ID: 1062653452

View in Genome Browser
Species Human (GRCh38)
Location 9:137590168-137590190
Sequence CTGGACGGGCGAGACGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062653430_1062653452 16 Left 1062653430 9:137590129-137590151 CCGCCGCCCGCACAACCGCCCCC 0: 1
1: 1
2: 2
3: 123
4: 5095
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653433_1062653452 10 Left 1062653433 9:137590135-137590157 CCCGCACAACCGCCCCCGGCCCC 0: 1
1: 0
2: 0
3: 87
4: 595
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653444_1062653452 -9 Left 1062653444 9:137590154-137590176 CCCCGCGCGGAGGCCTGGACGGG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653426_1062653452 25 Left 1062653426 9:137590120-137590142 CCGCCCCGGCCGCCGCCCGCACA 0: 1
1: 0
2: 3
3: 66
4: 713
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653446_1062653452 -10 Left 1062653446 9:137590155-137590177 CCCGCGCGGAGGCCTGGACGGGC 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653428_1062653452 21 Left 1062653428 9:137590124-137590146 CCCGGCCGCCGCCCGCACAACCG 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653423_1062653452 28 Left 1062653423 9:137590117-137590139 CCCCCGCCCCGGCCGCCGCCCGC 0: 1
1: 6
2: 96
3: 740
4: 4315
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653439_1062653452 -3 Left 1062653439 9:137590148-137590170 CCCCGGCCCCGCGCGGAGGCCTG 0: 1
1: 1
2: 1
3: 20
4: 214
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653436_1062653452 1 Left 1062653436 9:137590144-137590166 CCGCCCCCGGCCCCGCGCGGAGG 0: 1
1: 0
2: 6
3: 57
4: 694
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653424_1062653452 27 Left 1062653424 9:137590118-137590140 CCCCGCCCCGGCCGCCGCCCGCA 0: 1
1: 2
2: 14
3: 210
4: 1323
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653432_1062653452 13 Left 1062653432 9:137590132-137590154 CCGCCCGCACAACCGCCCCCGGC 0: 1
1: 0
2: 1
3: 33
4: 455
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653440_1062653452 -4 Left 1062653440 9:137590149-137590171 CCCGGCCCCGCGCGGAGGCCTGG 0: 1
1: 0
2: 1
3: 31
4: 331
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653434_1062653452 9 Left 1062653434 9:137590136-137590158 CCGCACAACCGCCCCCGGCCCCG 0: 1
1: 0
2: 1
3: 53
4: 658
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653429_1062653452 20 Left 1062653429 9:137590125-137590147 CCGGCCGCCGCCCGCACAACCGC 0: 1
1: 0
2: 2
3: 27
4: 265
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653427_1062653452 22 Left 1062653427 9:137590123-137590145 CCCCGGCCGCCGCCCGCACAACC 0: 1
1: 0
2: 0
3: 22
4: 378
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653442_1062653452 -5 Left 1062653442 9:137590150-137590172 CCGGCCCCGCGCGGAGGCCTGGA 0: 1
