ID: 1062664699

View in Genome Browser
Species Human (GRCh38)
Location 9:137663078-137663100
Sequence CAGGCCAGGACTGGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1155
Summary {0: 1, 1: 0, 2: 15, 3: 137, 4: 1002}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062664699 Original CRISPR CAGGCCAGGACTGGGCGCGG TGG (reversed) Intronic
900017605 1:163840-163862 CAGGCCCAGGCTGGGCGCAGTGG + Intergenic
900047864 1:522436-522458 CAGGCCCAGGCTGGGCGCAGTGG + Intergenic
900070081 1:764300-764322 CAGGCCCAGGCTGGGCGCAGTGG + Intergenic
900107194 1:987945-987967 CATGAAAAGACTGGGCGCGGCGG - Intergenic
900186272 1:1334677-1334699 CAGGCCTGGTCTGGGCACAGAGG - Exonic
900192659 1:1358075-1358097 CAGCCCAGGCCTGGGAGCGGGGG + Intronic
900307452 1:2018049-2018071 CAGGCTAGGGCTGGGTGCAGTGG + Intergenic
900405296 1:2490309-2490331 GAGGCCAGCACTGGCCACGGGGG - Intronic
900413274 1:2523346-2523368 CCGGCCAGCACTGGGGGCAGGGG - Intronic
900605177 1:3520634-3520656 CACACCAGGACTGGGCGGGCAGG + Intronic
901021526 1:6258414-6258436 CAGCACAAGGCTGGGCGCGGTGG - Intronic
901365824 1:8747286-8747308 TAAGTCAGGGCTGGGCGCGGTGG - Intronic
901553964 1:10017107-10017129 CTGCCCAGGGCTGGGTGCGGTGG - Intergenic
901630398 1:10645241-10645263 CAGCGCAGGGCCGGGCGCGGTGG + Intronic
901633037 1:10657072-10657094 CTGGCCAGAACTGGGCGGGCTGG - Intronic
901842964 1:11965302-11965324 CAGGCCTGGGCTGGGCCCTGGGG + Intronic
902056374 1:13603872-13603894 CTAGGCAGGGCTGGGCGCGGTGG - Intronic
902224287 1:14986993-14987015 CAGGCCAGGGCTGGGCACTGAGG + Intronic
902226517 1:14999761-14999783 CAGGCCAGGCCTGGACCCAGAGG + Intronic
902339700 1:15774929-15774951 CAGGGCTGGGCTGGGCGCGGTGG + Exonic
902397249 1:16139116-16139138 CAGGACAGGACTGGCCACTGGGG - Intronic
902445016 1:16457166-16457188 GAGGCATGGGCTGGGCGCGGTGG + Intronic
902595804 1:17508821-17508843 CAGGACAGGGCTGGGCACAGTGG - Intergenic
902681771 1:18048819-18048841 CAGTCCAGGGCTGGGGGAGGTGG - Intergenic
902698214 1:18154590-18154612 CAGGGCAGGGCTGGGTGAGGAGG + Intronic
902912070 1:19606456-19606478 ATGGCCAGGGCTGGGCACGGTGG + Intronic
903132736 1:21290246-21290268 CAGGCCGGGGCGGGGCGCGGCGG - Intronic
903471679 1:23591843-23591865 CAGGCCAAGCCTGGGGGTGGGGG + Intronic
903774729 1:25785497-25785519 CAGGAAAGGACTGGGTGTGGTGG - Exonic
903835187 1:26199017-26199039 CTGGCCGGGGCCGGGCGCGGTGG + Intronic
904001897 1:27343383-27343405 CAGGGCAGGGCTGGCGGCGGGGG + Intronic
904060726 1:27708124-27708146 CTGGCCAGGGCTGGGCACGGTGG - Intergenic
904161666 1:28526606-28526628 AAGGATAGGGCTGGGCGCGGTGG + Intronic
904185424 1:28700223-28700245 CTGGGCATGGCTGGGCGCGGTGG + Intronic
904251695 1:29229489-29229511 CAGGCTAGAGCTGGGCACGGTGG - Intronic
904296230 1:29521410-29521432 CAGGCCTGGTCTGGGGGCAGTGG + Intergenic
904341430 1:29837403-29837425 CAGGCCAGGTCTGTGCGCTCAGG - Intergenic
904410101 1:30320036-30320058 CAGGCCTGGTCTGGGGGCAGTGG - Intergenic
904562094 1:31405727-31405749 AAGGCCAGGCCTGGGCCCTGGGG - Intergenic
904679901 1:32222067-32222089 AAGGCCAGGAGAGGGCGGGGTGG - Intronic
904716670 1:32473151-32473173 TAAGCCAAGGCTGGGCGCGGCGG + Intronic
904736983 1:32642214-32642236 ATGGCCAGGGCCGGGCGCGGTGG + Intronic
905042200 1:34969011-34969033 CAGTCCATGGCTGGGCGTGGTGG + Intergenic
905165260 1:36077936-36077958 CAGGCCAGGGCCGGGCACGGTGG + Intergenic
905190545 1:36230403-36230425 TTAGCCAGGGCTGGGCGCGGTGG - Intronic
905671577 1:39794089-39794111 AAAGCCAGGGCCGGGCGCGGTGG + Intergenic
905759377 1:40541468-40541490 CAGACCCAGGCTGGGCGCGGTGG - Intronic
905869927 1:41397550-41397572 CAAGCCAGGACCGAGCGCGGTGG - Intergenic
905912356 1:41662986-41663008 CAGGCCTGGGGTGGGGGCGGGGG + Intronic
906537912 1:46562106-46562128 CAGTTCAGGGCTGGGCGCGGTGG + Intronic
906629823 1:47357252-47357274 GAAGGCAGGGCTGGGCGCGGTGG - Intronic
907133819 1:52120586-52120608 CAGGCAAGGGCTGGGCACAGTGG - Intergenic
907220919 1:52906492-52906514 TGGGCCAGGACTGGGGGCAGGGG - Intronic
907326681 1:53642893-53642915 CAGGCCTGCACTGGGCACTGGGG - Intronic
907487348 1:54787066-54787088 CAGGCCAGGGCTGGGGGTGAAGG + Exonic
907681555 1:56568910-56568932 CATGACAGGGCCGGGCGCGGTGG - Intronic
908628486 1:66074639-66074661 CAGCCAAGGACTGGGGGAGGGGG - Intronic
908772692 1:67610602-67610624 CATGCCAGGACTCGGGGCAGAGG - Intergenic
909002318 1:70233525-70233547 CAGATCTGGACTGGGCGCGGTGG - Intronic
909451735 1:75805110-75805132 CAGGTCAGGGCTGGGTGCGGTGG - Intronic
909629629 1:77758459-77758481 AAGGTCAGGGCTGGGCACGGTGG - Intronic
910028128 1:82682863-82682885 CAGGTTCGGGCTGGGCGCGGTGG - Intergenic
910927890 1:92415154-92415176 CAGGCCATCGCTGGGTGCGGTGG + Intergenic
911049462 1:93658224-93658246 CAGTAACGGACTGGGCGCGGTGG - Intronic
912357014 1:109062325-109062347 CAGGACTGGGCCGGGCGCGGTGG - Intergenic
912836058 1:112997381-112997403 CAGGTCACGGCCGGGCGCGGTGG - Intergenic
913209235 1:116569887-116569909 GAGGCCTGGGCTGGGCGTGGTGG - Intronic
914233806 1:145789983-145790005 TAGGCCGGGACTGGGCGTGGTGG - Intronic
914245254 1:145880996-145881018 CAGGCCATGGCTGGGTGCGGTGG + Intronic
914807783 1:151004208-151004230 CTGGAGAGGACTGGGCACGGTGG - Intronic
914809556 1:151016787-151016809 TAGTCCAGGGCTGGGCGTGGTGG - Intronic
915504011 1:156340746-156340768 CAAGCTGGGGCTGGGCGCGGTGG - Intronic
915958990 1:160248446-160248468 CAGGCTGGGGCTGGGCGTGGAGG + Intronic
916552713 1:165864233-165864255 CAGGACCCGGCTGGGCGCGGTGG - Intronic
916796472 1:168172001-168172023 CAGGGCAGGGCTGGGCAGGGTGG + Intergenic
918040413 1:180910979-180911001 CAGGGCAAGGCTGGGCGTGGTGG + Intergenic
919072445 1:192773075-192773097 AGGGCCAGGGCTGGGCGCCGTGG - Intergenic
919102959 1:193116598-193116620 CAGAACAGGGCTGGGCACGGTGG + Intergenic
920155075 1:203942713-203942735 CAGGACAGGGCCGGGCGTGGTGG + Intergenic
920215177 1:204357843-204357865 CAGGCTGGGTCTGGGCGAGGTGG + Intronic
920670466 1:208000223-208000245 CAGGCCAGGGCTGAGGGCAGAGG + Intergenic
921174913 1:212585311-212585333 TTCGCCAGGACTGGGCACGGGGG - Intronic
921977762 1:221220889-221220911 CAGCTCTGGGCTGGGCGCGGTGG - Intergenic
922105450 1:222509756-222509778 CAGGCCCAGGCTGGGCGCAGTGG + Intergenic
922265787 1:223982335-223982357 CAGGCCCAGGCTGGGCGCAGTGG + Intergenic
922351644 1:224738996-224739018 CAGGGCAGGTCTGGGGGTGGAGG - Intronic
922444739 1:225687621-225687643 CCAGCCTGGGCTGGGCGCGGTGG + Intergenic
922538799 1:226403463-226403485 AAAGCCAGGACTGGGTGCAGTGG - Intronic
922717740 1:227886035-227886057 CAGGGCAGGACTGGACCCCGGGG + Intergenic
923174270 1:231448071-231448093 CAGGCTAGGGCTGGGCACAGTGG + Intergenic
923986342 1:239386834-239386856 CAGGGGAGCACAGGGCGCGGGGG + Intronic
923992342 1:239453085-239453107 CAAGCCTGGGCCGGGCGCGGTGG - Intronic
924210896 1:241766421-241766443 CAGGGAAGGGCTGGGCGCGGTGG + Intronic
924289758 1:242524822-242524844 CCGCCCGGGCCTGGGCGCGGCGG - Intergenic
924347625 1:243087287-243087309 CAGGCCCAGGCTGGGCGCAGTGG + Intergenic
924483632 1:244459362-244459384 CAAGCCCAGGCTGGGCGCGGTGG - Intronic
924599816 1:245478700-245478722 CAAGTCAGGGCCGGGCGCGGTGG - Intronic
1062886189 10:1018137-1018159 CAGGGCTGGGCTGGGCGCAGGGG + Exonic
1063097109 10:2917895-2917917 CAGGACAGGACTGGGAGCTGGGG - Intergenic
1063385071 10:5611306-5611328 CAGGCCTGGGCTGGGTGCTGGGG - Intergenic
1063405822 10:5793874-5793896 CACTCCAAGGCTGGGCGCGGTGG + Intronic
1063942223 10:11142395-11142417 CTGGGCTGGGCTGGGCGCGGTGG + Intronic
1064109688 10:12527661-12527683 CAAGTCAAAACTGGGCGCGGTGG - Intronic
1064230916 10:13528872-13528894 CGGGCCGGGCCGGGGCGCGGCGG + Intronic
1064750850 10:18527091-18527113 CAGGATAGGGCCGGGCGCGGTGG + Intronic
1065386085 10:25134413-25134435 CAGGAGAGGACTGGGCGTGGTGG - Intergenic
1065694771 10:28369772-28369794 CAGACAGGGGCTGGGCGCGGTGG + Intergenic
1065719676 10:28614378-28614400 CAAACTAGGGCTGGGCGCGGTGG - Intronic
1065931738 10:30485474-30485496 AAAGGCAGGGCTGGGCGCGGTGG - Intergenic
1066273786 10:33848488-33848510 CAGGAAATGGCTGGGCGCGGTGG - Intergenic
1066728729 10:38417597-38417619 CAGGCCCAGGCTGGGCGCAGTGG - Intergenic
1066997387 10:42576843-42576865 CAGTCCAGGGCCGGGCGCCGTGG + Intronic
1067950469 10:50731749-50731771 CAGGCAAAGGCTGGGCGCAGTGG - Intergenic
1068696483 10:59972934-59972956 CAGGCCAGGGCAGGGTGCAGTGG - Intergenic
1069632731 10:69907014-69907036 ATGGCCATAACTGGGCGCGGTGG - Intronic
1069641972 10:69962087-69962109 GAGGCCAGCACTGGGTGGGGCGG - Intronic
1069660103 10:70117770-70117792 CAGGCCAGGGCAGGGCAGGGAGG + Intronic
1069661920 10:70128706-70128728 CAGGCAAGGGCTGGGTGTGGTGG + Intronic
1069745134 10:70710156-70710178 CAGTCCAGGCCTGGGGGAGGTGG + Intronic
1069831174 10:71283318-71283340 CTGGCCCGGGCTGGGCGCTGTGG + Intronic
1069986340 10:72286731-72286753 CAGACGAGGGCCGGGCGCGGTGG + Intergenic
1070627114 10:78059219-78059241 GAGGTCAGGGCTGGGCGCGGTGG + Intergenic
1070779568 10:79129770-79129792 CAGGCCAGGGCTGGGGGCAGGGG - Intronic
1070780720 10:79136061-79136083 AAGGCCAGGCCTGGGGGAGGAGG - Intronic
1070812049 10:79303176-79303198 CAGGAGAGGACTGGGCACAGTGG + Intronic
1070858415 10:79628599-79628621 CAGTCCAGGGCTGGGCACAGAGG - Intergenic
1071342636 10:84662862-84662884 CAGGGAAGGACTGGGCTCGCTGG + Intergenic
1071553644 10:86585989-86586011 CAAACTAGGACTGGGCGGGGTGG - Intergenic
1071569127 10:86686970-86686992 AAGGCAAGGGCTGGGCGCGGTGG - Intronic
1072710060 10:97710422-97710444 CAGACCATGGCTGGGCACGGTGG - Intergenic
1073051760 10:100671488-100671510 CAGCTCAGGTCTCGGCGCGGTGG + Intergenic
1073194811 10:101681428-101681450 CAGGTCTAGGCTGGGCGCGGTGG + Intronic
1073224799 10:101909117-101909139 GAGACCAGGGCTGGGCGCAGTGG + Intronic
1073302258 10:102478044-102478066 AAGGCCAGCGCTGGGCACGGTGG + Intergenic
1073406535 10:103302730-103302752 CAGGCCAGGGCTGGGTGCAGTGG - Intergenic
1073967940 10:109013040-109013062 GAGGAGAGGGCTGGGCGCGGTGG + Intergenic
1074745046 10:116524048-116524070 CAGGGGAGGGCCGGGCGCGGGGG + Intergenic
1075630392 10:123997159-123997181 GAGGCCAGGGCTGGGGGCTGGGG + Intergenic
1076112329 10:127870855-127870877 CAGGTCAGGAGTGGGCTGGGAGG - Intergenic
1076670077 10:132115566-132115588 CAGGACAGGACTGGCAGAGGAGG + Intronic
1076847194 10:133075133-133075155 CAGGCCAGGGCTGGGGCCTGAGG - Intronic
