ID: 1062658061

View in Genome Browser
Species Human (GRCh38)
Location 9:137614338-137614360
Sequence CGGACCATTGCGGAGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062658049_1062658061 22 Left 1062658049 9:137614293-137614315 CCCCAGAAAGTGTCCTATAAGGC 0: 1
1: 0
2: 1
3: 7
4: 108
Right 1062658061 9:137614338-137614360 CGGACCATTGCGGAGGTGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 109
1062658051_1062658061 20 Left 1062658051 9:137614295-137614317 CCAGAAAGTGTCCTATAAGGCCA 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1062658061 9:137614338-137614360 CGGACCATTGCGGAGGTGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 109
1062658050_1062658061 21 Left 1062658050 9:137614294-137614316 CCCAGAAAGTGTCCTATAAGGCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1062658061 9:137614338-137614360 CGGACCATTGCGGAGGTGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 109
1062658054_1062658061 0 Left 1062658054 9:137614315-137614337 CCAAGCGCTGGATCCACGACGTA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1062658061 9:137614338-137614360 CGGACCATTGCGGAGGTGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 109
1062658047_1062658061 26 Left 1062658047 9:137614289-137614311 CCTTCCCCAGAAAGTGTCCTATA 0: 1
1: 1
2: 1
3: 15
4: 200
Right 1062658061 9:137614338-137614360 CGGACCATTGCGGAGGTGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 109
1062658053_1062658061 9 Left 1062658053 9:137614306-137614328 CCTATAAGGCCAAGCGCTGGATC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1062658061 9:137614338-137614360 CGGACCATTGCGGAGGTGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062658061 Original CRISPR CGGACCATTGCGGAGGTGGA GGG Exonic
908340384 1:63172438-63172460 AGGAACATTGCAGAGGTGGCAGG - Intergenic
910085986 1:83403047-83403069 TTGATCATTGCAGAGGTGGAGGG + Intergenic
913971417 1:143420824-143420846 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914065794 1:144246437-144246459 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914113357 1:144719917-144719939 CAGAGTATTGAGGAGGTGGAGGG - Intergenic
1073547871 10:104367756-104367778 GGGAATATTGAGGAGGTGGAGGG - Intronic
1077018926 11:408940-408962 CGGACCACTGTGGAGGTGGTGGG - Intronic
1077284924 11:1761415-1761437 CGGACCATGTCGGAGGTTGGGGG - Exonic
1077519241 11:3021794-3021816 CAGAACAGTGCGGAGGTAGAAGG - Intronic
1083475543 11:62912772-62912794 CTGACCATTGAAGAGGTTGAGGG + Intronic
1084093484 11:66894663-66894685 CAGCCCATTGTGGAGGTGGGAGG - Intronic
1084882040 11:72178260-72178282 CGGACAAAAGCGCAGGTGGAAGG + Intergenic
1089338818 11:117744004-117744026 CGGATTATTGCAGAGCTGGATGG + Intronic
1089559424 11:119336357-119336379 CGGGCAATTGCGGTGGTAGACGG - Exonic
1097177528 12:57152015-57152037 CTGGCCTTTGGGGAGGTGGAAGG + Intronic
1100618409 12:96249378-96249400 CGCGCCACTGCGGAGGGGGAGGG + Intronic
1107708895 13:43133291-43133313 CTGACCTTTGCAGGGGTGGAAGG - Intergenic
1111204739 13:84990880-84990902 CGTACCTTAGCAGAGGTGGAAGG - Intergenic
1114059938 14:19009338-19009360 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
1114060133 14:19010502-19010524 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
1114060231 14:19011130-19011152 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