1: 0
2: 3
3: 23
4: 203
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653425_1062653452 26 Left 1062653425 9:137590119-137590141 CCCGCCCCGGCCGCCGCCCGCAC 0: 1
1: 1
2: 16
3: 184
4: 1398
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1062653438_1062653452 -2 Left 1062653438 9:137590147-137590169 CCCCCGGCCCCGCGCGGAGGCCT 0: 1
1: 1
2: 3
3: 18
4: 184
Right 1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062653452 Original CRISPR CTGGACGGGCGAGACGGGCC GGG Intronic
900214141 1:1472118-1472140 GCGGGCGGGCGGGACGGGCCGGG + Intronic
900221689 1:1512502-1512524 GCGGGCGGGCGGGACGGGCCGGG + Intronic
900466201 1:2826668-2826690 CTGGACGAGGGAGATGGCCCAGG - Intergenic
901852064 1:12022077-12022099 CTTGACTGGAGAGAGGGGCCGGG - Exonic
902770083 1:18640821-18640843 CTGGAGGGGCGCGCCGGGCCGGG + Intronic
902951008 1:19882727-19882749 GGGGACGGGTGAGGCGGGCCGGG + Exonic
905422852 1:37859980-37860002 CTGGACGGCCGCGACGTTCCCGG + Intergenic
912505167 1:110151028-110151050 CTGGAGCGGCGAGAGGAGCCCGG - Intronic
913453561 1:119008432-119008454 CTGGCCCGGCGCGGCGGGCCAGG + Intergenic
919101838 1:193105470-193105492 CCGGAGGGGCGGGACGGGGCGGG - Intronic
920099654 1:203508882-203508904 CTGGAAGGGCTGGACAGGCCAGG - Intergenic
921980507 1:221252211-221252233 CTGGAAGGGCCAGGTGGGCCAGG + Intergenic
924625029 1:245690267-245690289 CGGGAGGGGAGAGACAGGCCAGG - Intronic
1063081648 10:2773064-2773086 CTGGGTGGAGGAGACGGGCCTGG + Intergenic
1070819723 10:79347767-79347789 CTGGGCGCGGGACACGGGCCCGG + Intronic
1076443700 10:130497627-130497649 CTGGACCGTCCACACGGGCCTGG - Intergenic
1077492748 11:2869755-2869777 CTGCACGGGCACGACGGCCCCGG - Intergenic
1081638823 11:44739095-44739117 CTGGACGGGAGCAAAGGGCCAGG - Intronic
1083648480 11:64186482-64186504 CTGGTTGGGCGAGGAGGGCCCGG + Intronic
1085458659 11:76680076-76680098 TTGGAAGGACAAGACGGGCCAGG + Intergenic
1089442729 11:118530628-118530650 CGGGACCGACGAGACGGGCGGGG - Intronic
1094814041 12:34166622-34166644 TTGGAGGGGCCAGACGAGCCAGG + Intergenic
1096463630 12:51836491-51836513 CTGGACATGAGAGACTGGCCAGG - Intergenic
1096473921 12:51896477-51896499 GTGGAAGGTCCAGACGGGCCAGG - Intergenic
1096659507 12:53115522-53115544 CTGGACGCAGGCGACGGGCCTGG + Exonic
1101479599 12:105084374-105084396 CTGGCCGGGTGAGTCCGGCCCGG - Exonic
1101940887 12:109098223-109098245 CTGGAGCGGGGAGACGGGCTGGG - Intronic
1103516108 12:121509521-121509543 CTGGGCGGCCGAGGAGGGCCGGG - Intronic
1105000658 12:132687856-132687878 CTGGACGGGAGCGCCGGGCCGGG + Intronic
1108029257 13:46211886-46211908 CGGGACAGGCGAGGCGGGCGCGG - Intergenic
1114474299 14:22982760-22982782 CTGGACGTGAGAGGCGGGCAGGG + Intergenic
1116957983 14:50943858-50943880 GTGGACAGGCGAGAGGGGCCTGG + Intronic
