 CTGCAGGGCAGGAGCACCTCTGG + Intronic
1128506601 15:68277552-68277574 CTCCCTGGCTGGAGACCCTCAGG + Intergenic
1128609036 15:69059220-69059242 CTGTCTGGAGAGAAAACCTCAGG - Intronic
1133631679 16:7628022-7628044 TTGCCTGGAAAGCTAACCTCTGG - Intronic
1134553603 16:15149844-15149866 CTGCCAGCCAGGACAACCTCTGG + Intergenic
1135128270 16:19829639-19829661 CAGCCAGGATGGAGAACCTAAGG + Intronic
1135467426 16:22699175-22699197 ATGCCTGGAAGGAGAAGTACAGG - Intergenic
1136620128 16:31423095-31423117 CTGCCTGGAGAGAGAGCCTGTGG - Exonic
1138481418 16:57305767-57305789 CACCCTAGAAGGAGAACCCCAGG + Intergenic
1140587295 16:76308721-76308743 CTGCCTGGTAGCATCACCTCGGG - Intronic
1140765669 16:78154577-78154599 CTGAGTGGCAGCAGAACCTCTGG - Intronic
1140925637 16:79580588-79580610 CTGCTTGGAGGGAGAACAGCTGG + Intergenic
1141133935 16:81453610-81453632 CTGCAGGGAAGGAGAGCCACGGG + Intronic
1142308533 16:89299244-89299266 CTGCCTGGGAGGAGATCTACAGG + Intronic
1142877881 17:2863223-2863245 CTGCCTGGAAGGAGAAGGGAAGG - Intronic
1145059585 17:19724356-19724378 GTGCCTGGAAGGGTAACCTCAGG - Intergenic
1145267636 17:21388155-21388177 CTGCCGGGAAGGATAAGGTCAGG - Intronic
1146709229 17:35026505-35026527 CTGCCTGGATGGACAGCCTGAGG - Exonic
1148837322 17:50472300-50472322 CTGCCTGGAATGAGGCCCCCTGG - Intronic
1151203520 17:72487857-72487879 CCTCCTGCATGGAGAACCTCTGG + Intergenic
1152728383 17:81958688-81958710 CTGCCAGGAAGGACCATCTCAGG + Intronic
1153331561 18:3879903-3879925 CAGCCTGGAAGGAGTTCCGCTGG + Exonic
1156369541 18:36460494-36460516 CTCCCTGGAAAAAGGACCTCCGG - Intronic
1157014748 18:43698671-43698693 CTGGCTGGAAGGGGAGCCACAGG + Intergenic
1157118787 18:44888095-44888117 CTGCCTGGATGGAGTATTTCAGG + Intronic
1157467262 18:47958014-47958036 CTGCCTGGATGGAGGACCGGAGG - Intergenic
1165161376 19:33818702-33818724 ATGCCTGGATGCACAACCTCAGG - Intergenic
1165645439 19:37431800-37431822 CTGCCTGAAGGGAGAATCCCAGG + Intronic
1165738424 19:38192126-38192148 CTGCCTGGAATGACAGCGTCAGG - Exonic
1166045399 19:40226850-40226872 CTGCCCGGAAGCAGCCCCTCTGG + Intergenic
1168054964 19:53858276-53858298 CTGCATGGCAAGAGACCCTCAGG - Intergenic
1168314533 19:55478768-55478790 CCGCCTGGAAGGGGAATCTGCGG + Intronic
925266218 2:2568451-2568473 CTGCCTTGAAGGAGAAGACCTGG + Intergenic
927507694 2:23625180-23625202 TTCCCAGGAAGGAGAAACTCTGG - Intronic
927817722 2:26234216-26234238 CTGCCTGGGAGGAGGACTTGAGG - Exonic
927842525 2:26454736-26454758 CTTCCTCCAAGCAGAACCTCTGG + Exonic
927886973 2:26724699-26724721 CTGCCTGGGATAAGAGCCTCTGG + Intronic
928391504 2:30914364-30914386 CAACCTGGAAGAAGAATCTCAGG - Intronic
928572788 2:32625907-32625929 CTACCTGGAAGGTGAGGCTCTGG - Intergenic
928990941 2:37232339-37232361 CTGCCTGGGCTGAGAACCTTCGG - Intronic
929045846 2:37788404-37788426 CTGCCTGTAAGGTGAACGCCTGG - Intergenic
937302053 2:120848571-120848593 CTGGCAGGAAGGAGACCCTGGGG + Intronic
937508005 2:122558834-122558856 CTGTAGGGAAGGATAACCTCTGG + Intergenic
937666792 2:124496921-124496943 CTACCTGGATGTATAACCTCAGG + Intronic
938939525 2:136157406-136157428 TTGGCTGGAAGGAGAATCTTAGG - Intergenic
938974618 2:136464041-136464063 CGGCCTGGAAGGAAAACATCTGG - Intergenic