1076974201 11:159046-159068 CAGGCCCAGGCTGGGCGCAGTGG + Intergenic
1076988068 11:253669-253691 CAGGCGAGGCCTGGACGAGGTGG - Intergenic
1077073298 11:687781-687803 GAAGACAGGGCTGGGCGCGGTGG - Intronic
1077084203 11:740130-740152 CTGGCCATGGCTGGGCGTGGTGG + Intergenic
1077085255 11:747054-747076 GGGGCCAGGACTGGGGTCGGGGG - Intergenic
1077096736 11:802175-802197 CAGGCATGGACAGGGCGTGGCGG - Exonic
1077100545 11:820400-820422 GAGGTCAGGGCTGGGCGCGAAGG + Intronic
1077201086 11:1307988-1308010 CAGCCCAGTACTGGACGTGGTGG - Intronic
1077250048 11:1556974-1556996 CAGGCCGAGGCTGTGCGCGGGGG + Exonic
1077390429 11:2298541-2298563 CTGGGCAGGACTGGGGGCAGGGG - Intronic
1077572016 11:3346875-3346897 CAGCCCAGGTCGGGGAGCGGAGG - Intronic
1078210342 11:9265188-9265210 CGGGCCAGGGCCGGGGGCGGCGG - Exonic
1079172436 11:18109147-18109169 GAGGCCAGGACTGGGCGCGATGG + Intergenic
1079194968 11:18317541-18317563 CAGGCCCAGGCTGGGCGTGGTGG - Intronic
1079208295 11:18437463-18437485 CTGGCCAGGGCCGGGCACGGTGG + Intronic
1079225787 11:18603673-18603695 CAGGCAAGGACTGGCAGGGGAGG - Intergenic
1079380874 11:19936154-19936176 CAGTTCATGGCTGGGCGCGGTGG - Intronic
1079570328 11:21935265-21935287 AAGTCCATGGCTGGGCGCGGTGG + Intergenic
1080386241 11:31812720-31812742 CACCCCAGGACAGGGCGAGGGGG + Intronic
1080588245 11:33700203-33700225 CAGGCTAAGGCTGGGCTCGGTGG + Intronic
1081494812 11:43597920-43597942 CAGGAGGGGGCTGGGCGCGGTGG - Intronic
1081662055 11:44894330-44894352 CTGGCCAGGAGAGGGCGCTGTGG - Intronic
1081978327 11:47249804-47249826 CAGGCTTGGCCTGGGCGCCGTGG + Intronic
1082833614 11:57637555-57637577 CAGGGCGAGGCTGGGCGCGGTGG - Intergenic
1083165651 11:60885029-60885051 TAGTCTAGGGCTGGGCGCGGTGG - Intergenic
1083249943 11:61459905-61459927 GAGGCCGGGGCTGGGCGCGGTGG - Intronic
1083267514 11:61553614-61553636 CAGGCCAGGACTTGATGTGGAGG + Intronic
1083630748 11:64094007-64094029 CAGGCCAGGGCCGGGCGCAGTGG + Intronic
1083654662 11:64223673-64223695 CAGGCCAGGGATGGGGGTGGGGG + Exonic
1083791886 11:64991075-64991097 GAGTCCAGGGCCGGGCGCGGTGG - Intronic
1083822396 11:65180911-65180933 GGGGCCAGGATTCGGCGCGGAGG - Exonic
1083879343 11:65540414-65540436 CAGGCCCGGGATGGGCGCGGTGG + Intronic
1083919779 11:65776176-65776198 CGGGCCTGGGCTGGGTGCGGTGG - Exonic
1084265710 11:68004130-68004152 CAGGGCGGGACAGGGCGGGGCGG - Intronic
1084270006 11:68023752-68023774 GATGGCAGGGCTGGGCGCGGTGG + Intronic
1084391241 11:68878568-68878590 AAGGGCAGGGCTGGGCACGGTGG + Intergenic
1084573329 11:69973194-69973216 GATGCCAGAGCTGGGCGCGGTGG - Intergenic
1084606222 11:70173761-70173783 AAGGCCAGGGCCGGGCGCAGTGG + Intronic
1084702904 11:70799108-70799130 CAGCAGAGGTCTGGGCGCGGTGG + Intronic
1084789078 11:71462134-71462156 CAGGCCATGACTGGGAGTGGGGG + Intronic
1085004348 11:73071402-73071424 GTGTCCAGGACTGGGCGCAGTGG + Intronic
1085030916 11:73270445-73270467 CAGGCCAGCACTGTGCTGGGAGG + Intronic
1085054883 11:73397779-73397801 TAGGCCAGGACTGGGCTGGGAGG + Intergenic
1085116110 11:73933487-73933509 AAGGACATGGCTGGGCGCGGTGG - Intergenic
1085249663 11:75134634-75134656 CAGACCTGGGCTGGGTGCGGTGG + Intronic
1085284066 11:75348875-75348897 CTGGACAGGGCTGTGCGCGGTGG - Intronic
1085338346 11:75714788-75714810 CAAGCTAGGGCTGGGCGCGGTGG + Intergenic
1085538593 11:77244317-77244339 TAGCCCAGGGCTGGGCGCGGTGG - Intronic
1086371096 11:86156547-86156569 CAGGCTAGGGCTGGGGGCTGGGG - Intergenic
1086452438 11:86930502-86930524 CTGACCAGGGCCGGGCGCGGCGG + Intronic
1087119282 11:94556105-94556127 AAGAACAGGGCTGGGCGCGGTGG - Intronic
1087556388 11:99727017-99727039 CAGGGCATGGCCGGGCGCGGTGG + Intronic
1087614087 11:100468732-100468754 CAGGTCTGGGCTGGGCGTGGTGG + Intergenic
1087758332 11:102078178-102078200 AAGGACCTGACTGGGCGCGGCGG - Intronic
1088145493 11:106671544-106671566 TAGGCCAGGTCCAGGCGCGGTGG - Intergenic
1088312728 11:108477112-108477134 GAGGCCACGGCTGGGCGTGGTGG + Intronic
1088554600 11:111048990-111049012 CAGCCCAAGGCTGGGCGTGGTGG - Intergenic
1088997077 11:115010471-115010493 CAGAACAGGACTGGGCACGCTGG - Intergenic
1089075760 11:115737202-115737224 TAGGCCAGGCCTGGGCACAGTGG - Intergenic
1089249122 11:117144741-117144763 CAGGGCAGGGCAGGGCGGGGCGG - Intronic
1089658958 11:119973449-119973471 AAAGACAGGACTGGGCACGGTGG + Intergenic
1089831273 11:121330419-121330441 CAGTTCAGGGCTGGGTGCGGCGG + Intergenic
1089974772 11:122722990-122723012 CAGGTCTGGGCCGGGCGCGGTGG - Intronic
1090018201 11:123104365-123104387 GAACCCAGGACCGGGCGCGGTGG - Intronic
1090070346 11:123538914-123538936 AAGTCCAGAACTGGGCGCGGTGG - Intronic
1090360650 11:126170280-126170302 CTGCTCAGGGCTGGGCGCGGTGG + Intergenic
1091207663 11:133832767-133832789 CAGGGCAGGACTTCGCGGGGCGG - Intergenic
1091362564 11:134989166-134989188 CAGGCCATGACAGGGAGTGGGGG + Intergenic
1091392961 12:137040-137062 CAGGGCAGGGCTGGGTGGGGTGG - Intronic
1091460613 12:641551-641573 CAGGCTAGGGCCGGGCGCGGTGG + Intronic
1091691124 12:2598240-2598262 CAGGCAAGGGCTGGGGGCTGGGG - Intronic
1091739064 12:2946964-2946986 TAGGCCGGGTGTGGGCGCGGTGG + Intergenic
1092024533 12:5229895-5229917 CTGGACAGGGCTGGGCACGGTGG - Intergenic
1092140047 12:6177673-6177695 CAGGTCAGGGCTGGGCACGGTGG - Intergenic
1092783300 12:12006947-12006969 CGGGCCTGGGCAGGGCGCGGTGG - Intergenic
1092871204 12:12807394-12807416 AAGGCCAGGGCAGGGCGCGGTGG + Intronic
1093072563 12:14722047-14722069 CAAGGAAGGGCTGGGCGCGGTGG - Intergenic
1093428501 12:19056717-19056739 CAGTCAAGGACCAGGCGCGGTGG + Intergenic
1094025700 12:25958509-25958531 CAGGCGCGGGCGGGGCGCGGAGG + Intergenic
1094604923 12:31941773-31941795 CAAGCCAGGGCTGGGCGCAGTGG - Intergenic
1095989603 12:48025600-48025622 CAGGCTTGGGCTGGGGGCGGGGG - Intergenic
1096071144 12:48776178-48776200 CAGGGCAGGGCTGGGGGCAGGGG - Intronic
1096081299 12:48834644-48834666 GAGGCCAGGGCTGGGCATGGTGG + Intronic
1096088251 12:48880884-48880906 CAGGCATGGACCGGTCGCGGTGG + Intergenic
1096367360 12:51040027-51040049 TTGGCCAGGGCTGGGCGCGGTGG + Intergenic
1096520189 12:52180657-52180679 CAGGGCAGGAGTGGGCTGGGGGG + Intronic
1096544994 12:52332057-52332079 CAGGCCAGGACAGGACACAGAGG - Intergenic
1096989339 12:55786734-55786756 AAGGTCACGACTGGGCACGGTGG - Intronic
1097051686 12:56227009-56227031 CAGCCCATGGCTGGGCGCGGTGG - Intronic
1097121313 12:56735096-56735118 AAGGCATGGACCGGGCGCGGTGG - Intronic
1097229268 12:57499306-57499328 AAGGCTGGGGCTGGGCGCGGTGG + Intronic
1097245632 12:57606177-57606199 CTGACCAGGACTGGGAGTGGGGG - Exonic
1097717753 12:62984206-62984228 GACCCCAGGGCTGGGCGCGGTGG - Intergenic
1097876352 12:64647696-64647718 AAGGCCGGGGCCGGGCGCGGTGG - Intronic
1098415399 12:70229356-70229378 AAAGCCAGGGCTGGGCGTGGTGG - Intergenic
1099159672 12:79225066-79225088 CAAGTCAGGGCTGGGCGCAGTGG - Intronic
1099443733 12:82728431-82728453 CAGACCCAGGCTGGGCGCGGTGG + Intronic
1100511759 12:95281814-95281836 CAGTCCAGGGCTAGGCGCAGTGG - Intronic
1101321411 12:103676342-103676364 CCAGGCAGGGCTGGGCGCGGTGG - Intronic
1101784991 12:107874896-107874918 CAAGCCAGGACTGGACTGGGTGG - Intergenic
1102092861 12:110207804-110207826 AAGGCTGGGGCTGGGCGCGGTGG - Intronic
1102311040 12:111844476-111844498 CAAACCAAGGCTGGGCGCGGTGG - Intronic
1102921394 12:116794308-116794330 CAGGCCAGGGCTGGGCATAGTGG + Intronic
1103302065 12:119935337-119935359 CTGACCAGGAGTGGGTGCGGTGG - Intergenic
1103444277 12:120983831-120983853 GAGGCCAAGGCTGGGCGTGGTGG - Intronic
1103484784 12:121275194-121275216 CAGGTCAGGGCTGGACACGGTGG + Intronic
1103611506 12:122127030-122127052 GAGGGCAGGACTGGCCGTGGGGG - Intronic
1103644124 12:122377293-122377315 CACATCAGGGCTGGGCGCGGTGG - Intronic
1103658447 12:122493898-122493920 CAGGCACAGGCTGGGCGCGGTGG - Intronic
1103814886 12:123646862-123646884 AAGGCCATGGCTGGGTGCGGTGG + Intronic
1104247696 12:127059265-127059287 CGGGGCAGGACTGGGCATGGTGG - Intergenic
1104313000 12:127671184-127671206 CAGGCCAAGACTGGGCATGGTGG + Intergenic
1104690115 12:130819158-130819180 CGGGGCAGGGCTGGGCACGGCGG - Intronic
1104997284 12:132666298-132666320 CATACTAAGACTGGGCGCGGTGG + Intronic
1105023842 12:132835758-132835780 AAGGCCAGCACTGGGCAGGGCGG + Intronic
1105482554 13:20792303-20792325 CAGGCCTGGGCTGGGCACGGTGG + Intronic
1105678495 13:22701769-22701791 CAGACCAAGGCCGGGCGCGGTGG - Intergenic
1105973279 13:25450816-25450838 CCAGTCAGGGCTGGGCGCGGTGG - Intronic
1106167663 13:27263097-27263119 CAGACCTGGCCAGGGCGCGGTGG + Intergenic
1106211537 13:27652581-27652603 CTTGCCATGACTGGGCGCTGTGG + Intronic
1106506605 13:30376099-30376121 CACTTCAGGGCTGGGCGCGGTGG - Intergenic
1107652852 13:42561952-42561974 CAGGCCAGGACTGAGCATGGTGG - Intergenic
1107914531 13:45135543-45135565 CTGAACAGGGCTGGGCGCGGTGG - Intronic
1108033186 13:46258414-46258436 TAGGTCAGGGCTGGGTGCGGGGG - Intronic
1108040946 13:46338767-46338789 CAAGGAAGGGCTGGGCGCGGTGG + Intergenic
1108256943 13:48620017-48620039 CAGGCCGGGGCTGGGTGTGGTGG - Intergenic
1108506041 13:51113341-51113363 CAGGACAGGACTGGCGTCGGAGG - Intergenic
1109511347 13:63378855-63378877 CAGTCCTGGGCTGGGCACGGTGG + Intergenic
1111183247 13:84695766-84695788 CAGAACAGGGCTGGGCGAGGTGG + Intergenic
1111539540 13:89652622-89652644 GAGGGAAGGGCTGGGCGCGGTGG + Intergenic
1112359514 13:98704909-98704931 GGGGCTAGGGCTGGGCGCGGTGG + Intronic
1113653872 13:112056324-112056346 CAGGCCAGGCCGGAACGCGGGGG + Intergenic
1114270734 14:21098468-21098490 CGGGCCAGGGCCGGGGGCGGGGG - Exonic
1114280214 14:21187269-21187291 CAGGGGAGGGCTGGGCGCGGTGG + Intergenic
1114494547 14:23123627-23123649 CAGGCCAGGACTGGGAGTGGCGG + Intergenic
1114556282 14:23564202-23564224 CAGGACAGGACGGGGAGTGGGGG - Intronic
1115850034 14:37583902-37583924 CCCGCCAGGACCGGGCGAGGAGG - Intergenic
1115964881 14:38877031-38877053 CAAGTCAGGGCCGGGCGCGGTGG + Intergenic
1115995947 14:39196010-39196032 CAGGAGTGGGCTGGGCGCGGTGG - Intergenic
1116748396 14:48850539-48850561 GATGCCAGGGCTGGGCGCGGTGG + Intergenic
1117339767 14:54783267-54783289 AAGGCCAGGGCTGGGCGCTGTGG + Intronic
1117348218 14:54855216-54855238 CTGGCCAGGGCCAGGCGCGGTGG + Intronic
1117433002 14:55688285-55688307 CAAGACAGGGCTGGGCGTGGTGG + Intronic
1117738484 14:58791381-58791403 CAGGGATGGACTGGGCGCGGTGG + Intergenic