1117131936 14:52695608-52695630 CAGGAGGGCCGAGGCGGGCCTGG - Exonic
1119539331 14:75428282-75428304 CGGGACGGGCGGGGCGGGGCAGG + Intronic
1119759190 14:77139595-77139617 CAGGGCGGGCGAGAAGAGCCGGG + Exonic
1121225447 14:92318597-92318619 CTGGAGGGGCCAGAAGGGTCTGG + Intergenic
1122183511 14:99972020-99972042 GGGGACGGGCGCGCCGGGCCAGG - Intronic
1122862491 14:104588788-104588810 CAGGACGGGCAGGACGGGCAGGG + Exonic
1123016682 14:105379028-105379050 CTGGATGGTCGGGAAGGGCCTGG + Intronic
1126517036 15:49550080-49550102 CTGGACGGGGGCGGCTGGCCGGG + Intronic
1129116711 15:73368779-73368801 CGGGACGGGCCGGACGGGCCGGG - Exonic
1129155068 15:73712564-73712586 CTGGACGAGGGAGTTGGGCCAGG + Intronic
1131257507 15:90871893-90871915 CCGGGGGGCCGAGACGGGCCCGG - Intronic
1132527781 16:426067-426089 CCGGGCGGGCCGGACGGGCCGGG + Exonic
1132580795 16:683817-683839 CAGCACGGGCGAGAGTGGCCGGG + Intronic
1132939700 16:2500633-2500655 CTGGAAGGGAGAGACCAGCCTGG + Intronic
1133293439 16:4737671-4737693 CTGGACGGGCTGGATGGGCTGGG + Intronic
1133998091 16:10762748-10762770 CGGGACAGGAGAGAGGGGCCGGG + Intronic
1136985791 16:35103060-35103082 ATGGGCGGGGGAGGCGGGCCTGG - Intergenic
1142211712 16:88811638-88811660 CAGGACGGGCGAGATGTCCCTGG + Exonic
1142440415 16:90094310-90094332 CGGGAGGGGCCAGACAGGCCGGG - Intergenic
1142685506 17:1575050-1575072 CTGGACAGGCGACAGGGGGCTGG + Exonic
1142758634 17:2030203-2030225 CAGGGCGGCCGAGACGGCCCTGG + Exonic
1142993743 17:3748859-3748881 ATGGAGGGGCGGGAAGGGCCAGG + Intronic
1145941160 17:28744076-28744098 CGGCACGGGCGAGCGGGGCCAGG - Exonic
1150150879 17:62808125-62808147 CTGGGCGGGCGGGCCGGTCCAGG + Exonic
1150823891 17:68457616-68457638 CTGGAGGGGCGAGAAGGGGCGGG - Intergenic
1151977417 17:77490509-77490531 CTGCACAGGCCAGGCGGGCCAGG - Intronic
1152460577 17:80440000-80440022 CAGGAGGGCCGAGAGGGGCCGGG + Intergenic
1152957147 18:49248-49270 CGGGAGGGGCCAGACAGGCCGGG + Intronic
1153805447 18:8705821-8705843 CGGGCCGGGCGCGGCGGGCCGGG - Intronic
1153995375 18:10436095-10436117 CTGGAAGGGCTAGATGGGTCCGG + Intergenic
1154246379 18:12702960-12702982 CTGGACGGGCCTCAAGGGCCCGG + Exonic
1156473952 18:37394221-37394243 CTGGACAGGCGCGAGGGGCGGGG + Intronic
1160747820 19:720105-720127 CTAGACGGGCGGGAGGGGTCGGG - Intronic
1160974197 19:1784707-1784729 TTGGAGGGCCGAGAGGGGCCGGG + Intronic
1161087701 19:2342865-2342887 CAGGACGGTGGACACGGGCCTGG - Intronic
1161209731 19:3060163-3060185 CTGGAGGGGCACGCCGGGCCTGG - Intronic
1162743914 19:12788786-12788808 CTGGGCGGGAGACACAGGCCTGG + Intronic
1162995686 19:14333671-14333693 CTGGGCTGGCGGGAAGGGCCCGG - Intergenic
1163370272 19:16897514-16897536 CTGTACGGGGGAGGCGGGGCTGG - Intronic