940697654 2:156999869-156999891 CTGCCTGCCAAGAAAACCTCAGG + Intergenic
942191770 2:173477671-173477693 CAGCCTGTAAAGAAAACCTCAGG - Intergenic
945257525 2:207814556-207814578 CTGAGTGGAAAGAGAACCTCAGG - Intergenic
945977149 2:216279883-216279905 CTGCCTGGAAAGAGGGCTTCTGG + Intronic
946393277 2:219429421-219429443 CTGCCTGGAACTAGAAATTCTGG + Intergenic
946485587 2:220097941-220097963 GTGGCTGGAAGGACAACGTCAGG + Intergenic
948061870 2:235048126-235048148 CTGCCTGGGAGGAATCCCTCAGG - Intronic
948399257 2:237671160-237671182 CTGCTTGGAAAGGGAACTTCTGG - Intronic
1170268641 20:14499133-14499155 CAGCATGGCAGGAGAAACTCAGG + Intronic
1170336368 20:15274887-15274909 CTTCCTGGAAGAAGTACCACTGG + Intronic
1170568779 20:17621395-17621417 CTGCAGGGAAGGAGAGCTTCGGG - Intronic
1173023294 20:39285745-39285767 CTGCCTAGAAGCAGAGCCTGAGG + Intergenic
1173342107 20:42161933-42161955 CTGCAGGGGAGGAGAGCCTCAGG + Intronic
1173443397 20:43096854-43096876 CTGTCTGGAAGGGGAGCCTGGGG - Intronic
1174489108 20:50879751-50879773 CTGCCAGGCAGGCTAACCTCAGG - Intronic
1174548344 20:51343366-51343388 ATGCCTGGAGGGAGAAGGTCTGG + Intergenic
1175601895 20:60281152-60281174 CTGCGTGGAAGGAAAGTCTCAGG - Intergenic
1175988176 20:62774665-62774687 CTGCCTGGAAGGAGCACGCAGGG - Intergenic
1179329097 21:40381202-40381224 CTGCCAGGAATAAGAACCACGGG + Intronic
1180784494 22:18539260-18539282 CTGCCTGCCAGGAGATCTTCTGG + Intergenic
1181128070 22:20713313-20713335 CTGCCTGCCAGGAGATCTTCTGG + Exonic
1181241397 22:21478617-21478639 CTGCCTGCCAGGAGATCTTCTGG + Intergenic
1181339438 22:22166229-22166251 CTGCCTGGAAAGCTAACCCCGGG - Intergenic
1181774603 22:25150307-25150329 CTGCCTGGCAGCAGAACCCCTGG + Intronic
1181871635 22:25903734-25903756 CTGGCTTGAAGGAGAGGCTCTGG + Exonic
1182256953 22:29046110-29046132 CTTGCAGGAAGGAGAAACTCGGG + Intronic
1182711802 22:32327874-32327896 CTGCCGGGATGGGGCACCTCGGG + Intergenic
1183119087 22:35715790-35715812 CTGCCTTCAAGGTGAAGCTCCGG + Intergenic
1184434655 22:44463152-44463174 CTGTGTTGAAGGAGAACTTCAGG - Intergenic
1185146849 22:49141819-49141841 CTGCAGGTAAGGAGACCCTCTGG - Intergenic
1185185409 22:49396433-49396455 CAGCCTGGAAGGAGCTGCTCGGG - Intergenic
1185375295 22:50480131-50480153 CTTCCTGGAAGTAGAAATTCTGG - Intergenic
952060531 3:29503544-29503566 GTGCCTGGAAGTAGAATGTCAGG - Intronic
952907088 3:38147658-38147680 CTGGCTGGGAGAAGAAACTCTGG + Intergenic
953581918 3:44165284-44165306 CTGCCAGGAAGGAGAGCATTTGG - Intergenic
953679452 3:45028692-45028714 CAGCCAGGAATGAGAATCTCAGG + Intronic
954197339 3:49004580-49004602 CTTCCAGGGAGGAGGACCTCAGG + Intronic
954447636 3:50555248-50555270 CTGCTGGGAAGGTGATCCTCTGG - Intergenic
955550140 3:60075204-60075226 CTGCCTGTCAGGAGAACCAATGG + Intronic
955570594 3:60300842-60300864 CTATCTGGAAGGAGAACATCAGG - Intronic
956003876 3:64758699-64758721 GTGCCTAGAAGGAGAAATTCTGG + Intergenic
961381955 3:126501010-126501032 CCCCCTGGAAAGAGAACCTACGG + Intronic
961863891 3:129939630-129939652 CTGCCTAGAAGCAGAATTTCTGG + Intergenic
962038819 3:131683429-131683451 CGGCCTGGAATGGGGACCTCAGG + Intronic
972278687 4:37583295-37583317 CTGCCTGGCTGGAGAACTCCTGG + Intronic
