ID: 1062656063

View in Genome Browser
Species Human (GRCh38)
Location 9:137605195-137605217
Sequence GCCCCCCGACGGAGACGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062656050_1062656063 15 Left 1062656050 9:137605157-137605179 CCAGTCTCAGAGCTCGCCTCGGC No data
Right 1062656063 9:137605195-137605217 GCCCCCCGACGGAGACGCGGCGG No data
1062656051_1062656063 -1 Left 1062656051 9:137605173-137605195 CCTCGGCCCCGCCCCCAGCCCTG No data
Right 1062656063 9:137605195-137605217 GCCCCCCGACGGAGACGCGGCGG No data
1062656047_1062656063 20 Left 1062656047 9:137605152-137605174 CCTTCCCAGTCTCAGAGCTCGCC No data
Right 1062656063 9:137605195-137605217 GCCCCCCGACGGAGACGCGGCGG No data
1062656048_1062656063 16 Left 1062656048 9:137605156-137605178 CCCAGTCTCAGAGCTCGCCTCGG No data
Right 1062656063 9:137605195-137605217 GCCCCCCGACGGAGACGCGGCGG No data
1062656053_1062656063 -8 Left 1062656053 9:137605180-137605202 CCCGCCCCCAGCCCTGCCCCCCG No data
Right 1062656063 9:137605195-137605217 GCCCCCCGACGGAGACGCGGCGG No data
1062656052_1062656063 -7 Left 1062656052 9:137605179-137605201 CCCCGCCCCCAGCCCTGCCCCCC No data
Right 1062656063 9:137605195-137605217 GCCCCCCGACGGAGACGCGGCGG No data
1062656054_1062656063 -9 Left 1062656054 9:137605181-137605203 CCGCCCCCAGCCCTGCCCCCCGA No data
Right 1062656063 9:137605195-137605217 GCCCCCCGACGGAGACGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062656063 Original CRISPR GCCCCCCGACGGAGACGCGG CGG Intergenic
No off target data available for this crispr