1163631497 19:18419955-18419977 GTGGACGGGCGAGACCGGAGCGG + Intronic
1166039193 19:40191813-40191835 CTGTACGGGCGGGGCGGGGCGGG - Exonic
1166892191 19:46000477-46000499 TTGGACGGGAGAGAGGGGGCTGG + Intronic
1168189044 19:54724968-54724990 CTGGAATGGAGACACGGGCCTGG + Intronic
1168193309 19:54755764-54755786 CTGGATTGGCGATATGGGCCTGG + Intronic
1168195285 19:54770152-54770174 CTGGAGGGGAGATATGGGCCTGG + Intronic
1168201106 19:54816799-54816821 CTGGAGGGGAGATATGGGCCTGG + Intronic
1168203574 19:54834042-54834064 CTGGAGTGGAGATACGGGCCTGG + Intronic
1168205878 19:54850679-54850701 CTGGAGGGGAGATATGGGCCTGG + Intronic
1168205889 19:54850718-54850740 CTGGAGTGGAGATACGGGCCTGG + Intronic
926250969 2:11155334-11155356 CGGGAGGGGCGGGGCGGGCCCGG + Intronic
927195316 2:20542601-20542623 CTGGACAGGGGAGGCGGGCAGGG + Intergenic
932886765 2:75555756-75555778 CTGGAGGGCAGAGATGGGCCTGG - Intronic
934728099 2:96638124-96638146 CTGGTCGGGCGGGGCGGGTCGGG - Intronic
935729811 2:106056039-106056061 CTGGAGAGGAGAGACCGGCCCGG - Intergenic
937228753 2:120384693-120384715 CTGGATGGGGGAGTCTGGCCTGG + Intergenic
937983829 2:127629745-127629767 CAGGACAGGCAAGACGGGGCTGG + Exonic
942072418 2:172327810-172327832 CTGGAGGGGTGGGAGGGGCCAGG + Intergenic
946421509 2:219567677-219567699 CTGGACAGGCGAGGCAGGGCAGG - Intronic
946497023 2:220205149-220205171 CTGCAAGGGTGAGACAGGCCAGG + Intergenic
948361167 2:237421671-237421693 GGGGCCGGCCGAGACGGGCCGGG + Exonic
948387649 2:237591509-237591531 CTGGAGGGGGGACACTGGCCTGG + Intronic
948438022 2:237967100-237967122 CGAGACAGGCGAGGCGGGCCCGG - Exonic
1169151936 20:3296274-3296296 CAAGACAGGTGAGACGGGCCCGG + Intronic
1169164207 20:3407997-3408019 CTGGTCGGGCGGGGCGGGGCGGG - Intergenic
1170793089 20:19523948-19523970 CTGGACAGGCAAGAAGTGCCAGG + Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173521393 20:43702881-43702903 CTGGGAGGGCGAGAAGGGCAGGG - Exonic
1176257410 20:64159511-64159533 CTGGATGGGAGAGACTAGCCTGG + Intronic
1179638551 21:42731606-42731628 CTGCACGGGGGAGGCAGGCCTGG - Intronic
1180615052 22:17121178-17121200 CCGGGCGGGCGAGGCGGGCTAGG + Exonic
1181513732 22:23400218-23400240 CTGGATGGGCGAGGCAGGCGTGG + Intergenic
1183427142 22:37746112-37746134 ATGGAAGCGCGAGACGGGCCGGG - Intronic
1183535300 22:38397894-38397916 CGGGACGGTCCACACGGGCCAGG - Intronic
1184043439 22:41957937-41957959 CTGGGCGGGCGGGGCGGGCTGGG - Intergenic
1184759406 22:46536469-46536491 CGGGGCCGGCGCGACGGGCCCGG - Exonic
950480811 3:13242628-13242650 CTGGGTGGGCGACATGGGCCTGG + Intergenic
951078709 3:18425828-18425850 CAGGACGGGCAGGACGGGCACGG + Intronic
953989944 3:47476078-47476100 ATGGACGGCCGGGCCGGGCCGGG + Exonic
954110375 3:48429854-48429876 CTGGACGGGCGGGAAGAGGCCGG - Intronic