973019948 4:45190552-45190574 CTGCCTGGATAGATAAACTCAGG - Intergenic
973220260 4:47718052-47718074 CTGCCTGGCAGGAAGAACTCTGG - Intronic
974075640 4:57165927-57165949 CTACCTTCAAGGAGATCCTCAGG + Intergenic
974197786 4:58598971-58598993 TTGCCTGGAAGGACAACATGGGG + Intergenic
975723465 4:77270196-77270218 CTTCCAGGAAGCAGATCCTCAGG + Intronic
976560328 4:86493639-86493661 CTGCCTGGAAGGAAGCCCTATGG + Intronic
976762815 4:88568766-88568788 GTGCCTGGAATGGGAGCCTCAGG + Intronic
978144759 4:105359369-105359391 CAGCCTGGAAGGGGACCCACAGG - Intergenic
980740735 4:136946880-136946902 CTGCCTGGAGTGAGAACTTACGG + Intergenic
982016622 4:151161059-151161081 CTTACTGGAAGGAGAAACACAGG + Intronic
982275137 4:153630512-153630534 TGGCCTGCAAGGAGAACATCTGG + Intronic
985690889 5:1311642-1311664 CTGCCTGGCAGGAGCAGCCCCGG - Intergenic
985885771 5:2676548-2676570 CTGCCTGGACGGACATCCTCGGG - Intergenic
986176230 5:5354378-5354400 CTGCCTTGAGGGAGAGCCTCAGG + Intergenic
986891124 5:12307618-12307640 ATACCTGGAAGGAGAATTTCTGG + Intergenic
990834240 5:59997950-59997972 TTGCCTGGAATGAGAACAGCAGG + Intronic
992594227 5:78329268-78329290 GTGCCTGGGAGGAAAACTTCAGG + Intergenic
993618023 5:90136854-90136876 CAGCCTGGAATGAGAACTTATGG - Intergenic
994174879 5:96700802-96700824 CTGGCAGGAAGGACACCCTCAGG + Intronic
997210783 5:132075490-132075512 CTGCCCAGAAGGCCAACCTCAGG + Intronic
999053535 5:148549463-148549485 CAGCCTGGGATGAGAGCCTCTGG - Intronic
999683813 5:154084668-154084690 CTGCCTGGAAGGAGGGCATAGGG - Intronic
999969299 5:156843167-156843189 CAGCCTTGGAGGAGAACCTGGGG + Intergenic
1000518391 5:162269042-162269064 CAGCGTGGAAGGAGACCCGCAGG - Intergenic
1002126624 5:177050419-177050441 CAGCCTGACAGGAGAAGCTCAGG + Intronic
1003160207 6:3627942-3627964 CCGCCTGCAAGGGGAGCCTCAGG - Intergenic
1003438987 6:6122160-6122182 CTGCCTGGAGTGAGAACTTATGG + Intergenic
1005971640 6:30766431-30766453 CTACCTTGAAGCAGAACCTGGGG + Intergenic
1006117356 6:31782284-31782306 ATGCCTGGATGGACAACATCCGG - Exonic
1006466570 6:34198207-34198229 GTGCCTCGAAGGAGAATGTCGGG + Intergenic
1008015959 6:46519967-46519989 CTGCCTGAAAGTAGAAAATCCGG - Intergenic
1008581686 6:52913908-52913930 CTGCCAGCAAGGAGACCCACTGG + Intergenic
1009308961 6:62125683-62125705 GTGCCTGGAATGAGGACCTCAGG - Intronic
1009575806 6:65457463-65457485 CTGCATTGAAAGAGAACCTTTGG - Intronic
1015207870 6:130661159-130661181 CTCCCTGGAAGGAGAACTCATGG - Intergenic
1015310845 6:131765702-131765724 CAGCCTGGAAGAAGAGCGTCAGG - Intergenic
1015563074 6:134537329-134537351 CTGGATGAAAGGAGAAACTCTGG - Intergenic
1017626673 6:156356397-156356419 CTGCCTGGAAGAGGAAGCTTGGG + Intergenic
1017971368 6:159315276-159315298 CTGCCTGGAAGGAGCTCCCCAGG + Intergenic
1018865344 6:167742974-167742996 CCCCCTGGAATGAGAACTTCTGG - Intergenic
1019389238 7:776506-776528 CGGCCGGGAAGGGGGACCTCAGG + Intronic
1019750618 7:2726858-2726880 CTGGCTGGAACGATAACCCCAGG + Intronic
1019917428 7:4142910-4142932 CTGCCTGGAAAAAGCATCTCTGG - Intronic
1019948004 7:4345435-4345457 CTGCCTGGACTGAGAACCCCAGG + Intergenic
1020066463 7:5191558-5191580 CTGCCTGGGAGGAGGACTTGTGG + Intronic