1118039994 14:61906040-61906062 AAGTCCATGGCTGGGCGCGGTGG - Intergenic
1118462786 14:66002157-66002179 AAGGCCAGGCCTGGGCGTAGAGG + Intronic
1118601545 14:67473963-67473985 CAGGTGAGGGCCGGGCGCGGTGG + Intronic
1118619776 14:67603966-67603988 AAGGGCAGGGCTGGGAGCGGTGG - Intergenic
1119367544 14:74106876-74106898 CAGGCCGGGGCCGGGCGTGGTGG - Intronic
1119370132 14:74132792-74132814 TAGGTCATGGCTGGGCGCGGTGG - Intronic
1119724617 14:76914454-76914476 CAGGACCTGGCTGGGCGCGGTGG + Intergenic
1119743513 14:77028500-77028522 CCGGCCAGGCCTGGGGGCGGCGG - Exonic
1119793664 14:77376843-77376865 AAGCCCAGGACAGAGCGCGGCGG + Intronic
1120144734 14:80967570-80967592 CAGGTCAGGGCCGGGCGGGGTGG - Intronic
1120836803 14:89046092-89046114 AATGCCACGGCTGGGCGCGGTGG - Intergenic
1120986676 14:90341341-90341363 CAAATCAGGGCTGGGCGCGGTGG - Intergenic
1121046862 14:90794511-90794533 CCAGCCAGGGCTGGGTGCGGTGG - Intronic
1121443134 14:93961575-93961597 CAGGGCAGGACTGGCTGAGGAGG + Intronic
1121645809 14:95516554-95516576 GAGGCCAGGCCTGGGGCCGGGGG - Intronic
1122226624 14:100284512-100284534 AAAGCCAGGACTGGGCTCTGAGG - Intergenic
1122467860 14:101946623-101946645 TAGGTCAGGGCTGGGCGCGGTGG - Intergenic
1122637989 14:103139107-103139129 CAGACCCGGGCTGGGCGCTGCGG + Intergenic
1122807355 14:104266686-104266708 CAGGCCAGGGCTGCGCTCTGGGG - Intergenic
1122993191 14:105248597-105248619 CCGGCCAGGCCCGGCCGCGGGGG - Exonic
1123056424 14:105572727-105572749 CAGGACAGGGCTGGGGGCGGAGG - Intergenic
1123057509 14:105579080-105579102 CAGGACAGGGCTGGGGGCGGAGG + Intergenic
1123080857 14:105692855-105692877 CAGGACAGGGCTGGGGGCGGAGG - Intergenic
1123081784 14:105699013-105699035 CAGGACAGGGCTGGGGGCGGAGG + Intergenic
1123464610 15:20506097-20506119 CAGGCCAGGACCTGACGCGCAGG + Intergenic
1123653504 15:22494944-22494966 CAGGCCAGGACCTGACGCGCAGG - Intergenic
1123743925 15:23303807-23303829 CAGGCCAGGACCTGACGCGCAGG - Intergenic
1124275339 15:28322064-28322086 CAGGCCAGGACCTGACGCGCAGG + Exonic
1124307365 15:28589537-28589559 CAGGCCAGGACCTGACGCGCAGG - Intergenic
1124602317 15:31145001-31145023 AAGGCCGGGGCTGGGTGCGGTGG - Intronic
1124653160 15:31487484-31487506 CTGGCAAGGACTGGGAGTGGGGG - Exonic
1124795199 15:32771364-32771386 CAGGCCCGGGCCGGGCGTGGTGG - Exonic
1124912186 15:33932537-33932559 TAGGTCTGGGCTGGGCGCGGTGG + Intronic
1125003613 15:34795466-34795488 CAGGCGAGGAGTGAACGCGGAGG + Intronic
1125064722 15:35468778-35468800 CAGGCAGAGGCTGGGCGCGGTGG + Intronic
1125333221 15:38602493-38602515 GAGGACAAGGCTGGGCGCGGTGG + Intergenic
1125983651 15:44027929-44027951 CAGCACAGGGCCGGGCGCGGTGG - Intronic
1126647015 15:50884717-50884739 TAGTACAGGGCTGGGCGCGGTGG + Intergenic
1126795557 15:52258019-52258041 AAGGCCAGGGCTGGGCCTGGGGG + Intronic
1126823663 15:52528915-52528937 CAGGGCAGGGCCGGGCGGGGAGG + Exonic
1126848714 15:52785078-52785100 GAAGCCAGGACTGGGCGTGTGGG - Intronic
1127141932 15:55986880-55986902 CAGGCCTTGGCCGGGCGCGGTGG - Intronic
1127334086 15:57966699-57966721 CAGCACAGGACTGGGCTCTGAGG + Intronic
1127398719 15:58564438-58564460 AAGGACAGGGCTGGGCGTGGTGG + Intronic
1127495240 15:59505222-59505244 AAGACAAGGGCTGGGCGCGGTGG + Intronic
1127547399 15:60004068-60004090 CAGCTCAAGACTGGGCGAGGGGG - Intergenic
1127573928 15:60271966-60271988 AAGGCCAGGGCTGGGCGTGGTGG - Intergenic
1127891391 15:63254623-63254645 CAGACATGGGCTGGGCGCGGTGG + Intronic
1128044642 15:64606854-64606876 CAGGCATGGGCTGGGCGTGGTGG + Intronic
1128061255 15:64737185-64737207 CTGGCCAGGGCTGGGCATGGTGG + Intergenic
1129116042 15:73365970-73365992 CTGGCCAGTACTGGGCCCTGAGG - Intronic
1129121708 15:73401400-73401422 TATGCCAGCGCTGGGCGCGGTGG + Intergenic
1129228550 15:74183818-74183840 CAGGCCAAGGCTGGGTGTGGCGG + Intronic
1129305030 15:74653963-74653985 CAGTGTAGGGCTGGGCGCGGTGG + Intronic
1129305868 15:74661576-74661598 GAGACCAGCACTGGGCGTGGTGG + Intronic
1129362873 15:75035307-75035329 GAGGCCAGGAATGGGCTTGGCGG + Intronic
1129834272 15:78692171-78692193 CTGGCCTGGACTGGGAGCAGGGG - Intronic
1130008247 15:80124144-80124166 AAGGAAAAGACTGGGCGCGGTGG + Intronic
1130058109 15:80546675-80546697 GAGGCAATGGCTGGGCGCGGTGG + Intronic
1130215548 15:81965415-81965437 CAGTCCTGGACTGGGGGCGGTGG + Intergenic
1130256547 15:82328513-82328535 CTGGGCAGGACTGGGCCTGGTGG - Intergenic
1130598405 15:85261475-85261497 CTGGGCAGGACTGGGCCTGGTGG + Intergenic
1131013885 15:89041785-89041807 CAGGCCAGGTCTGGGTGCCGTGG - Intergenic
1131055911 15:89374881-89374903 GAGGCCAGGGCCGGGCGGGGAGG - Intergenic
1131119244 15:89812918-89812940 CAGACCAGGGCTGGGAGCTGGGG + Intronic
1131254126 15:90850563-90850585 CAGCTCTGGGCTGGGCGCGGCGG + Intergenic
1131490015 15:92854505-92854527 CAGCCCAAGGCTGGGTGCGGTGG - Intergenic
1132147779 15:99438493-99438515 CCGGCCAGGACGGGGGTCGGGGG + Intergenic
1132177083 15:99724550-99724572 TATGCCAGGGCTGGGCGCAGTGG - Intronic
1132355578 15:101169015-101169037 CAGGGCAGGCCTGGGCTTGGGGG - Intergenic
1132368600 15:101277172-101277194 CAGGCCCGGACCTTGCGCGGAGG - Intronic
1132489821 16:221412-221434 ACGGCCAGGGCTGGGCGTGGTGG + Intronic
1132571151 16:644725-644747 CAGGGCAGGGCCGGGCGCGGTGG - Intronic
1132579186 16:677405-677427 CCGGCCAGGGCAGGGGGCGGGGG - Intronic
1132597638 16:760622-760644 CGGGCCAGGCCTGGGGGAGGAGG - Intronic
1132669799 16:1097919-1097941 CAGGCCAGGCCTGAGTGGGGTGG + Intergenic
1132678830 16:1131455-1131477 GAGGCCAGGAATGGGCTCAGGGG - Intergenic
1132752523 16:1465409-1465431 CAGGCGAGGCCAGGGTGCGGCGG - Intronic
1133103823 16:3494490-3494512 CAAGGCAGGACTGGGCACGGGGG - Intronic
1133187006 16:4107261-4107283 CAGGTCAAGGCTGGGCGTGGTGG + Intronic
1133238743 16:4402590-4402612 CTGGGCAGGGCTGGGCGCTGGGG + Intronic
1133255765 16:4514715-4514737 CAAGCCAGGGCTGGGCCCAGGGG + Exonic
1133797259 16:9056274-9056296 CAGGTCAGGGCCGGGCGCGATGG + Intergenic
1133947224 16:10358901-10358923 CATGTCTTGACTGGGCGCGGTGG - Intronic
1134448026 16:14345532-14345554 AAGAACAGGGCTGGGCGCGGTGG - Intergenic
1134864778 16:17595482-17595504 GAGCCCAGGACCGGGCGCAGTGG - Intergenic
1135329425 16:21548627-21548649 CAGGCCTCGGCTGGGCGTGGTGG + Intergenic
1135384060 16:22020580-22020602 AAAGTCAGGGCTGGGCGCGGTGG - Intronic
1135462366 16:22655876-22655898 CAGGCCAGGAATGGGGGCTCAGG - Intergenic
1135534096 16:23279365-23279387 CAGACCACGGCTGGGCGTGGTGG - Intronic
1135536089 16:23295637-23295659 AAGGCCAGGGCTGGGTGCAGTGG - Intronic
1136424823 16:30162763-30162785 CAGGCCCAGGCTGGGCACGGTGG + Intergenic
1136481876 16:30547152-30547174 CTGTCCTGGGCTGGGCGCGGTGG - Intronic
1136535022 16:30894116-30894138 CAGGCCGGGGCGGGGCGCGGCGG - Exonic
1136627222 16:31469059-31469081 TAGGGCCTGACTGGGCGCGGTGG - Intergenic
1136648739 16:31646926-31646948 AATGGAAGGACTGGGCGCGGTGG + Intergenic
1137226410 16:46515619-46515641 CAGAACAAGGCTGGGCGCGGTGG + Intergenic
1138023254 16:53503252-53503274 CAGGGCAGGGCAGGGCGGGGTGG - Intronic
1138491509 16:57379835-57379857 GAGCCCAGGTCTGGGAGCGGAGG - Intronic
1138508717 16:57494800-57494822 GAGTCCTGGACTGGGCGCAGTGG + Intergenic
1138595421 16:58026816-58026838 GAGGCAAGGGCTGGGGGCGGCGG - Intronic
1139541718 16:67622947-67622969 CAAGTGAGGGCTGGGCGCGGTGG - Intronic
1139740422 16:69030762-69030784 CAGGTGAGGGCCGGGCGCGGTGG + Intronic
1139748797 16:69095926-69095948 GGGGCCATGGCTGGGCGCGGTGG + Intergenic
1139823092 16:69736151-69736173 CAGGCTGGGGCTGGGCGTGGTGG - Intergenic
1139832144 16:69808687-69808709 CAGGCCATGGCCGGGCGCAGTGG - Intronic
1139938141 16:70586117-70586139 GAGGCCAGGGCTGGGGGCGGTGG - Intronic
1140097885 16:71891059-71891081 CAGGAAGGGGCTGGGCGCGGTGG - Intronic
1140460321 16:75134467-75134489 CAGGCCTGGGCTGGGCGCGGTGG + Intergenic
1140479819 16:75256533-75256555 CAGGCCAGGACTTGGAGTGCAGG - Intronic
1140509407 16:75495993-75496015 CCGGCCAGGGCTGGGCGCGGTGG + Intergenic
1140820532 16:78658802-78658824 CATGCTAGGGCTGGGCACGGTGG + Intronic
1140927591 16:79599220-79599242 CCGGCCAGCGCTGGGGGCGGCGG - Exonic
1141116816 16:81315684-81315706 CGGGCCCGGCCTGGGCGAGGGGG - Intronic
1141461219 16:84179802-84179824 CAGGCCTGGTGTGGGCGCTGAGG + Exonic
1141509942 16:84505477-84505499 AGGGCCAGGAATGGGCGCCGGGG - Intronic
1141516456 16:84548264-84548286 CAGCACACGGCTGGGCGCGGTGG + Intronic
1141658788 16:85430538-85430560 AAGGCCAGGCCAGGGGGCGGAGG + Intergenic
1141734872 16:85845660-85845682 TAGGTCTGGGCTGGGCGCGGTGG + Intergenic
1142008017 16:87699404-87699426 CAGGGCAGGGCCGGGCGCGGTGG + Intronic
1142018643 16:87766134-87766156 CGGCCCCGGGCTGGGCGCGGTGG + Intergenic
1142042432 16:87903143-87903165 CAGGCCTCGGCTGGGCGCGGTGG + Intronic
1142113883 16:88346411-88346433 CAGGCCAGGGCTGGGAGGGAGGG - Intergenic
1142188448 16:88706065-88706087 CAGCTCCGGACTGGGCGCGCGGG - Intronic
1142188538 16:88706348-88706370 CGGGCCAGGACAGCGGGCGGCGG - Exonic
1142205753 16:88782397-88782419 CAGGGCAGGGCTGGGCGCGATGG - Intronic
1142446058 16:90138617-90138639 CAGGCCCAGGCTGGGCGCAGTGG - Intergenic
1142461450 17:96846-96868 CAGGCCCAGGCTGGGCGCAGTGG + Intergenic
1142543445 17:680004-680026 CTGGGCATGGCTGGGCGCGGTGG + Intronic
1142630004 17:1219329-1219351 GAGGCCATGGCTGGGCGTGGTGG - Intronic
1142633099 17:1238752-1238774 CAGGCCATGGCTGGGCGTGGTGG - Intergenic
1142678047 17:1527527-1527549 CAAACCAGGGCTGGGCACGGTGG - Intronic
1142689874 17:1599059-1599081 AATGCCTGGGCTGGGCGCGGTGG + Intronic
1142751760 17:1992953-1992975 CAGGTGAGGGCCGGGCGCGGTGG + Intronic
1142757957 17:2026555-2026577 AAGGTCAGGGCCGGGCGCGGTGG + Intergenic
1142856722 17:2734773-2734795 CTGGTTAGGGCTGGGCGCGGTGG - Intergenic
1142857319 17:2738483-2738505 AAGGCCTGGGCTGGGCGCAGTGG + Intergenic
1142865405 17:2787852-2787874 CAGGCACAGGCTGGGCGCGGTGG - Intronic
1142979186 17:3661813-3661835 CACACCAGCACTGGGAGCGGGGG + Intergenic
1143024927 17:3935910-3935932 CAGGCCTGGGCTGGGCATGGTGG - Intronic
1143485899 17:7253706-7253728 CATTCCATGGCTGGGCGCGGTGG + Intronic
1143546579 17:7600184-7600206 AAGGATATGACTGGGCGCGGTGG - Intronic
1143637734 17:8176071-8176093 CAGGGCAGGCCTGGGGGCGGCGG + Intronic
1144692291 17:17275654-17275676 AAAGCCAGGGCTGGGCGTGGTGG + Intronic
1144764238 17:17724234-17724256 CCGGGCAGGTCTGCGCGCGGCGG - Intronic