956574516 3:70737157-70737179 CTGCAGGGGAGAGACAGGCCAGG + Intergenic
961349772 3:126292380-126292402 CTGGGCAGGCGAGATGGCCCAGG - Intergenic
968583156 4:1404120-1404142 CTGGACGGGTGCTGCGGGCCGGG + Intronic
969358443 4:6645791-6645813 CTGGAAGGGGGAGAATGGCCAGG - Intergenic
975779014 4:77819761-77819783 CGGGGCGGGCGGGCCGGGCCGGG + Intergenic
980130380 4:128811663-128811685 CGGGGCGGGCGCGGCGGGCCGGG - Intronic
985441417 4:189984562-189984584 CGGGAGGGGCCAGACAGGCCGGG + Intergenic
986125811 5:4881591-4881613 CTGGAGGGGCAACACGGGGCAGG - Intergenic
992795980 5:80255702-80255724 CTGGGCGGGCGGGAAGGGGCAGG - Intronic
1007779827 6:44246428-44246450 CGGGACCGCCGAGACAGGCCTGG + Intronic
1013306139 6:108848601-108848623 CAGGGCGGGAGAGGCGGGCCGGG - Intronic
1013585224 6:111572354-111572376 CTGGATGGGTGATACTGGCCAGG - Intronic
1018613285 6:165662848-165662870 CGGGAGGGGCGCGGCGGGCCGGG + Intronic
1019896969 7:3990265-3990287 CTGCAAGGGGGAGAAGGGCCTGG - Intronic
1024049606 7:45610356-45610378 CTGGACAGAAGAGAAGGGCCCGG - Intronic
1025227970 7:57180196-57180218 CTAGAGGGGCGGGATGGGCCTGG + Intergenic
1025940939 7:66075872-66075894 CCGGATGGGCGGGACGGGCGTGG + Intronic
1029374932 7:100171679-100171701 CTGGGCGGGCGAGAGGGGGCGGG + Intronic
1034284308 7:149874214-149874236 GCGGAGGGGCGAGCCGGGCCAGG - Intronic
1035369236 7:158368557-158368579 CTGTGCGGGCGGGCCGGGCCAGG - Intronic
1037878131 8:22558920-22558942 CTGGACGGGCAAGGAGAGCCTGG + Intronic
1040567507 8:48581238-48581260 CTGGATGGGCGAGCCGGGGGAGG + Intergenic
1049597037 8:143489492-143489514 CTGGCCAGGGGAGAGGGGCCAGG + Intronic
1049614285 8:143569339-143569361 CTGGGCGGGAGAGACGGGGGCGG + Intronic
1049621045 8:143598493-143598515 CTTGACGGGCGGGCCGGGCGCGG - Exonic
1051818119 9:21133539-21133561 CAGGACAGGATAGACGGGCCCGG - Intergenic
1060182905 9:121546183-121546205 CTGGACAGGCCAGGCGGGGCGGG + Intergenic
1060747114 9:126145031-126145053 CGGGACAGAGGAGACGGGCCAGG - Intergenic
1061261448 9:129482834-129482856 CCCGGCGGGCGAAACGGGCCGGG + Intergenic
1061580122 9:131531221-131531243 CTGGGCGGGCGCGCCGGGCCTGG - Intronic
1062048429 9:134435055-134435077 CTGAGCTGGCGAGATGGGCCAGG - Intronic
1062179731 9:135184891-135184913 CCGGGCGGGCGAGCCGGGCCTGG - Intergenic
1062335026 9:136061214-136061236 CTGGTCGGGAGGGACAGGCCAGG + Intronic
1062653452 9:137590168-137590190 CTGGACGGGCGAGACGGGCCGGG + Intronic
1062678349 9:137761969-137761991 CCGGATGGGAGAGACGGGCAAGG - Intronic
1062741003 9:138175330-138175352 CGGGAGGGGCCAGACAGGCCGGG - Intergenic
1186340115 X:8635996-8636018 CTTCACTGGGGAGACGGGCCTGG - Intronic
1186378428 X:9033232-9033254 GGGGACGGGCTGGACGGGCCAGG - Intronic
1198005601 X:132489764-132489786 CTGGCCGGGCGGGGCGGGGCCGG - Intronic