1022198639 7:28094681-28094703 TTGCCTGGAAGGAGAAGCTTCGG - Intronic
1022517303 7:30984151-30984173 CTGGCTGGAAGGAGGACACCGGG - Intronic
1023572716 7:41589022-41589044 CTGCCTGGAAGGTAAACCTTTGG - Intergenic
1023824576 7:44000458-44000480 CGGTCAGGAAGGAGAACCTGAGG + Intergenic
1024305884 7:47929354-47929376 CTCCCTGGAAGTGGAAGCTCGGG - Exonic
1026088128 7:67279220-67279242 CGGTCAGGAAGGAGAACCTGAGG + Intergenic
1026726115 7:72871051-72871073 CGGTCAGGAAGGAGAACCTGAGG - Intergenic
1027117726 7:75494553-75494575 CGGTCAGGAAGGAGAACCTGAGG + Intergenic
1027222018 7:76220287-76220309 CTGCCTGGAAGGACTCCCTGGGG - Intronic
1027274078 7:76540927-76540949 CGGTCAGGAAGGAGAACCTGAGG - Intergenic
1027327520 7:77059979-77060001 CGGTCAGGAAGGAGAACCTGAGG - Intergenic
1028503625 7:91547240-91547262 GTGCCTGGAAGGAGAAAAGCTGG - Intergenic
1029606276 7:101601263-101601285 CAGCCTGGAGGGACAGCCTCAGG - Intergenic
1033536829 7:142320447-142320469 CTGCCTGGAAGGAAAAGCAAAGG + Intergenic
1034200163 7:149279206-149279228 CTGGCTGGAAAGAGAAACCCAGG - Intronic
1034589723 7:152129041-152129063 CTGCCGTGAAGGAGAACCCCGGG + Intergenic
1035377453 7:158414795-158414817 CTGGCTGGATGGAGATGCTCCGG - Intronic
1035469447 7:159100265-159100287 CTGCATGGATGGAGAAGCTGAGG - Intronic
1035645050 8:1212332-1212354 CTGAGAGGAAGGAGGACCTCTGG - Intergenic
1035688066 8:1540055-1540077 CTGCCAGGGAGGAGGACCACAGG - Intronic
1036682111 8:10883107-10883129 CTGCCTGGAAGGAGAAACCTAGG - Intergenic
1036750386 8:11440062-11440084 CTGCCTGGAAGGTGAAACCTGGG + Intronic
1037042456 8:14252771-14252793 CTGCCTGAAAGCTGAAGCTCTGG - Intronic
1037304133 8:17487158-17487180 CTACCAGGAACCAGAACCTCTGG - Intergenic
1038496534 8:28007270-28007292 GTGCCTGGAAGGGGAAGCTTGGG - Intergenic
1039489364 8:37936025-37936047 TTTGCTGGAAGGAGAGCCTCTGG - Intronic
1041161593 8:55050482-55050504 CTGCGTGCTAGGAGAACCACTGG - Intergenic
1044599501 8:93989847-93989869 CTGCCTGGAAGGAGATGGTTTGG - Intergenic
1045027436 8:98101254-98101276 CTCTCTGGCAGGAGAATCTCAGG - Intergenic
1047381919 8:124372252-124372274 CTGCCTGGCAGGAGGACCTCGGG - Exonic
1049574678 8:143384689-143384711 CTGGCTGGCAGCAGGACCTCAGG - Intergenic
1049644924 8:143731921-143731943 CTCCCTGGAAGGAGAGCCCTAGG + Intronic
1051194908 9:14553716-14553738 CTGCCTGCAGGAAGAACCTAAGG + Intergenic
1051413228 9:16812193-16812215 CTGCCTGGCAGGCAAAGCTCTGG + Intronic
1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG + Intergenic
1060029837 9:120204792-120204814 CTGAATGGAATGAGAGCCTCAGG - Intergenic
1061374511 9:130216010-130216032 CGGCCTGGAAGGTGAAGCTCAGG - Intronic
1061478266 9:130883678-130883700 CTGGCTGGCAGGAGAGCCACAGG - Intronic
1062186011 9:135218913-135218935 CTGCCTGGAAGAGGAAGCTCTGG - Intergenic
1062213576 9:135377438-135377460 CTTCCTGGGAAGAGACCCTCTGG - Intergenic
1062651015 9:137577717-137577739 CTGCCTGGAAGGAGAACCTCTGG + Intronic
1185467627 X:364023-364045 CTGCCTGGAAGGAAGAACCCGGG + Intronic
1185849499 X:3472274-3472296 CTCCTTGAAAGGAGAACCCCTGG - Intergenic
1190806557 X:53843540-53843562 CTGCCAGGAGGAAGAACCTAGGG - Intergenic
1190997314 X:55622760-55622782 CTTACTGGAAATAGAACCTCTGG + Intergenic