1144790960 17:17858984-17859006 CATCCCAGGGCTGGGCGCAGTGG - Intronic
1145858276 17:28183614-28183636 CAGGCTAAGGCTGGGTGCGGTGG - Intronic
1146211884 17:30949459-30949481 CAGACTAGGGCTGGGCGCGGTGG + Intronic
1146217572 17:30990233-30990255 CAAAACAGGGCTGGGCGCGGTGG + Intronic
1146320832 17:31845118-31845140 CAGGCCTTGGCTGGGCGCGGTGG - Intergenic
1146337042 17:31982372-31982394 AAAGCCTGGGCTGGGCGCGGTGG + Intronic
1146919758 17:36702737-36702759 GAGGCCAGGACTGGGGGCAAAGG + Intergenic
1147123528 17:38350772-38350794 AAGGCCGGGCGTGGGCGCGGTGG + Intergenic
1147224925 17:38969064-38969086 AAAGCCAGGGCTGGGCCCGGTGG - Intergenic
1147277086 17:39327171-39327193 CAAGACAGGGCTGGGTGCGGTGG - Intronic
1147384418 17:40072919-40072941 CAGACCAGGACTGGGCACTGGGG - Intronic
1147522473 17:41187826-41187848 CAAGCTAGGGCTGGGCGCAGTGG + Intergenic
1147742808 17:42678340-42678362 CAGGGCTGGGCTGGGCGGGGAGG + Intergenic
1148188126 17:45659431-45659453 GAACCCAAGACTGGGCGCGGTGG - Intergenic
1148215680 17:45833038-45833060 CAGGACAGGACTGGGGCTGGAGG - Intronic
1148353239 17:46956587-46956609 CTGGCAAGGGCTGGGTGCGGTGG - Intronic
1148447501 17:47746404-47746426 AAGGGCTGGACTGGGAGCGGGGG + Intergenic
1148651542 17:49253653-49253675 CAGGGCCTGACTGGGCGTGGTGG + Intergenic
1148668555 17:49393006-49393028 CAGACCACGGCTGGGCACGGTGG - Intronic
1148716807 17:49721800-49721822 AAGGCTAGGGCTGGGCGTGGTGG + Intronic
1148814978 17:50321167-50321189 GAGACCAGGGCCGGGCGCGGTGG - Intergenic
1148898624 17:50857321-50857343 AAGGCCAAGGCCGGGCGCGGTGG - Intergenic
1149123934 17:53204799-53204821 CAGGCAGAGACTGGGTGCGGTGG + Intergenic
1149217983 17:54380671-54380693 AAGGGCAGGGCTGGGCGCAGTGG - Intergenic
1149719356 17:58827613-58827635 TTGGCCAGGGCTGGGCGCGGTGG + Intronic
1149737499 17:59009731-59009753 AAGGCCAGGGCCGGGCGCAGTGG - Intronic
1150003186 17:61454719-61454741 CAGGGCAGGGCTGAGCGCGTAGG + Intronic
1150209045 17:63431732-63431754 CAGACCAGGGCTGGGGGTGGGGG - Intergenic
1150424676 17:65067821-65067843 CAGGCCGGGCATGGGCGCGGTGG + Intergenic
1150448982 17:65249937-65249959 CATTCCAAGGCTGGGCGCGGTGG - Intergenic
1150690467 17:67362385-67362407 CAGGCTCTGGCTGGGCGCGGTGG + Intronic
1150701841 17:67453960-67453982 CAGGCTCGGGCTGGGCGTGGTGG + Intronic
1150789422 17:68189609-68189631 CAGGACAAGGCCGGGCGCGGTGG - Intergenic
1150824823 17:68465217-68465239 CCGGCCGGGGCCGGGCGCGGTGG - Intergenic
1150833654 17:68544718-68544740 CTGGCCAGGCCTGAGCACGGAGG - Intronic
1151296269 17:73188663-73188685 CTGATCAGGACTGGGCGCTGTGG + Intergenic
1151363400 17:73602029-73602051 CAGTTCTGGGCTGGGCGCGGCGG - Intronic
1151426790 17:74035889-74035911 CTGGCAATGGCTGGGCGCGGTGG + Intergenic
1151453391 17:74212691-74212713 CAGGCCAGGAGGGGGCTCTGGGG - Intergenic
1151496295 17:74460199-74460221 CAGGGGAGGGCTGGGCGCAGTGG - Intergenic
1151668802 17:75560176-75560198 CAGGGCATGACTGGGCTGGGAGG + Intronic
1151817029 17:76476444-76476466 GGGGCCAGGGCTGGGCGCCGTGG - Intronic
1151845077 17:76648011-76648033 CAGCAGAAGACTGGGCGCGGTGG - Intergenic
1152176493 17:78791404-78791426 AAGGCCAGGGCCGGGCACGGTGG - Intronic
1152384049 17:79958503-79958525 TTGGTCAGGGCTGGGCGCGGTGG - Intronic
1152421758 17:80197245-80197267 CAGGCCAGGGCCGGGTGTGGTGG + Intronic
1152629728 17:81405503-81405525 CCTGCCAGGATTGGGGGCGGGGG - Intronic
1152741647 17:82020999-82021021 GAGTCCAGGACTGGGGGTGGGGG + Intronic
1152774720 17:82193913-82193935 CAGGCCAGGACTGGAGTCTGGGG - Intronic
1152932035 17:83114913-83114935 CAGCCCAGGACTCGTCGCAGAGG + Intergenic
1153285886 18:3453397-3453419 AAGTGCAGGGCTGGGCGCGGTGG + Intronic
1153932401 18:9889778-9889800 AAGACTGGGACTGGGCGCGGTGG + Intergenic
1154356187 18:13624629-13624651 CAGGCCAGGCATGGGGACGGAGG - Intronic
1154489268 18:14907177-14907199 CAGGCCATGACAGGGAGTGGGGG - Intergenic
1155011611 18:21784332-21784354 CAACACAGGGCTGGGCGCGGTGG - Intronic
1156448751 18:37254521-37254543 GAGGCCGGGAGTGGGGGCGGAGG - Intronic
1157237132 18:45975477-45975499 TAAGCCAGGGCTGGGCGCGGTGG + Intergenic
1157457100 18:47842252-47842274 CAGGCCAGGGCCAGGCGTGGTGG + Intronic
1157663480 18:49466124-49466146 CAAACCAGGGCTAGGCGCGGTGG + Intergenic
1157832323 18:50867823-50867845 CACTCCAGGGCTGGGCGCGGTGG - Intergenic
1157862519 18:51153851-51153873 CAGGCCAGGGCTGGCCGAGGGGG + Intergenic
1158639838 18:59194420-59194442 CATTAGAGGACTGGGCGCGGTGG + Intergenic
1158663585 18:59412052-59412074 CAGGGCATGGCTGGGCGTGGTGG - Intergenic
1159067340 18:63585195-63585217 CAGCCCCTGGCTGGGCGCGGTGG - Intergenic
1159557426 18:69959957-69959979 CAGGCAATGGCTGGGCACGGTGG + Intronic
1159590290 18:70326560-70326582 CAGCAAAGGACTGGGCGGGGGGG - Exonic
1159664919 18:71146015-71146037 CAGGCCGGGGCCGGGCACGGTGG - Intergenic
1159999427 18:75002513-75002535 GAGGTCAGGGCCGGGCGCGGTGG + Intronic
1160299620 18:77668301-77668323 CAGGCCAGCACTGGGCACCCCGG + Intergenic
1160651151 19:229213-229235 CAGGCCCAGGCTGGGCGCAGTGG + Intergenic
1160710795 19:550158-550180 CAGGGAAGGGCCGGGCGCGGTGG - Intergenic
1160758428 19:770552-770574 CTGGACAGGGCCGGGCGCGGTGG + Intergenic
1160939433 19:1613451-1613473 CAGGGCAGGGCTGGGGGCAGGGG + Intronic
1160961221 19:1721897-1721919 CAGGACATGACTGGGCATGGTGG - Intergenic
1160998554 19:1896810-1896832 CAACCCGGGGCTGGGCGCGGTGG + Intergenic
1161121675 19:2530431-2530453 CTGGACAGGGCTGGGTGCGGTGG + Intronic
1161326833 19:3668137-3668159 CAGCCCAGGCCTGGGCTCGTTGG - Intronic
1161337213 19:3721185-3721207 CAGGGCAGGGCCGGGCGCGGTGG - Intronic
1161342539 19:3751124-3751146 CAGGGCAGGCCTGGGCTCGTGGG + Intronic
1161400769 19:4065633-4065655 CAGGCCGGGCCCGGGCGTGGGGG - Intronic
1161581895 19:5085716-5085738 CAGGCCTGGCCTGGGCGGCGAGG + Intronic
1161623693 19:5313202-5313224 CAGGCCAGGACCGGGCACGGTGG - Intronic
1161634080 19:5376225-5376247 CAGGCCCGAGCTGGGCGTGGTGG - Intergenic
1161722279 19:5909775-5909797 TAGGCTAGGGCCGGGCGCGGTGG - Exonic
1161722625 19:5911964-5911986 GAGGCCAGGGCTGGGCGCGGTGG - Intronic
1161796226 19:6388215-6388237 CATGCCATGGCTGGGCGCGGTGG - Intronic
1161811417 19:6473438-6473460 AAAACCAGGGCTGGGCGCGGTGG - Intronic
1162042906 19:7981043-7981065 CAGGGCAGGAATGGATGCGGTGG + Intronic
1162073789 19:8171225-8171247 CAAGACAAGGCTGGGCGCGGTGG + Intronic
1162356309 19:10187314-10187336 CAGACCATGGCTGGGCGCAGTGG + Intronic
1162523539 19:11195101-11195123 CAGGCCTGGACTGGGTCGGGGGG + Intronic
1162549196 19:11349116-11349138 CAGGTCTGGACTGGGGGAGGGGG - Intronic
1162645644 19:12048229-12048251 CAGGCCTGGGCTGGGCGCGGTGG + Intronic
1162828251 19:13267653-13267675 CAGGCCCAGACTGGGTGCCGTGG + Intronic
1162869471 19:13574762-13574784 CTGCCCAGGGCTGGGAGCGGTGG - Intronic
1162985300 19:14265771-14265793 GAGGCCAGGGCTGGCCGAGGGGG - Intergenic
1163009633 19:14416972-14416994 CAGGCCCAGGCTGGGCGTGGTGG - Intronic
1163058366 19:14739811-14739833 CAGGGATGGACTGGGCGCAGTGG + Intronic
1163079266 19:14925242-14925264 CAGGACAAGCCTGGGCGTGGTGG + Intergenic
1163286369 19:16350809-16350831 CAAACCAGGGCTGGGTGCGGTGG + Intergenic
1163458482 19:17422661-17422683 CATAACAGGACTGGGCGCGGTGG + Intronic
1163470358 19:17493144-17493166 GAGGACAGGGCCGGGCGCGGCGG + Intronic
1163511216 19:17736195-17736217 AAGGCCTGGGCTGGGCACGGTGG - Intergenic
1163543226 19:17924414-17924436 TTAGCCAGGGCTGGGCGCGGTGG - Intergenic
1163613253 19:18311752-18311774 CAGCACAGGGCTGGGCGGGGTGG - Intronic
1163657687 19:18557143-18557165 GAAACCAGGGCTGGGCGCGGTGG + Intergenic
1163748313 19:19060886-19060908 AAGGCCAGGGCCGGGTGCGGTGG - Intergenic
1163796837 19:19342701-19342723 CGGGCCAGGGCTGGGGGCGGGGG + Intronic
1164050816 19:21584893-21584915 ACAGCCAGGGCTGGGCGCGGTGG + Intergenic
1164284229 19:23797393-23797415 CAGGCCAGGGCTGGGCATGGTGG - Intronic
1165065515 19:33225935-33225957 CAGGCCGGGACTGGGGGAGGGGG - Intergenic
1165213692 19:34254612-34254634 CAGGTGAGGAGCGGGCGCGGCGG + Exonic
1165243914 19:34487079-34487101 CAGGCAGGGACTGGGCTTGGTGG - Intronic
1165415618 19:35691630-35691652 CAGGTCAGGGCTGGGCACAGTGG + Intergenic
1165454076 19:35900653-35900675 CAGTCCCTGAATGGGCGCGGCGG + Intronic
1165497535 19:36162291-36162313 TGGGCCAGGACCGGACGCGGTGG + Intergenic
1165651449 19:37494282-37494304 TTGGCCAGGGCTGGGCACGGTGG - Intergenic
1165700013 19:37930297-37930319 CAGGCATGGGCTGGGCACGGTGG - Intronic
1165710772 19:38009303-38009325 CAGAATAGGGCTGGGCGCGGTGG - Intronic
1165814648 19:38634309-38634331 TTGGCCAGGACTTGGCACGGTGG + Intronic
1166048289 19:40242470-40242492 CAGGCCAGCACTGGGGGTGGGGG + Intronic
1166171159 19:41028332-41028354 CAGCCCAGCACTGGGCCCAGGGG + Intergenic
1166235803 19:41455371-41455393 CAGGCCACGGCTGGGCACGGTGG - Intergenic
1166602049 19:44104947-44104969 CAGGGCTCGGCTGGGCGCGGTGG - Intronic
1166716361 19:44970682-44970704 CTGGCCTAGGCTGGGCGCGGTGG - Intronic
1166980556 19:46629758-46629780 CAGGCCTGGGCTGGGCGTGATGG - Intergenic
1167146029 19:47681158-47681180 CAGGCCAGGGCTGGGCTGGGGGG - Exonic
1167203356 19:48083100-48083122 CAAGCCAGGGCCAGGCGCGGTGG - Intronic
1167302326 19:48685386-48685408 CTGACCAGGGCTGGGCACGGTGG - Intergenic
1167334735 19:48877828-48877850 CAGGCCGGGTCTGGGTGCGGTGG - Intergenic
1167358210 19:49016750-49016772 AAGGCCAGGACTCGGGGCTGCGG - Intronic
1167359709 19:49023639-49023661 AAGGCCAGGACTCGGGGCTGCGG - Intronic
1167361422 19:49032446-49032468 AAGGCCAGGACTCGGGGCTGCGG + Intronic
1167363852 19:49044519-49044541 AAGGCCAGGACTCGGGGCTGCGG + Intronic
1167364646 19:49048408-49048430 AAGGCCAGGACTCGGGGCTGCGG - Intronic
1167378749 19:49126536-49126558 AAGGCCAGGACTGGGCGCAGTGG - Intronic
1167397261 19:49238791-49238813 CAAACCTGGGCTGGGCGCGGTGG - Intergenic
1167447780 19:49548625-49548647 CAGGCCAGGGCCAGGCGTGGTGG - Intergenic
1167500114 19:49841490-49841512 GAGGCCCAGGCTGGGCGCGGTGG + Intergenic
1167522339 19:49962638-49962660 CAAGGCAGGGCTGGGCGCAGTGG - Intergenic
1167585859 19:50375402-50375424 CAGTCTCGGACCGGGCGCGGTGG - Intronic
1167747502 19:51361070-51361092 CAGGCGTGGGCCGGGCGCGGTGG - Intronic
1167767970 19:51496927-51496949 AAGGCCAGCAGTGGGCGTGGGGG - Exonic
1167847868 19:52179140-52179162 AAGGCCAGGGTTGGGCACGGTGG - Intergenic
1167961451 19:53107473-53107495 CAGACCACGACCGGGCGCAGTGG - Intergenic