1114060428 14:19012273-19012295 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
1114060747 14:19014250-19014272 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
1114101507 14:19385730-19385752 CGCACCCTTGCAGAGGTGGCTGG + Intergenic
1114101826 14:19387705-19387727 CGCACCCTTGCAGAGGTGGCTGG + Intergenic
1114101925 14:19388333-19388355 CGCACCCTTGCAGAGGTGGCTGG + Intergenic
1114102119 14:19389476-19389498 CGCACCCTTGCAGAGGTGGCTGG + Intergenic
1114102314 14:19390641-19390663 CGCACCCTTGCAGAGGTGGCTGG + Intergenic
1114102414 14:19391269-19391291 CGCACCCTTGCAGAGGTGGCTGG + Intergenic
1114102607 14:19392413-19392435 CGCACCCTTGCAGAGGTGGCTGG + Intergenic
1114252140 14:20970905-20970927 CTTTCCATTGCGGAGGTGGCTGG - Intergenic
1114266935 14:21078228-21078250 CAGGCCATTGAGGAGCTGGAGGG + Exonic
1118054003 14:62059059-62059081 GGGACCTTTGGGAAGGTGGAGGG + Intronic
1122984385 14:105205536-105205558 CGGAGCATTGCTGGGGTGGGAGG - Intergenic
1123092755 14:105749061-105749083 AGGACGATTGTGGAGGTGGGAGG + Intergenic
1202833428 14_GL000009v2_random:59716-59738 CACACCATTGCAGAGGTGGGTGG + Intergenic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1125448832 15:39786620-39786642 CGGACCCCTGAGGAGATGGAGGG - Intergenic
1138962048 16:62038772-62038794 TGGAGCATTGCGGGGGAGGAAGG + Intergenic
1139410000 16:66751497-66751519 CTGACCAGTGAGGAGGAGGAAGG - Exonic
1148206733 17:45784257-45784279 CGGACCGTGGGGGAGGTGGCGGG + Intergenic
1152438432 17:80289975-80289997 GGGACCACTTAGGAGGTGGAGGG + Intronic
1154453635 18:14501786-14501808 CACACCCTTGCGGAGGTGGCTGG - Intergenic
1154453678 18:14502020-14502042 CACACCCTTGCGGAGGTGGCTGG + Intergenic
1158302351 18:56066067-56066089 CTTAGCATTGGGGAGGTGGAGGG + Intergenic
1158647856 18:59263945-59263967 CCGACCCTTGTGGAGGCGGATGG - Intergenic
1161556055 19:4943388-4943410 ATGACAATTGCGGATGTGGATGG + Intronic
1163124323 19:15236594-15236616 TGGACCCTGGCTGAGGTGGAGGG - Exonic
1164831504 19:31325074-31325096 CGGAGCACAGCGGAGGTGGCTGG - Intronic
1166125993 19:40715699-40715721 CGCACCATTCCGCAGGTGGGCGG - Intronic
1166994628 19:46714287-46714309 CGGAACCTGGCGGAGGTGGGAGG + Intronic
928913722 2:36449252-36449274 GGGAGCATTGTGGAGCTGGAAGG + Intronic
932221916 2:70006286-70006308 CAGACCTTTGCGGAGGTGGGAGG - Intergenic
934176108 2:89581757-89581779 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
934286418 2:91656119-91656141 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
934538833 2:95158738-95158760 ATGACCGTGGCGGAGGTGGAGGG - Intronic
936461009 2:112713811-112713833 CTGAGGATCGCGGAGGTGGAGGG - Intergenic
938281696 2:130067930-130067952 CGCACCCTTGCAGAGGTGGCTGG + Intergenic
938332189 2:130455662-130455684 TGCACCATTGCAGAGGTGGCTGG + Intergenic
938332317 2:130456479-130456501 CGCACCCTTGCAGAGGTGGCTGG + Intergenic
938357490 2:130664189-130664211 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
938433925 2:131270976-131270998 CGCACCCTTGCAGAGGTGGCTGG - Intronic
938477965 2:131633622-131633644 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
938478316 2:131635774-131635796 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
938478424 2:131636412-131636434 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
939518464 2:143199787-143199809 GTGTCCATTGGGGAGGTGGATGG - Intronic