1194891479 X:99384699-99384721 CTGCCTGGAGTGAGAACTTGTGG - Intergenic
1197075304 X:122345659-122345681 CTGCATGGCAGGGGGACCTCAGG + Intergenic
1197946086 X:131841129-131841151 CTGCCTGGCAGAAGAGACTCCGG + Intergenic
1201993782 Y:20060032-20060054 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1201994693 Y:20072496-20072518 CTGCCAGAAAGAAGAAACTCTGG + Intergenic
1201994776 Y:20073626-20073648 CTGCCTGAAGGAAGAAACTCTGG + Intergenic
1201995208 Y:20079371-20079393 CTGCCAGAAAGAAGAAACTCTGG + Intergenic
1201995272 Y:20080250-20080272 CTGCCAGAAGGGAGAAACTCTGG + Intergenic
1201995352 Y:20081251-20081273 CTGCCAGAAAGAAGAAACTCTGG + Intergenic
1201996271 Y:20093637-20093659 CTGCCAGAAGGAAGAACCTCTGG - Intergenic
1201996743 Y:20099693-20099715 CTGCCAGAAGGGAGAAACTCTGG - Intergenic
1201996763 Y:20099943-20099965 CTGCCTGAAGGAAGAAACTCTGG - Intergenic
1201998120 Y:20118009-20118031 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1201998129 Y:20118134-20118156 CTGCCTGAAGGAAGAAACTCTGG - Intergenic
1201998780 Y:20126495-20126517 CTGCCTGAAGGAAGAAACTCTGG - Intergenic
1202006114 Y:20274301-20274323 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1202006385 Y:20277919-20277941 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1202006764 Y:20282906-20282928 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1202007555 Y:20293405-20293427 CTGCCAGAAGGAAGAACCTCTGG - Intergenic
1202007618 Y:20294279-20294301 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1202007728 Y:20295778-20295800 CTGCCAGAAAGAAGAATCTCTGG - Intergenic
1202008015 Y:20299642-20299664 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1202008262 Y:20303002-20303024 CTGCCAGAAGGAAGAACCTCTGG - Intergenic
1202009278 Y:20316095-20316117 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1202009992 Y:20325474-20325496 CTGCCAGAAGGAAGAACCTCTGG - Intergenic
1202010486 Y:20331848-20331870 CTGCCAGAAGGAAGAACCTCTGG - Intergenic
1202010549 Y:20332722-20332744 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1202011580 Y:20346347-20346369 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1202011697 Y:20347847-20347869 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1202011832 Y:20349597-20349619 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1203336423 Y_KI270740v1_random:6098-6120 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1203337569 Y_KI270740v1_random:21506-21528 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1203337649 Y_KI270740v1_random:22507-22529 CTGCCAGAAGGGAGAAACTCTGG - Intergenic
1203337775 Y_KI270740v1_random:24139-24161 CTGCCAGAAAGAAGAAACTCTGG - Intergenic
1203337823 Y_KI270740v1_random:24764-24786 CTGCCTGAAGGAAGAAACTCTGG - Intergenic
1203337971 Y_KI270740v1_random:26770-26792 CTGCCAGAAGGGAGAAACTCTGG - Intergenic
1203337990 Y_KI270740v1_random:27020-27042 CTGCCTGAAGGAAGAAACTCTGG - Intergenic
1203338237 Y_KI270740v1_random:30278-30300 CTGCCTGAAGGAAGAAACTCTGG - Intergenic
1203338391 Y_KI270740v1_random:32283-32305 CTGCCAGAAGGGAGAAACTCTGG - Intergenic
1203338411 Y_KI270740v1_random:32533-32555 CTGCCTGAAGGAAGAAACTCTGG - Intergenic