1167976417 19:53230356-53230378 AAAGTCAGGGCTGGGCGCGGTGG - Intergenic
1168308907 19:55451229-55451251 GAGGCCAGGGCTGGGCCGGGCGG + Intergenic
1168381922 19:55931419-55931441 GAAGCCTGGGCTGGGCGCGGTGG + Intronic
1168502936 19:56908678-56908700 CAGGCATAGGCTGGGCGCGGTGG - Intergenic
1168561985 19:57392084-57392106 AAGCACAGGGCTGGGCGCGGTGG - Intronic
1168648626 19:58078221-58078243 AAGCCCATGGCTGGGCGCGGTGG + Intronic
1168705046 19:58465734-58465756 CATTTCAGGACTGGGCGCAGTGG - Intergenic
925510539 2:4620833-4620855 CATGTCACGGCTGGGCGCGGTGG - Intergenic
925593893 2:5536494-5536516 CAAGCCAGGGCTGGGCGCAGTGG - Intergenic
926331027 2:11825328-11825350 GAGGCCAGGCCTGGACCCGGTGG - Intronic
927156287 2:20223583-20223605 GACGCCAGCACCGGGCGCGGGGG + Intronic
927778409 2:25920147-25920169 CAGAACAGGGCTGGGTGCGGTGG - Intergenic
927914914 2:26929517-26929539 CACCTCAGGACTGGGCACGGTGG - Intronic
928154998 2:28868725-28868747 CAAACTAGGGCTGGGCGCGGTGG + Intronic
928648831 2:33383822-33383844 CAGGTCAGGGCTGGGCGCAGTGG - Intronic
928978016 2:37108853-37108875 CAAGCCTTGGCTGGGCGCGGTGG - Intronic
929183948 2:39074060-39074082 CCAGCCTGGGCTGGGCGCGGTGG + Intronic
929458859 2:42086413-42086435 CAGCCCAGGACTGGGCACATAGG + Intergenic
929564034 2:42973880-42973902 CAGGGCAGGATGGGGGGCGGGGG - Intergenic
929646196 2:43630872-43630894 GATGCCAGGGCTGGGCACGGTGG - Intergenic
929764304 2:44831514-44831536 CTGGCCTGGGCTGGGTGCGGTGG + Intergenic
930074831 2:47397996-47398018 CAGGCCAGGGCCGGGCACAGTGG - Intergenic
931290719 2:60870737-60870759 CAGGCTTGGGCTGGGCGTGGTGG - Intergenic
931500555 2:62861413-62861435 CACTCAAGGGCTGGGCGCGGTGG - Intronic
931565073 2:63607541-63607563 AAGAAGAGGACTGGGCGCGGTGG + Intronic
931606572 2:64058814-64058836 CAGGGCATGGCTGGGCGCTGTGG + Intergenic
932252051 2:70253028-70253050 TAGGCCAGGACTGGGCGCAGTGG - Intergenic
932379775 2:71271385-71271407 CAGATCATGGCTGGGCGCGGTGG + Intergenic
932761136 2:74440025-74440047 CAGGCCAGGGATGTGGGCGGGGG - Intronic
932787808 2:74622520-74622542 CAGGCAATGGCCGGGCGCGGTGG - Intronic
932798108 2:74715408-74715430 CAGGGCAGGCCGGGGCGGGGCGG + Intergenic
933728073 2:85437660-85437682 CAGGGCAGGCCAGGGGGCGGGGG + Intergenic
933752471 2:85611834-85611856 CAGGCCAGGAGTGGTGGCGGCGG + Intronic
933774963 2:85766337-85766359 CAGGCCCGGGCTGGGTGTGGGGG - Intronic
933902899 2:86861981-86862003 GAGGGCGGGACCGGGCGCGGTGG + Intergenic
935237480 2:101151044-101151066 CAGCCCGGGACTGGGGGCCGCGG + Intronic
935593525 2:104862548-104862570 GAGGGCAGGGCTGGGCGCGGAGG + Intergenic
935653217 2:105399323-105399345 CGGACGAGGCCTGGGCGCGGTGG + Intronic
935707898 2:105872280-105872302 CAGGGCAGGCCTGGTGGCGGGGG - Intronic
935769034 2:106399390-106399412 CAGGCATGGGCTGGGCGCAGTGG + Intronic
935773540 2:106450090-106450112 CAGGTGTGGGCTGGGCGCGGTGG + Intronic
935777645 2:106487288-106487310 GAGGGCGGGACCGGGCGCGGTGG - Intergenic
935906524 2:107845849-107845871 CAGGTGTGGGCTGGGCGCGGTGG - Intronic
935911062 2:107896525-107896547 CAGGCATGGGCTGGGCGCGGTGG - Intergenic
935992922 2:108737999-108738021 CAGGTGTGGGCTGGGCGCGGTGG - Intronic
936128313 2:109810966-109810988 CAGGTGTGGGCTGGGCGCGGTGG - Intronic
936216384 2:110560519-110560541 CAGGTGTGGGCTGGGCGCGGTGG + Intronic
936348782 2:111696773-111696795 CAGGCGTGGGCTGGGCACGGTGG + Intergenic
936425524 2:112415094-112415116 CAGGTGTGGGCTGGGCGCGGTGG + Intronic
936446035 2:112596000-112596022 CATGCCCAGGCTGGGCGCGGTGG - Intergenic
936463760 2:112729407-112729429 CAGGCCAAGGCCAGGCGCGGTGG - Intronic
936561420 2:113542256-113542278 AGGGCCAGGAGAGGGCGCGGCGG - Intergenic
937313086 2:120914278-120914300 CAGGCCAGGGCTAGGCCAGGTGG - Intronic
937944449 2:127319517-127319539 AAGGCCAAGGCTGGGCGCAGTGG + Intronic
938008643 2:127810761-127810783 AAGGCCCTGACTGGGAGCGGTGG - Intronic
938019005 2:127890916-127890938 TGGGCCAAGGCTGGGCGCGGTGG + Intergenic
938042972 2:128091293-128091315 CAGGGCAGGGCGGGGCGAGGCGG - Exonic
938097686 2:128474217-128474239 CAGGACAGGATGGGGCGCTGGGG + Intergenic
938297065 2:130185020-130185042 CCAGGCAGGGCTGGGCGCGGTGG + Intronic
939447042 2:142323377-142323399 CAGGCCATGACTGGAAGCAGAGG + Intergenic
939985087 2:148822078-148822100 CAAGACAGGGCTGGGCACGGTGG - Intergenic
940297646 2:152144822-152144844 TTTGCCAGGGCTGGGCGCGGTGG - Intronic
940421461 2:153483701-153483723 CAGGGCAGGGCCGGGCGTGGTGG - Intergenic
940772253 2:157851920-157851942 AATGCCAGGACTGGGCGGGTGGG - Intronic
941067893 2:160924082-160924104 CAGTCCAGAGCTGGGCGCAGTGG + Intergenic
941430745 2:165411007-165411029 CAGACCCGGGCCGGGCGCGGTGG + Intergenic
941928574 2:170919140-170919162 CAGGCCACGACTGGAAGTGGAGG - Intergenic
942087011 2:172453237-172453259 CAGTACAGGGCTGGGCGCAGTGG + Intronic
942843855 2:180399458-180399480 TAGGCAAGGGCTGGGCACGGTGG + Intergenic
944092188 2:195924308-195924330 CAGCCCAGGGCTGGGCGTGGAGG + Intronic
944428048 2:199604036-199604058 CAGCCCAGTGCTGGGAGCGGAGG + Intergenic
944958756 2:204843660-204843682 GAGTTCTGGACTGGGCGCGGTGG - Intronic
945042649 2:205755113-205755135 AAGGCCAGGACTGGACGAGGAGG - Intronic
945080768 2:206085250-206085272 CAGGCCGGGGCGGGGCGGGGCGG - Intronic
945097282 2:206231604-206231626 CTGACCAGGGCCGGGCGCGGTGG - Intergenic
946188348 2:217994333-217994355 CAGTCCAGGCCTGGGGGTGGGGG + Intronic
946293621 2:218765362-218765384 CAGGCCAGGGCCAGGCTCGGTGG - Intergenic
946409033 2:219507374-219507396 CCGGCCAGGGCTGGGCTCAGCGG - Intergenic
946409487 2:219509075-219509097 CTGGCCAGGACAGGGTGGGGTGG + Intergenic
947541976 2:230985922-230985944 CAGGGTAGGCCTGGGCGCTGGGG + Intergenic
947551287 2:231048545-231048567 CAGACCAGAACTGGGGGCAGAGG - Exonic
947554651 2:231080853-231080875 GAAGCCAGGGCTGGGCACGGTGG + Intronic
947564658 2:231186121-231186143 CAGGCTAGGGCTGGGCAGGGAGG - Intergenic
947612911 2:231534746-231534768 AAGGTCAGGGCTGGGCGCGGTGG - Intergenic
947686259 2:232088257-232088279 CAGGCGTGGGCCGGGCGCGGTGG + Intronic
947837118 2:233183722-233183744 CAAGCCTGGACTGGGCACTGTGG + Intronic
948196828 2:236103010-236103032 GAGGCCAGGCCTGGGGGTGGGGG - Intronic
948415489 2:237799591-237799613 CAGGCCCTGGCCGGGCGCGGTGG - Intronic
948570131 2:238912649-238912671 GAGGCCAGGGCTGGGGGAGGAGG - Intergenic
948640349 2:239372005-239372027 CAGACCAGGGCAGGGCGCGTGGG + Intronic
948923209 2:241076748-241076770 GAGTCCAGGGCCGGGCGCGGGGG + Intronic
1169063135 20:2675922-2675944 CAGGCATGGGCTGGGCGTGGTGG + Intergenic
1169142530 20:3234416-3234438 CAGCCCAGGGCTGGGGGCTGGGG - Intronic
1169199120 20:3699115-3699137 CAGGGCAGGACAGGGCTGGGGGG + Intronic
1169499755 20:6148063-6148085 CTGGTCACGACTGGGCACGGAGG - Intergenic
1170570288 20:17628703-17628725 GAGGCCAGCACAGGGCCCGGAGG - Intronic
1171181620 20:23095000-23095022 CAGGCCAGAAGTGGGGGCGTGGG - Intergenic
1172247809 20:33457923-33457945 CAGGCCTGGGCTGGGTGCGGTGG - Intergenic
1172459669 20:35107859-35107881 AATTCCAGGGCTGGGCGCGGTGG + Intergenic
1172904896 20:38362007-38362029 GAGGTCAGGGCTGGGCGCGGTGG + Intronic
1173268596 20:41510430-41510452 TAGGCCAGGCCTTGGCTCGGAGG + Intronic
1173611241 20:44369898-44369920 GAGCCCAGGGCCGGGCGCGGCGG - Intronic
1174280925 20:49438688-49438710 GAAGCCAGGACGGGGCACGGTGG - Intronic
1174832062 20:53822313-53822335 TAGACTAGGGCTGGGCGCGGTGG - Intergenic
1175110065 20:56641627-56641649 CAAGGGAGGGCTGGGCGCGGTGG - Intergenic
1175271949 20:57740370-57740392 CAGACTCCGACTGGGCGCGGTGG + Intergenic
1175347645 20:58292917-58292939 CAGGTCTGGGCTGGGCGCGGTGG - Intergenic
1175348805 20:58302964-58302986 CAGGGCCGGGCTGGGTGCGGTGG - Intergenic
1175367753 20:58467364-58467386 CCGGCCGGGACTGCGCGCGGCGG - Exonic
1176019572 20:62955774-62955796 CACGCCAGGACAGGGCGTGGAGG + Intronic
1176025706 20:62984458-62984480 CAGCCCAGGACAGGGCAGGGAGG - Intergenic
1176299272 21:5090940-5090962 CAGGCCAGGCCTGTGCCCTGTGG + Intergenic
1177013847 21:15759761-15759783 CAGGCCATGACTGGAAGTGGGGG - Intronic
1177171709 21:17662504-17662526 CAGGAAAGGGCCGGGCGCGGTGG + Intergenic
1177652691 21:23979031-23979053 TAGGCCAGGGCCGGGCGCGGTGG + Intergenic
1177730453 21:25021990-25022012 CTCGGCGGGACTGGGCGCGGTGG - Intergenic
1178210098 21:30520480-30520502 CAGTGAAGGGCTGGGCGCGGTGG + Intergenic
1178444697 21:32628124-32628146 AAGGCCAGGGCCGGGCGTGGTGG - Intergenic
1178633324 21:34281203-34281225 CAGGCCTGGACTGAGCGCTTGGG + Intergenic
1179144614 21:38756692-38756714 CAGACAGGGGCTGGGCGCGGTGG - Intergenic
1179169958 21:38965237-38965259 CAGGCCAGGACGGGAAGTGGGGG + Intergenic
1179272172 21:39860028-39860050 CAGGACAGGACTGGGCATAGGGG - Intergenic
1179670179 21:42941426-42941448 CCGGCTAGGGCCGGGCGCGGTGG + Intergenic
1179783935 21:43719275-43719297 CATGCCGGGCCTGGCCGCGGCGG - Exonic
1179857754 21:44171007-44171029 CAGGCCAGGCCTGTGCCCTGTGG - Intergenic
1179910972 21:44448743-44448765 CTGGCCAGGGCTGGGCGCTTAGG - Intergenic
1180096349 21:45557035-45557057 CAGGCCAGGGCTGAGCCCAGGGG - Intergenic
1180143819 21:45908922-45908944 CAGGCCACGACTGGGTGTGGAGG - Intronic
1180177822 21:46098682-46098704 GAGGGCGGGACTGGGCGGGGAGG + Intronic
1180184548 21:46132955-46132977 GAGGTCAGGGCTGGGCCCGGGGG - Intergenic
1180712641 22:17849976-17849998 CATCCTGGGACTGGGCGCGGTGG - Intronic
1180879250 22:19192350-19192372 ATCGCCAGGGCTGGGCGCGGTGG - Intronic
1180938049 22:19638737-19638759 CAGGGCAGGGCTGGGGGAGGGGG + Intergenic
1180958288 22:19750858-19750880 CAGGGCAGGGCAGGGCGTGGAGG - Intergenic
1181037464 22:20176758-20176780 CAGGCCAGGGCTGGAGGCAGGGG + Intergenic
1181114772 22:20624727-20624749 CAGGGCAGGGCCGGGCGTGGTGG + Intergenic
1181121701 22:20671279-20671301 GAGGCCGGGCCGGGGCGCGGAGG - Intergenic
1181160476 22:20957174-20957196 GAAGCCCGGACTGAGCGCGGGGG - Intergenic
1181559599 22:23692443-23692465 CTGGCCTGGACTGGGCTTGGAGG + Exonic
1181634667 22:24169055-24169077 CAGGCCAGGGCTGGGGAGGGGGG + Intronic
1181721339 22:24777027-24777049 CAGGACAGGGCTGGGCACGGTGG + Intergenic
1181763456 22:25073979-25074001 TGGGGCAGGACTGGGCGCAGTGG - Intronic
1181791365 22:25269547-25269569 CAGCCCAGGGCTGGGCACGGTGG - Intergenic
1181793201 22:25283364-25283386 CAGGACAGGACAGGGCCGGGGGG - Intergenic
1181831806 22:25565459-25565481 CAGGACAGGACAGGGCTGGGGGG - Intronic
