ID: 1062652532

View in Genome Browser
Species Human (GRCh38)
Location 9:137585598-137585620
Sequence CCTGAGAGGCCCAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062652525_1062652532 16 Left 1062652525 9:137585559-137585581 CCCAACAAGAACGAAAGACACTT 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1062652532 9:137585598-137585620 CCTGAGAGGCCCAGTGAGGAAGG No data
1062652526_1062652532 15 Left 1062652526 9:137585560-137585582 CCAACAAGAACGAAAGACACTTC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1062652532 9:137585598-137585620 CCTGAGAGGCCCAGTGAGGAAGG No data
1062652524_1062652532 20 Left 1062652524 9:137585555-137585577 CCAGCCCAACAAGAACGAAAGAC 0: 1
1: 0
2: 0
3: 21
4: 1013
Right 1062652532 9:137585598-137585620 CCTGAGAGGCCCAGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062652532 Original CRISPR CCTGAGAGGCCCAGTGAGGA AGG Intronic
No off target data available for this crispr