945225535 2:207529238-207529260 CGGACCATGGCTGACGTCGACGG - Intergenic
948058987 2:235029947-235029969 AGGAACAATGCAGAGGTGGACGG + Intronic
948945926 2:241218568-241218590 CGGAGCTTTGCGGGGCTGGAGGG + Intronic
1169144658 20:3244495-3244517 CGGCCCCTTGGGTAGGTGGAAGG + Intergenic
1175515054 20:59564218-59564240 CGGCCCATTGAGGAGATGGTTGG + Intergenic
1176129808 20:63491943-63491965 CGGACGGATGGGGAGGTGGATGG + Intronic
1176820503 21:13651285-13651307 CACACCCTTGCGGAGGTGGCTGG - Intergenic
1176820548 21:13651519-13651541 CACACCCTTGCGGAGGTGGCTGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180478416 22:15731950-15731972 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
1180478614 22:15733114-15733136 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
1180478710 22:15733742-15733764 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
1180478909 22:15734885-15734907 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
1180479230 22:15736862-15736884 CGCACCCTTGCAGAGGTGGCTGG - Intergenic
1184788047 22:46681218-46681240 CGGGCCATGGAGGAGGCGGAGGG + Intergenic
953815440 3:46152617-46152639 GGGACCGTTGCGGGGGTGGGGGG + Intergenic
954452747 3:50580456-50580478 CTGACCAGAGGGGAGGTGGATGG + Exonic
955688188 3:61564749-61564771 CCGACCAGTGTGGAGGTGGCAGG - Intronic
963794211 3:149615448-149615470 TGGACGATTGCTGAAGTGGAGGG + Intronic
1202766593 4_GL000008v2_random:153849-153871 CACACCATTGCAGAGGTGGGTGG - Intergenic
987593981 5:19971681-19971703 GGGACCTTTCCGAAGGTGGAGGG + Intronic
990504917 5:56434487-56434509 CAGAGCATTGTAGAGGTGGAAGG - Intergenic
1008849832 6:56011749-56011771 AGGAACATTGAGAAGGTGGAAGG + Intergenic
1015453128 6:133393437-133393459 AGGAACATTGCGGAGGGGAATGG + Intronic
1028907363 7:96169869-96169891 CGAACCATTCCAGAGGTGGAAGG - Intronic
1031045431 7:116881785-116881807 TGGACCAGGGCGGGGGTGGAGGG - Intronic
1038309898 8:26438413-26438435 GAAACCATTCCGGAGGTGGATGG + Intronic
1041327978 8:56689385-56689407 GGGAGCATAGAGGAGGTGGATGG + Intergenic
1049463048 8:142738955-142738977 GGCACCCTTGGGGAGGTGGAGGG + Intergenic
1049523665 8:143108988-143109010 GGGACCATCGCGGAAGAGGAGGG - Intergenic
1058905921 9:109482707-109482729 CAGAGCATTGCAGAGGTGGTAGG - Intronic
1061766658 9:132885912-132885934 CAGAGCATTGCGGGGGTGGGGGG - Intronic
1062658061 9:137614338-137614360 CGGACCATTGCGGAGGTGGAGGG + Exonic
1203526702 Un_GL000213v1:97402-97424 CACACCCTTGCGGAGGTGGCTGG - Intergenic
1203526747 Un_GL000213v1:97636-97658 CACACCCTTGCGGAGGTGGCTGG + Intergenic
1203547398 Un_KI270743v1:138961-138983 CACACCATTGCAGAGGTGGCTGG + Intergenic
1191076832 X:56462851-56462873 TGGACCAGTGTGTAGGTGGAGGG + Intergenic
1198854586 X:141002872-141002894 CAGACCATTGTGGAAGTGGGGGG + Intronic
1198877432 X:141242275-141242297 CAGACCATTGTGGAAGTGGGGGG - Intronic
1198908115 X:141584496-141584518 CAGACCATTGTGGAAGTGGGGGG - Intronic
1198908676 X:141589928-141589950 CAGACCATTGTGGAAGTGGGGGG + Intronic
1198918394 X:141698223-141698245 CAGACCATTGTGGAAGTGGGGGG - Intronic
1201796705 Y:17903998-17904020 AGGAACATTACGGAGGTAGAAGG + Intergenic
1201804849 Y:18001987-18002009 AGGAACATTACGGAGGTAGAAGG - Intergenic
1202358085 Y:24073060-24073082 AGGAACATTACGGAGGTAGAAGG + Intergenic
1202512693 Y:25597053-25597075 AGGAACATTACGGAGGTAGAAGG - Intergenic