1181919557 22:26310246-26310268 AAAGTCAGGACTGGGCGTGGTGG + Intronic
1182123380 22:27800623-27800645 CAGCCCAGGATTGGGCGCTCCGG + Exonic
1182306322 22:29371442-29371464 CAGGCAGCGGCTGGGCGCGGTGG + Intronic
1182309634 22:29395435-29395457 CAGGCCTGGGCTGGGCGGGAGGG - Intronic
1182530831 22:30955243-30955265 CAGGCCAAGGCTGGGCGTGGTGG - Intronic
1182652930 22:31866669-31866691 AAGGAAAGGGCTGGGCGCGGTGG - Intronic
1182711336 22:32325201-32325223 CAGGCCTGGGCTGGGTGCTGGGG + Intergenic
1182769357 22:32782802-32782824 AAGGCCTGGGCTGGGCACGGTGG - Intronic
1182881606 22:33738570-33738592 CATGCCAGGGCCGGGCGCGGTGG + Intronic
1183236498 22:36622669-36622691 AAGACAAGGGCTGGGCGCGGTGG + Intronic
1183319829 22:37158260-37158282 AAGGGGAGGGCTGGGCGCGGTGG + Intronic
1183331302 22:37223288-37223310 CAGGCCCAGGCCGGGCGCGGTGG - Intergenic
1183376159 22:37466739-37466761 ATTGCCAGGGCTGGGCGCGGTGG + Intergenic
1183458413 22:37935217-37935239 AGGGCCAGGGCTTGGCGCGGTGG - Intronic
1183487171 22:38094862-38094884 CAAGCCAGGACCGGGCGTGGTGG + Intronic
1183538630 22:38417229-38417251 CAGGGAAGGACTGGGTGCGGAGG - Intergenic
1183727641 22:39598338-39598360 AAGGCCAGGACATGGGGCGGGGG - Intronic
1183738511 22:39657149-39657171 GAGGCCACGACTGGGGGCAGTGG - Intronic
1183821068 22:40346471-40346493 CAGGGCAGGACGGGGCGGGGCGG - Intergenic
1183864133 22:40690720-40690742 CAGGCCAGGCCTGGGAGGGCAGG - Intergenic
1183939274 22:41283959-41283981 CAGGCCAGGGCCGGGCGCAAAGG + Intronic
1183967520 22:41451211-41451233 CAGGTCAGGGCTGGGCGTGGTGG + Intergenic
1184061502 22:42085070-42085092 CAAGACTGGCCTGGGCGCGGTGG + Intergenic
1184161140 22:42697961-42697983 CAGGGCATGGCCGGGCGCGGTGG + Intronic
1184265782 22:43345125-43345147 CTGGCTAGGGCTGGGCGGGGGGG - Intergenic
1184409888 22:44320346-44320368 CAGCCCAGAACTGGGCATGGAGG + Intergenic
1184558700 22:45248527-45248549 CATTCCAGGGCTGCGCGCGGTGG - Intergenic
1184659948 22:45961134-45961156 CAGCCCAGAGCTGGGCGCGCCGG + Intronic
1184700725 22:46170872-46170894 GAGGCCAGGGCTGGGTGCAGTGG + Intronic
1184726278 22:46348520-46348542 CAGGCCAGGCCTAGGAGCGCTGG - Intronic
1184751488 22:46488944-46488966 CAGGGCTGGGCTGGGCGTGGTGG - Intronic
1184772165 22:46603800-46603822 GAGGCCGAGGCTGGGCGCGGTGG - Intronic
1184929393 22:47669861-47669883 CAGGCAAGGAATGTGTGCGGGGG + Intergenic
1184932579 22:47692118-47692140 CAGAAGAGGGCTGGGCGCGGTGG + Intergenic
1185049776 22:48547975-48547997 CAGGGCAGGACTGGGGCTGGAGG - Intronic
1185056364 22:48580728-48580750 CATGCCAAGACTGGGTGCAGGGG - Intronic
1185065017 22:48627818-48627840 CAGGCCTGGCCTGGGCACTGAGG + Intronic
1185203554 22:49523374-49523396 CAGGCCTGGAATGGGCTCTGAGG - Intronic
1185331581 22:50254363-50254385 AAGGAGAGGGCTGGGCGCGGTGG + Intronic
1185347468 22:50316899-50316921 CAGGCAAGGACAGGGCGGGGGGG + Intronic
949552263 3:5121227-5121249 CAGAACTGGGCTGGGCGCGGTGG - Intergenic
949818415 3:8087802-8087824 CAGCCCAGAACTGGCCGTGGTGG - Intergenic
949904698 3:8849331-8849353 CAGCCCAGGAGTGGTCGTGGCGG + Intronic
950036861 3:9892301-9892323 AAAGGCAGGGCTGGGCGCGGTGG - Intronic
950063006 3:10087932-10087954 GAGGCCAGGGCTGGGCACAGTGG - Intronic
950187305 3:10953032-10953054 GAGGCCAGGGCTGGGCTGGGTGG - Intergenic
951383026 3:22008641-22008663 ATGGCCCGGGCTGGGCGCGGTGG - Intronic
952245293 3:31582578-31582600 CAAACTAGGGCTGGGCGCGGTGG - Intronic
952268800 3:31812317-31812339 CTGGCCAGGGCCAGGCGCGGTGG - Intronic
952316643 3:32238311-32238333 CGCTCCAGGACTCGGCGCGGAGG - Intergenic
952373714 3:32747660-32747682 CAGGCATGGGCTGGGCTCGGTGG + Intronic
952496020 3:33916398-33916420 CATGCCAGCACAGGGCGTGGTGG - Intergenic
953024673 3:39138010-39138032 CAGGCCAGGAATGGGAGTGGCGG + Intronic
953440649 3:42913975-42913997 CAGGCCAGGACTTAGGGCAGAGG - Intronic
953499685 3:43421231-43421253 CTGGCCAGGGCTGGGAGCGGTGG + Intronic
954356732 3:50088284-50088306 GAGGCCGGTGCTGGGCGCGGTGG - Intronic
954368533 3:50158398-50158420 GAGGCCAGGGCTGGGGGAGGTGG + Intronic
954558780 3:51538768-51538790 CCGGCCAGGCCCGGGCGCCGCGG - Intergenic
955175708 3:56611571-56611593 CTTGCCAGAACTGGGCGTGGGGG - Intronic
955265948 3:57444878-57444900 CAGGCCGGGGCTGGGAGGGGAGG - Intronic
955326293 3:58011197-58011219 GAGGACCGGGCTGGGCGCGGTGG - Intronic
955762644 3:62304463-62304485 CAGACCTGGACTGGGCATGGTGG + Intergenic
955865876 3:63383427-63383449 GAGGCCAGGACCAGGCGCAGTGG + Intronic
956247916 3:67204818-67204840 AAGGCCAGGGCCGGGCGTGGTGG - Intergenic
956794233 3:72703559-72703581 CAAGACAGGGCTGGGCGTGGTGG + Intergenic
956813379 3:72886595-72886617 CAGGGACGGGCTGGGCGCGGTGG + Intergenic
958785723 3:98594185-98594207 CAGGCTGGGGCCGGGCGCGGTGG + Intergenic
959008233 3:101044910-101044932 AAGGCCTTGGCTGGGCGCGGTGG + Intergenic
959222000 3:103531974-103531996 AAGGACAGGACCGGGTGCGGTGG - Intergenic
959661006 3:108868392-108868414 CCAGGCAGGGCTGGGCGCGGTGG + Intergenic
960317735 3:116198788-116198810 CAGAACTGGACTGGGCGCAGCGG + Intronic
960903146 3:122572198-122572220 CACTCCAGGGCTGGGCGCGGTGG - Exonic
960991044 3:123311607-123311629 CAGGCCAGGAGAGGAGGCGGCGG + Intronic
961454785 3:127018565-127018587 CAGGCCAGGGCCTGGCTCGGAGG - Intronic
961766918 3:129218682-129218704 CAAGTCAGGGCCGGGCGCGGTGG - Intergenic
961849560 3:129801720-129801742 CAGGCATGGGCCGGGCGCGGTGG - Intronic
962160366 3:132992821-132992843 CAGCCCAGGGCTGGGCACTGCGG + Intergenic
962265587 3:133942279-133942301 CAAGCCTAGGCTGGGCGCGGTGG - Intronic
962520672 3:136195584-136195606 CATCCCAGTACAGGGCGCGGAGG + Exonic
962966156 3:140356470-140356492 AATTCCAGGGCTGGGCGCGGTGG + Intronic
963106176 3:141649054-141649076 CAAACCAGGGCTGGGCGCGGTGG + Intergenic
963128285 3:141835030-141835052 GAGGAGAGGGCTGGGCGCGGTGG - Intergenic
963140577 3:141943042-141943064 GTGGCCAGGGCCGGGCGCGGTGG - Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
964348697 3:155781480-155781502 TGGGCCAGGGCTGGGCGCAGTGG + Intronic
964472825 3:157072366-157072388 CAGCCCAGGAGTGGGCACAGTGG + Intergenic
966787033 3:183631224-183631246 GAGATCAGGGCTGGGCGCGGTGG + Intergenic
966814398 3:183878076-183878098 CTGGCTGGGGCTGGGCGCGGTGG - Intronic
966892679 3:184418506-184418528 GAGGCCACGTCTGGGGGCGGTGG - Intronic
967029019 3:185588330-185588352 CGGGCGAGGGCCGGGCGCGGTGG - Intronic
967045552 3:185733467-185733489 CAGAGCCAGACTGGGCGCGGTGG + Intronic
967095176 3:186172132-186172154 CAAGCGGGCACTGGGCGCGGTGG - Intronic
967174396 3:186849979-186850001 GAGGCAAGGACTGGGCGTGGTGG + Intronic
968059503 3:195716520-195716542 TTGGCCAGGGCTGGGCGTGGTGG + Intergenic
968138153 3:196234033-196234055 CAGGACACGGCCGGGCGCGGGGG + Intronic
968160501 3:196423076-196423098 CAGGCGAGGACTTGGCGGGCTGG - Intronic
968303298 3:197632021-197632043 CAGACCAGGAAAGGGCGGGGGGG - Intergenic
968366679 3:198190774-198190796 CAGGCCCAGGCTGGGCGCAGTGG - Intergenic
968485521 4:859170-859192 CAGGCCCGGCCCGGGCGCTGTGG - Intronic
968600330 4:1505673-1505695 CATGCCAGGGCTGTGCACGGGGG - Intergenic
968685033 4:1952288-1952310 CAGGGCAGGACTTGGTGCAGGGG - Intronic
968797885 4:2721024-2721046 CAGGCGTGGGCCGGGCGCGGTGG + Intronic
969109186 4:4831166-4831188 GAGGAAAGGGCTGGGCGCGGTGG + Intergenic
969349376 4:6589526-6589548 CAGAATAGGGCTGGGCGCGGCGG - Intronic
969712458 4:8851842-8851864 CAGCCCAGGCCTGGGCACTGTGG + Intronic
969870524 4:10101708-10101730 CAGGGCAGGCCTGGGCCCGCAGG + Intronic
970190306 4:13509725-13509747 CAAGCCAGAACAGGGCACGGGGG - Intergenic
970281736 4:14464197-14464219 CAGTGCAGGGCTGGGTGCGGTGG - Intergenic
971944410 4:33255326-33255348 CAGGCGAGGAATGGGTGCTGGGG + Intergenic
972406999 4:38756383-38756405 CAGGTTGGGGCTGGGCGCGGTGG - Intergenic
972420484 4:38882023-38882045 CTGACCAGGGCCGGGCGCGGTGG + Intronic
972501602 4:39683225-39683247 CAAACCAGGGCTGGGCGCAGTGG - Intergenic
972544426 4:40066605-40066627 CAGACCAGGGCTAGGCACGGTGG - Intronic
972572642 4:40324853-40324875 CTACCCAGGACTGGGCACGGTGG + Intergenic
973211327 4:47618530-47618552 GAGGCGAGGGCTGGGCGCAGTGG + Intronic
973925041 4:55728603-55728625 ACGGCCAGGGCCGGGCGCGGTGG - Intergenic
973958976 4:56090680-56090702 CTGGCCCTGACTGGGCGCAGTGG - Intergenic
974003125 4:56530556-56530578 CGGGGCGGGGCTGGGCGCGGGGG + Intergenic
975351393 4:73351222-73351244 AAGGCCCTGGCTGGGCGCGGTGG + Intergenic
975548095 4:75580985-75581007 AAAGCCAAGGCTGGGCGCGGTGG - Intronic
975592270 4:76011768-76011790 CAGGCCTGAGCTGGGCGCAGCGG - Intronic
977597142 4:98895908-98895930 CAGGCATGGGCTGGGCGCAGTGG + Intronic
977959762 4:103072342-103072364 AAGACCAGGGCTGGGTGCGGTGG - Intronic
978497971 4:109380269-109380291 GAGTCCAGGGCTGGGTGCGGTGG - Intergenic
979333248 4:119440122-119440144 CAGGCCCAGGCTGGGTGCGGTGG + Intergenic
979677081 4:123421112-123421134 CAAGACATGGCTGGGCGCGGTGG - Intergenic
979807783 4:124996452-124996474 AAAGCCAGGCATGGGCGCGGTGG + Intergenic
981728844 4:147876303-147876325 CAAGATAGGGCTGGGCGCGGTGG + Intronic
982201794 4:152968615-152968637 CAGGCTTGGGCTGGGCGCGGTGG - Intronic
982445359 4:155484553-155484575 CATGCCTTGGCTGGGCGCGGTGG + Intergenic
982552254 4:156817769-156817791 TAGGCTAGGGCTGGGCGTGGTGG + Intronic
982710731 4:158756218-158756240 CAGGCCAGGGCTGGGTGTGGTGG - Intergenic
984139415 4:175984448-175984470 CAGGAGAGGGCTGGGCGCGGTGG - Intronic
984367943 4:178822332-178822354 GAGCCCAGGGCTGGGCACGGTGG + Intergenic
984696669 4:182786267-182786289 GAAGCCAGGGCTGGGCACGGTGG + Intronic
985659037 5:1146560-1146582 CAGGCCACGACGGGAAGCGGTGG + Intergenic
985909201 5:2865809-2865831 TACACCAGGACTGGGCGCTGTGG - Intergenic
986683263 5:10252460-10252482 CAGGCATTGACTGGGCGCGGTGG + Intronic
986721537 5:10564175-10564197 CTGGCCAGGAAGGGGCGCGAGGG + Intergenic
987035128 5:14011728-14011750 CAGACGAGGGCAGGGCGCGGCGG - Intergenic
988147029 5:27323243-27323265 CAAGACAGGGCCGGGCGCGGTGG + Intergenic
989394840 5:40943047-40943069 TAGGCCAGGCATGGGCGTGGCGG - Intronic
989586540 5:43078313-43078335 CAGGCTGGGGCTGGGCGCCGTGG + Intronic
990307994 5:54511548-54511570 CAGGCCAGGGCTGGGCGTGGTGG - Intergenic
990740943 5:58912071-58912093 GATACCAGGGCTGGGCGCGGTGG - Intergenic
991327254 5:65448738-65448760 AATGCCAGGGCCGGGCGCGGTGG - Intronic
991426219 5:66494775-66494797 CAGGGATGGACTGGGGGCGGTGG + Intergenic
991681023 5:69139532-69139554 AAGGCCATGGCCGGGCGCGGTGG - Intergenic
992253505 5:74898869-74898891 CAGAACAGGGCTGGGCGCAGTGG - Intergenic
992882265 5:81122080-81122102 CATGCCAGCACTGGGGGCTGAGG - Intronic
992965338 5:81993711-81993733 CAGGCTAAGGCTGGGCACGGTGG - Intronic
993518079 5:88862762-88862784 TAGGGCAGGAGTGGGCGCTGAGG + Intronic
995156411 5:108918772-108918794 CAGTCCAAGGCGGGGCGCGGTGG - Intronic
996700290 5:126444103-126444125 TAGGCCAGGACTGGTGGTGGTGG - Intronic
997203453 5:132026760-132026782 CAGGTCTGGGCTGGGGGCGGTGG + Intergenic
997332048 5:133071178-133071200 AAGGCAAGGACTGGGCATGGTGG + Intronic
997525312 5:134549234-134549256 CAGCCCAGGGCCGGGCGCGGTGG + Intronic
997529129 5:134571409-134571431 CAGCCCTGGGCCGGGCGCGGTGG + Intronic
997560966 5:134846006-134846028 CGGGGCAGGACCGTGCGCGGCGG + Exonic
998443609 5:142181735-142181757 CAGGCCAAGAATGGGAGCAGCGG + Intergenic
1000320847 5:160133343-160133365 CAGGCCAGGAGTGGGTGGGCGGG - Intergenic
1000321784 5:160140140-160140162 CAGGCATGGGCTGGGCGCAGTGG + Intergenic
1000949667 5:167465540-167465562 CATGCCCGGGCCGGGCGCGGTGG + Intronic
1001122938 5:168994927-168994949 AATGCCAGGGCTGGGCGCAGTGG - Intronic
1001450498 5:171820801-171820823 CGGGCCAGGAGTGGGGGAGGGGG + Intergenic
1001497793 5:172202051-172202073 CAGGCTGGGGTTGGGCGCGGTGG + Intronic
1001734906 5:173989603-173989625 CAGGGCGGGACCGGGCGCGGCGG + Intronic
1002191637 5:177481266-177481288 GAGGCCAGGGCTGGGCGCGTTGG - Intergenic
1002206448 5:177566083-177566105 CAGGCCTGGGCTGAGCGTGGTGG - Intergenic
1002314361 5:178333681-178333703 CAGGCCCGGCCTGGGGGCAGAGG - Intronic
1002331542 5:178444505-178444527 CAGGACAAGACTGGGTGTGGTGG + Intronic
1002725904 5:181295974-181295996 CAGGCCCAGGCTGGGCGCAGTGG - Intergenic
1002771682 6:295485-295507 AAAGACAGGACTGGGCGTGGTGG + Intronic
1002874894 6:1202032-1202054 CAGGGTAGGCCTGGGGGCGGGGG - Intergenic
1003197713 6:3929758-3929780 CAGTCCAAGGCCGGGCGCGGTGG + Intergenic
1004515324 6:16317610-16317632 AAGGCCATCCCTGGGCGCGGTGG - Intronic
1004684202 6:17926848-17926870 AAAGCAGGGACTGGGCGCGGTGG + Intronic
1004842042 6:19598568-19598590 CCGGCCTGGGCCGGGCGCGGTGG - Intergenic
1004979787 6:21010794-21010816 CTGACCAGGGCTGGGCGCGATGG + Intronic
1005574040 6:27175682-27175704 CAGGACAGGGCTGGGCGCGGTGG + Intergenic
1005995331 6:30927521-30927543 CAGGGCAGGGCTGGGCATGGTGG - Intergenic
1006126812 6:31844209-31844231 CTGGGCATGGCTGGGCGCGGTGG - Intergenic
1006636045 6:35461932-35461954 TAGGTCAGGGCTGGGCACGGTGG - Intronic
1006671754 6:35733785-35733807 CAGTTCAGGGCTGGGCGCGGTGG - Intergenic
1006782988 6:36644694-36644716 CAGTTTGGGACTGGGCGCGGTGG - Intergenic
1006793005 6:36715923-36715945 CAGGGCAGGACAGGGCCGGGAGG - Intronic
1007126656 6:39431439-39431461 CAGTCCAGGGCTTGGCGCTGTGG - Intronic
1007474709 6:42111567-42111589 TTAGCCAGGGCTGGGCGCGGTGG - Intronic
1007485532 6:42178441-42178463 CCGGCCAGGGCTGGGGGCAGCGG + Intronic
1007618027 6:43193689-43193711 CTGGCCTGGGCTGGGCACGGTGG - Intronic
1007628057 6:43257688-43257710 CAGGACAGGAATGGGCCTGGAGG - Intronic
1008513559 6:52299101-52299123 CAGGCCAGGGCTGGGTGTGAGGG - Intergenic
1008620056 6:53263020-53263042 AAGGCCAGGGCTGGGTGTGGTGG - Intergenic
1009623653 6:66107662-66107684 CTGGGCATGGCTGGGCGCGGTGG - Intergenic
1010363849 6:75027193-75027215 CAGGACAGGGCCAGGCGCGGTGG + Intergenic
1010935031 6:81850676-81850698 CAGGAAGGGGCTGGGCGCGGTGG + Intergenic
1011050654 6:83145292-83145314 GAGGCCAGGGCTGGGTGCAGTGG + Intronic
1011621579 6:89248731-89248753 CAGATGAGGGCTGGGCGCGGTGG - Intergenic
1012883814 6:104822079-104822101 CAGGCGTGGGCCGGGCGCGGTGG + Intronic
1013288879 6:108703880-108703902 CAGGCCAGGGCCAGGCGCGGTGG + Intergenic
1013509592 6:110832290-110832312 CAGGCATGGGCTGGGCACGGTGG - Intronic
1015769065 6:136750363-136750385 CAGGACAAGGCTGGGTGCGGTGG - Intronic
1015898486 6:138039707-138039729 AAGGCCAGGCCCGGGCGCGGTGG - Intergenic
1015991036 6:138943033-138943055 TAGGCCAGGGCCGGGTGCGGTGG - Intronic
1016020182 6:139228969-139228991 GAGGCCAGGACTGGGTGAGTGGG + Intergenic
1016361928 6:143276587-143276609 AAAGCCAGCACTGGGCGCTGGGG + Intronic
1016742793 6:147546240-147546262 GAGGCCTGGGCTGGGCGCGGTGG + Intronic
1017157099 6:151332321-151332343 CAGGGCTGGGCCGGGCGCGGTGG - Intronic
1017401489 6:154069522-154069544 CAGGCCAGGGCTCGGCGCGGTGG - Intronic
1017590892 6:155976931-155976953 CAGGCCTGGGCTGGGTGCTGGGG + Intergenic
1017722202 6:157251529-157251551 CAGGGTGGGCCTGGGCGCGGTGG - Intergenic
1017729389 6:157301644-157301666 CAGTCCAGGGCTGGACGCAGTGG + Intronic
1017945476 6:159093532-159093554 CCAGCCTCGACTGGGCGCGGTGG - Intergenic
1017999180 6:159563941-159563963 AAGTCCTGGGCTGGGCGCGGTGG + Intergenic
1018062508 6:160102021-160102043 CAGGCCAGGACGGGGCCCAGGGG - Intronic
1018154030 6:160968936-160968958 GAGGCCCAGACTGGGCGCGGTGG + Intergenic
1018391891 6:163347077-163347099 CAGGCCAGGGCTGGGCAATGCGG + Intergenic
1018846626 6:167561326-167561348 CAAGGCAGGACTGGACCCGGTGG + Intergenic
1019156251 6:170040760-170040782 CAGGCCATGACGGGAAGCGGGGG + Intergenic
1019394001 7:806892-806914 TAGGCCAGGGCTGGGCGCTGTGG + Intergenic
1019480148 7:1262655-1262677 CTGGGCAGGACAGGGCGCAGGGG + Intergenic
1019503104 7:1375390-1375412 CGGGCCAGGACCGGGCGCGGTGG - Intergenic
1019611457 7:1938932-1938954 CAGGCCAGGACCGGGACCAGAGG + Intronic
1019730044 7:2624494-2624516 CAGGCCAGCAGCGGGCGTGGAGG - Intergenic
1019854040 7:3586408-3586430 GAGGACAGGGCCGGGCGCGGTGG + Intronic
1020016944 7:4836648-4836670 AGCACCAGGACTGGGCGCGGTGG + Intronic
1020036944 7:4969616-4969638 AAGGCCAGGGCTGGGCACAGCGG + Intergenic
1020076135 7:5260277-5260299 CAGGCAAGGCCTGGGTGTGGCGG - Intergenic
1020081271 7:5287128-5287150 CAGGTGAGGGCTGGGCGCAGTGG + Intronic
1020111292 7:5449068-5449090 AAAGCCAGGACTGGGCACGGTGG + Intronic
1020163340 7:5789065-5789087 AAGGCCAGGGCTGGGCACAGCGG - Intergenic
1020181104 7:5923029-5923051 AGGGCCAGGGCCGGGCGCGGGGG + Intronic
1020301829 7:6801859-6801881 AGGGCCAGGGCCGGGCGCGGGGG - Intronic
1020686973 7:11308419-11308441 CAGCTCAGGGCTGGACGCGGTGG + Intergenic
1021497280 7:21290180-21290202 CAAGGCAGGGCTGGGTGCGGTGG + Intergenic
1022009663 7:26297941-26297963 GATGACAGGGCTGGGCGCGGTGG + Intronic
1022358058 7:29634427-29634449 CTGTCCAGGGCTGGGCGCAGTGG + Intergenic
1022446813 7:30477806-30477828 GAAGCCAGGGCCGGGCGCGGTGG - Intronic
1022537353 7:31106424-31106446 CAGGCCAGGACAGGGCCTGGAGG + Intronic
1022653746 7:32299360-32299382 CAGGCCAGTGCTGGGGGCAGTGG - Intergenic
1022973726 7:35538730-35538752 CAGACCAGGAAGGGCCGCGGGGG - Intergenic
1022989417 7:35693921-35693943 CAGGCAAAGACCGGGCGCGGTGG - Intronic
1023178644 7:37458562-37458584 TAGGACATGGCTGGGCGCGGTGG - Intergenic
1023776205 7:43610057-43610079 ATGGCCAGGGCCGGGCGCGGTGG + Intronic
1023997741 7:45172235-45172257 TAGCCCAGGACTGGGAGCTGGGG + Intronic
1024070794 7:45783542-45783564 CAGGCCCAGGCTGGGCGCAGTGG - Intergenic
1024243034 7:47449891-47449913 TAGACCAGGGCTGGGCGTGGTGG - Intronic
1024276333 7:47679982-47680004 CAGGCCATGACGGGGAGAGGGGG + Intergenic
1025191846 7:56901660-56901682 GTAGCCAGGGCTGGGCGCGGTGG - Intergenic
1025202955 7:56973294-56973316 CAGGCAAGGGCTGGGCATGGCGG + Intergenic
1025668989 7:63603632-63603654 CAGGCAAGGGCTGGGCATGGCGG - Intergenic
1025962243 7:66232642-66232664 CAGGCATGGGCCGGGCGCGGTGG - Intronic
1026023689 7:66729235-66729257 GAGGTCAGGGCTGGGTGCGGTGG - Intronic
1026071860 7:67128974-67128996 GAGACCTAGACTGGGCGCGGTGG - Intronic
1026097239 7:67356197-67356219 AAGGCCAGGGCTGGGCGCGGTGG + Intergenic
1026465331 7:70648871-70648893 CCTTCCAGGGCTGGGCGCGGTGG - Intronic
1026833588 7:73624118-73624140 CGGGGCAGGACTGCGCGCTGGGG - Intronic
1026976669 7:74502877-74502899 GTGTCCAGGGCTGGGCGCGGTGG + Intronic
1026999828 7:74644751-74644773 AAGACCTGGACTGGGCGCGGTGG + Intergenic
1027027981 7:74868312-74868334 GATGCCATGGCTGGGCGCGGTGG + Intergenic
1027059769 7:75075759-75075781 GATGCCATGGCTGGGCGCGGTGG - Intergenic
1027134944 7:75617502-75617524 CAGGCTGAGGCTGGGCGCGGTGG - Intronic
1027217931 7:76196117-76196139 GGGGACAGGGCTGGGCGCGGTGG + Intergenic
1027259114 7:76451561-76451583 TTGGCCAGGGCTGGGCGCGGTGG - Intergenic
1027310485 7:76949645-76949667 TTGGCCAGGGCTGGGCGCGGTGG - Intergenic
1029260620 7:99300245-99300267 CAAGACAGGGCTGGGCGTGGTGG - Intergenic
1029454340 7:100660637-100660659 GAGGCCAGGGCCGGGCGCAGTGG + Intergenic
1029624171 7:101709387-101709409 GAGGCCAGGACTGGAGGCAGAGG + Intergenic
1029671758 7:102037637-102037659 CAGCCCAGGGCCGGGCGTGGTGG - Intronic
1029713317 7:102311787-102311809 CAGGGGAGGGCTGGGCGTGGTGG + Intronic
1031085400 7:117297455-117297477 CTGTACAGGGCTGGGCGCGGTGG - Intronic
1031202188 7:118702370-118702392 GAGGCCAGGGCTGGGCACAGTGG + Intergenic
1031459973 7:122036983-122037005 AAGGGCAGGGCTGGGCGCGGTGG + Intronic
1031979687 7:128116600-128116622 CTGGCCAGGCCTGGGAGCCGAGG + Intergenic
1032130614 7:129224891-129224913 CAGACCGGGACGGGGCGGGGCGG + Intergenic
1032143009 7:129350989-129351011 TAGGCCGGGGCCGGGCGCGGTGG - Intronic
1032245078 7:130204625-130204647 CCAGCCACGGCTGGGCGCGGTGG - Intronic
1032367554 7:131314707-131314729 CAAACAAGGGCTGGGCGCGGTGG - Intronic
1032386750 7:131530455-131530477 CAGGTCAGGGCTGGGCTTGGTGG + Intronic
1032792102 7:135249969-135249991 CAGGCCAGGGCTGGGCGATAAGG + Intronic
1033206213 7:139425193-139425215 CAAGCCTGGGCCGGGCGCGGTGG - Intergenic
1033321072 7:140340023-140340045 CAGGAAAGGGCCGGGCGCGGTGG - Intronic
1034085424 7:148317966-148317988 CAGGGCAGGGCCGGGCACGGAGG - Intronic
1034135347 7:148762857-148762879 CAGGCCTAGGCCGGGCGCGGTGG + Intronic
1034183581 7:149157245-149157267 CAGGACAGGGCGGGGCACGGTGG + Intronic
1034456547 7:151174042-151174064 CAGGCCAGAGGTGGTCGCGGCGG - Intronic
1034622698 7:152468532-152468554 AAGGCAAAGGCTGGGCGCGGTGG - Intergenic
1035108013 7:156458208-156458230 CAGGGCAGCATTGGGCGGGGAGG + Intergenic
1035185926 7:157125759-157125781 CAGGCAAGGGCCGGGCTCGGGGG + Intergenic
1035476498 7:159147880-159147902 CAGGCCATGACAGGGAGAGGGGG + Intergenic
1035679763 8:1479266-1479288 CAGGCGGGGATTGGGGGCGGTGG + Intergenic
1035759158 8:2056443-2056465 CAGGCCAGGCCTGGCCGTGTTGG + Intronic
1036493851 8:9251807-9251829 CAGGCTGGGGCTGGGCACGGTGG + Intergenic
1037807409 8:22066415-22066437 CAGGCCGGGCCGGGGCGGGGAGG + Intronic
1037829693 8:22180157-22180179 CAGGGCAGCACTGGGCTGGGAGG + Intronic
1037899980 8:22682457-22682479 CAGGCCTGGTCTGGGGGCAGAGG - Intergenic
1037995872 8:23352099-23352121 CTGTCCAGGGCTGGGCACGGTGG - Intronic
1038718433 8:30012203-30012225 CAGGTCAGGACTGGGAGGTGAGG + Intergenic
1039032671 8:33327063-33327085 TAGGGCAGGAGTGGGCGCAGTGG - Intergenic
1039058534 8:33555488-33555510 CAGAACAGGGCTGGGCGTGGTGG - Intronic
1039754649 8:40510751-40510773 CAAGCCAGGGCTGGGTGTGGTGG - Intergenic
1039769302 8:40667439-40667461 CAGGACAGGGCCGGGCACGGTGG - Intronic
1040464233 8:47679417-47679439 CAGGCCAGCACTGGAGGGGGCGG - Intronic
1040464261 8:47679503-47679525 CAGGCCAGCACTGGAAGGGGTGG - Intronic
1040593213 8:48815405-48815427 CAGGCCAGGAGGGGGTGGGGTGG - Intergenic
1041817274 8:61988391-61988413 AAAGAGAGGACTGGGCGCGGTGG - Intergenic
1042484316 8:69334151-69334173 CACCCCAGGACCTGGCGCGGAGG - Intergenic
1042787548 8:72566410-72566432 TAGGCAAGGGCTGGGCACGGTGG + Intronic
1043439398 8:80263567-80263589 TAACACAGGACTGGGCGCGGTGG - Intergenic
1043579833 8:81699198-81699220 TAGGCCAGGGCTGGGCACAGTGG - Intergenic
1043961072 8:86419130-86419152 CAGACTAGGGCTGGGCGCGGTGG + Intronic
1045022878 8:98059665-98059687 TTGGCCAGGGCCGGGCGCGGTGG - Intergenic
1045334393 8:101185864-101185886 CAGGCGTGGGCCGGGCGCGGTGG + Intronic
1045468818 8:102492879-102492901 CAGCCTAGGGCTGGGCGCGGTGG - Intergenic
1046075634 8:109308682-109308704 CAGGACCAGACTGGGTGCGGTGG + Intronic
1046312944 8:112463068-112463090 CAAACCAGGGCTGGGCGCAGTGG + Intronic
1046660417 8:116942711-116942733 CACGCAAGGGCTGGGCGCGGTGG + Exonic
1046829621 8:118730267-118730289 GAGTCCAGGACTGGCCGCTGTGG + Intergenic
1047489103 8:125359618-125359640 CATGCCATGGCTGGGCGCGATGG - Intronic
1047770434 8:128026228-128026250 AAGGCTGGGACTGGGTGCGGTGG - Intergenic
1047961826 8:130016670-130016692 GCGGCGGGGACTGGGCGCGGGGG - Intronic
1048233635 8:132668727-132668749 CAGCTCAGGGCCGGGCGCGGTGG - Intronic
1048352122 8:133624722-133624744 TAAGCCAGGGCCGGGCGCGGTGG + Intergenic
1048360943 8:133696801-133696823 CAGGCCTGTAGTGGGCGCTGCGG + Intergenic
1048558966 8:135511843-135511865 CAGAGCAGGGCTGGGTGCGGTGG - Intronic
1049199679 8:141333976-141333998 CAGGACAGGTCTGGCTGCGGTGG + Intergenic
1049286496 8:141778198-141778220 CAGGCCTGGCATGGGCTCGGGGG + Intergenic
1049352179 8:142170282-142170304 CAGGCCAGGCCTGAGCGCTACGG + Intergenic
1049393376 8:142383277-142383299 CAGGCCAGGGCAGGGCACAGAGG + Intronic
1049550992 8:143259612-143259634 GAGGCCAGGGTTGGGGGCGGGGG - Intronic
1049638056 8:143699946-143699968 CAGCCCTAGGCTGGGCGCGGTGG + Intronic
1049683082 8:143928339-143928361 CAGCCCAAGACTGGGCGAAGGGG + Intronic
1049692288 8:143966715-143966737 CAGGGCAGGGCTCGGCTCGGGGG + Intronic
1049694615 8:143977217-143977239 CGGGCGAGGTCTGGGAGCGGCGG + Exonic
1049728038 8:144160054-144160076 CAGGCGTGGGCCGGGCGCGGTGG - Intronic
1049783635 8:144440231-144440253 CAGCTCAGGACTGGGGGCTGTGG + Intronic
1049891266 9:73084-73106 AGGGCCAGGAGAGGGCGCGGCGG + Intergenic
1049918366 9:340332-340354 CAGGCTCGGGCTGGGCGTGGTGG + Intronic
1049934775 9:491246-491268 CACTCCAGGAGTGGGCACGGTGG - Intronic
1050542942 9:6685655-6685677 TAGGCCATGGCTGGGCGTGGTGG - Intergenic
1050878128 9:10666923-10666945 TAGGCCAGGGCTGGGCGCAGTGG - Intergenic
1052270951 9:26627333-26627355 CAGTCCTAGGCTGGGCGCGGTGG + Intergenic
1052907335 9:33847380-33847402 CAAGCCAGGGCCGGGCGCAGTGG - Intronic
1053475796 9:38381424-38381446 CAGGGCAGGGCAGGGCGGGGTGG - Intergenic
1053557336 9:39151265-39151287 CAAAGCAGGGCTGGGCGCGGTGG + Intronic
1053821442 9:41971534-41971556 CAAAGCAGGGCTGGGCGCGGTGG + Intronic
1054090319 9:60839682-60839704 CAAAGCAGGGCTGGGCGCGGTGG + Intergenic
1054111730 9:61115239-61115261 CAAAGCAGGGCTGGGCGCGGTGG + Intergenic
1054139779 9:61467684-61467706 CAAAGCAGGGCTGGGCGCGGTGG - Intergenic
1054609126 9:67215882-67215904 CAAAGCAGGGCTGGGCGCGGTGG - Intergenic
1055618670 9:78100030-78100052 CAGTCCAAGGCTGGGCGCGGAGG - Intergenic
1056594267 9:87993069-87993091 TAGGACATGACCGGGCGCGGTGG - Intergenic
1057019896 9:91689030-91689052 CAGGCCAGGCCTGCACGGGGTGG + Intronic
1057053240 9:91941749-91941771 CAGGGCGGGGCTGGGCGGGGTGG - Intronic
1057201641 9:93143572-93143594 CAGGTAGGGGCTGGGCGCGGTGG + Intergenic
1057300633 9:93879821-93879843 CATGGCCGGAGTGGGCGCGGAGG - Intergenic
1057556805 9:96094696-96094718 CAGCCCAGGTCTGGAGGCGGGGG + Intergenic
1057563049 9:96143566-96143588 CAAGACAGGGCTGGGCGCGGTGG - Intergenic
1057716811 9:97502025-97502047 CTGGCCAGGGCTGCGCGCGCGGG - Intronic
1058569800 9:106328641-106328663 CAAGCCAGGACTGGACGTGGTGG + Intergenic
1058873002 9:109218624-109218646 AGGGCCAAGACTGGGGGCGGGGG - Intronic
1059140197 9:111845914-111845936 CAGTACAGGGCCGGGCGCGGTGG + Intergenic
1059204732 9:112453678-112453700 GAGGCCAAGGCTGGGCGTGGCGG - Intronic
1060410828 9:123399081-123399103 CAGGCCACGGCCGGGCGCGGTGG - Intronic
1060569932 9:124628945-124628967 AAGGCCAGGGCCGGGGGCGGTGG - Intronic
1060664984 9:125427498-125427520 CAGGCCTGCTCTGGGCGCTGGGG + Intergenic
1060945404 9:127567347-127567369 CAGGCCTGGACTGTGGGAGGAGG - Intronic
1060952336 9:127612254-127612276 GACGCGCGGACTGGGCGCGGGGG - Exonic
1061002689 9:127911195-127911217 CAGGCCAGGAGTGGTGGGGGCGG + Intronic
1061048348 9:128179618-128179640 CAGTCTTGGGCTGGGCGCGGTGG - Intronic
1061069697 9:128301645-128301667 GAAGCTAGGGCTGGGCGCGGTGG + Intergenic
1061076437 9:128344228-128344250 GAGTCCAGGGCTGGGCGCAGTGG + Intronic
1061267091 9:129512811-129512833 AATGCCAGGGCTGGGCGCAGTGG + Intergenic
1061330780 9:129890867-129890889 GAGGCCGGGGCTGGGCGCCGTGG + Intronic
1061465959 9:130779996-130780018 CAGCCCTGGGCCGGGCGCGGTGG + Intronic
1061477509 9:130878236-130878258 CAGGACAAGGCTGGGTGCGGTGG - Intronic
1061545367 9:131301386-131301408 CAGACCAGGACTGGGCTCCATGG - Intronic
1061625691 9:131839382-131839404 CTGGCCAGGACAGGGCGAGGAGG + Intergenic
1061626074 9:131841502-131841524 CAGGCATGGCCTGGGCGAGGCGG - Intergenic
1061664120 9:132150387-132150409 GACGCCAAGACTGGGCGCCGCGG - Intergenic
1061792727 9:133066956-133066978 GAGGGCAGGGCTGGGCGGGGTGG + Intronic
1061882900 9:133576928-133576950 CAGGCCAGGGCTCTGCCCGGCGG - Intergenic
1061969649 9:134037282-134037304 CAACGCAGGGCTGGGCGCGGTGG + Intronic
1062117313 9:134816458-134816480 CTGGGCAGGACTGGGCCTGGAGG + Intronic
1062194752 9:135266782-135266804 CAGGGCAGGACAGGGCATGGGGG - Intergenic
1062288971 9:135786164-135786186 CAGGGCAGGGCAGGGCGGGGAGG - Intronic
1062309804 9:135929638-135929660 CTGGGCAGGGCTGGGGGCGGGGG - Intergenic
1062323359 9:136001261-136001283 CCGGCCAGGGCTGGGGGCTGGGG - Intergenic
1062349601 9:136132561-136132583 CATCCCAGGACTGGGCGGCGGGG - Intergenic
1062392027 9:136337676-136337698 GAGGCCAGGACTCGGTGGGGCGG - Intronic
1062456170 9:136640224-136640246 CATCCCAGGGCTGGGTGCGGTGG - Intergenic
1062483459 9:136763090-136763112 CTGGCCAGGACCGGGTGGGGTGG - Intronic
1062483469 9:136763110-136763132 CAGGCCAGGAGTGTGTGCGAAGG + Intronic
1062523527 9:136969329-136969351 CAGGGCAGGACAGGGCAGGGAGG + Exonic
1062537639 9:137027909-137027931 CAGGCGAGGGCAGGGCCCGGCGG + Exonic
1062566838 9:137167328-137167350 CAGGGCGGCACTGGGCGCTGAGG + Intronic
1062573794 9:137197387-137197409 CAGAACTGGGCTGGGCGCGGTGG - Intronic
1062579938 9:137225005-137225027 CAGCCCAGGCCTGGGCTCTGAGG - Exonic
1062597353 9:137305292-137305314 CGGGCCAGCACAGGCCGCGGCGG + Intergenic
1062664699 9:137663078-137663100 CAGGCCAGGACTGGGCGCGGTGG - Intronic
1062751039 9:138253618-138253640 CAGGCCCAGGCTGGGCGCAGTGG - Intergenic
1185576385 X:1176856-1176878 GAGGACAGGCCGGGGCGCGGTGG + Intergenic
1185689866 X:2145460-2145482 CAGTCCAGGGCTGGGCGCGGTGG + Intergenic
1187767134 X:22654748-22654770 CAAGCCAAGGCCGGGCGCGGTGG - Intergenic
1187871627 X:23769544-23769566 GAGGCCAGGGCCGGGCGCGGTGG + Intergenic
1188019101 X:25137559-25137581 CAGGCCTGTGCTGGGCGTGGTGG - Intergenic
1188391869 X:29630823-29630845 CTGGAGAGGGCTGGGCGCGGTGG - Intronic
1188821611 X:34781838-34781860 TAGGTCAGGGCTGGGCGTGGTGG - Intergenic
1189697955 X:43685165-43685187 CAGAGCAGGGCTGGGTGCGGTGG - Intronic
1189876440 X:45441237-45441259 TGGGCCCGGGCTGGGCGCGGTGG - Intergenic
1190232917 X:48596395-48596417 CAAGCCTCGACTGGGCTCGGTGG + Intronic
1190288716 X:48977610-48977632 TAGTTCAGGGCTGGGCGCGGTGG - Intronic
1190457190 X:50637814-50637836 CAGGCCAGAACTGAGCCCTGGGG + Intronic
1190642657 X:52495563-52495585 CACTCCATGACCGGGCGCGGTGG - Intergenic
1190645016 X:52517304-52517326 CACTCCATGACCGGGCGCGGTGG + Intronic
1190850847 X:54240015-54240037 TAGGGCAGGGCTGGGCGCAGTGG + Intronic
1191854032 X:65608247-65608269 CAGGGCAGGCCTGGGAGAGGAGG + Intronic
1192432040 X:71118998-71119020 GAGGGCAGGACGGGGGGCGGTGG + Intronic
1193711583 X:84886848-84886870 CAGGCCTAGGCTGGGCGTGGTGG + Intergenic
1193722737 X:85005444-85005466 CTGGCGAGGACCGGGCGTGGTGG - Intronic
1194339169 X:92688322-92688344 GAGCCTAGGGCTGGGCGCGGTGG + Intergenic
1195033660 X:100950943-100950965 GAGGACAGGGCTGGGTGCGGGGG + Intergenic
1195946460 X:110218538-110218560 TATGCCAGGACTAGGGGCGGGGG - Intronic
1196800523 X:119539242-119539264 CAGGGCAAGGCTGGGCACGGTGG + Exonic
1197203537 X:123770093-123770115 CAAGACAAGACTGGGCTCGGTGG + Intergenic
1198853420 X:140990243-140990265 CAGGACCGGGCTGGGCGTGGTGG - Intergenic
1199039691 X:143097724-143097746 CAAACTAGGACTGGGCACGGTGG - Intergenic
1199221371 X:145319666-145319688 CAGGTTAGGGCTGGGCGCAGTGG - Intergenic
1199847454 X:151701376-151701398 CAGGCCTGGCCTGGGGGCTGTGG + Exonic
1200002043 X:153067168-153067190 CAGGGCAGGGCTGGGTGCTGCGG + Intergenic
1200141175 X:153903849-153903871 CAAGCCAGGCCTGGGTGCGGGGG + Intronic
1200149020 X:153942522-153942544 TAGGCCCGGGCTGGACGCGGTGG - Intronic
1200398175 X:156003387-156003409 CAGGCCAGAGCTGAGCTCGGGGG - Intronic
1200502685 Y:3970858-3970880 CAGGCTTGGGCTGGGCGTGGTGG - Intergenic
1201398119 Y:13571453-13571475 AAGACCCGGGCTGGGCGCGGTGG + Intergenic