ID: 1062665068

View in Genome Browser
Species Human (GRCh38)
Location 9:137666159-137666181
Sequence GGCAAGCGGCATGGAGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062665068_1062665074 6 Left 1062665068 9:137666159-137666181 CCTTGTCCTCCATGCCGCTTGCC 0: 1
1: 0
2: 1
3: 20
4: 228
Right 1062665074 9:137666188-137666210 AATAACCCTGTTTTGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062665068 Original CRISPR GGCAAGCGGCATGGAGGACA AGG (reversed) Intronic
900257326 1:1703990-1704012 GGGAGGCTGCATGGGGGACAGGG + Intronic
901811120 1:11767164-11767186 GCCAAGCAGCAGGCAGGACAGGG - Intronic
901847527 1:11993134-11993156 GGCAAGGGACATGTGGGACAGGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
904985802 1:34547443-34547465 GGGAAGGGGCAGGGAGGGCAGGG + Intergenic
905103548 1:35546740-35546762 GGAAAGCTTCATGGAGGAAATGG - Intronic
905490238 1:38337762-38337784 GGCAATGGGCTGGGAGGACATGG - Intergenic
905889731 1:41511500-41511522 GGCTAGAGGCATGGAGACCATGG - Intronic
906480923 1:46198407-46198429 CGCAAGCGGCATGGAGGAGGCGG - Intronic
906497644 1:46316849-46316871 GGGGAGCGGCAAGGAGGACAGGG + Intergenic
906606739 1:47178037-47178059 GGAAAGGGGCAGGGAGGAGAGGG - Intergenic
907526285 1:55056075-55056097 GGCAGGCGGCGTTGAGGACGCGG - Exonic
907716882 1:56934310-56934332 GGCAGGGGGCATGGATGAGAGGG + Intronic
908154363 1:61337287-61337309 GGCAGGAGGCAAGGAGGAAAGGG - Intronic
912663917 1:111561903-111561925 GGCCAGGGGCAAGGAGGAGATGG - Intronic
912691090 1:111805091-111805113 GCCAGGTGGCATGGAGGAAAGGG + Intronic
913350678 1:117855313-117855335 GGGAGGAAGCATGGAGGACAGGG + Intergenic
914806862 1:150998122-150998144 GGCAAGGGGCCTGGAGCAGAAGG - Exonic
915758101 1:158282639-158282661 GGCAGGAGGCATGGTGGTCAGGG + Intergenic
915820376 1:159016978-159017000 GGGAAGAGGTATGAAGGACATGG - Intronic
916765758 1:167858924-167858946 GGCAATAGGAAGGGAGGACAAGG + Intronic
918104071 1:181401313-181401335 GGGAGGCTGCCTGGAGGACAGGG - Intergenic
919939869 1:202278773-202278795 GGCAAGCAGGGTGGAGGAGAAGG + Intronic
920966938 1:210708868-210708890 GGCATAGGGCAGGGAGGACAAGG + Intronic
1065480971 10:26193531-26193553 AGAAAGCTGCAAGGAGGACATGG - Intronic
1065722885 10:28643332-28643354 GGCAGGAGGGATGGAGCACATGG - Intergenic
1065771368 10:29081741-29081763 TGCAAGCGACCTGGAGCACACGG + Intergenic
1067686070 10:48466602-48466624 GGCAAGCGGCAAGGCGGCCGCGG + Intronic
1069313239 10:67065650-67065672 GGGAAAGGGCATGGAGGACCAGG - Intronic
1070247924 10:74749290-74749312 GTCAGGTGGCATGGAGGGCAAGG + Intergenic
1072088469 10:92103542-92103564 GGCCAGTAGCCTGGAGGACAGGG - Intronic
1073042432 10:100616798-100616820 GGCAAGAGACAGGGAGGAAATGG - Intergenic
1074297505 10:112204156-112204178 GGCAATAGGAATTGAGGACAAGG - Intronic
1074360143 10:112819407-112819429 GGCAAGTGGCTTGGAGACCAGGG - Intergenic
1074721700 10:116270948-116270970 GGCATCCGGCCTGGAGGCCAAGG - Exonic
1074850394 10:117434745-117434767 GGCAAGCAGGAGGGATGACATGG - Intergenic
1075321715 10:121496543-121496565 GGCCAGAGGCATGGAGTACTTGG - Exonic
1075389531 10:122082820-122082842 GGCAAAGGGCATGGAGGACGAGG - Exonic
1076801904 10:132834877-132834899 TGCAAACAGCATGGTGGACAAGG + Intronic
1076870218 10:133189314-133189336 GCCAAGCGGCAGGGAGAACACGG - Intronic
1076915978 10:133423372-133423394 GGAACGCGGCCTGGAGGACGAGG - Exonic
1076936114 10:133568238-133568260 GGAACGCGGCCTGGAGGACGAGG - Intronic
1077142142 11:1029383-1029405 GGGTAGCGGCATGGTGGGCAGGG + Intronic
1077151608 11:1075395-1075417 GCCAAGCGGGATGTAGGAGAGGG - Intergenic
1077318184 11:1928469-1928491 GGCAAGCCCCAGGGAGGTCAGGG + Intronic
1077371714 11:2185444-2185466 GGGAGGCAGCATGGAGGGCATGG + Intergenic
1078064039 11:8066303-8066325 GGCAGGCAGCATGGAGGTGAAGG + Intronic
1079408279 11:20163771-20163793 GGCAGGGAGCATGGAGGACTGGG - Intergenic
1081976884 11:47241075-47241097 AGCAAGGGGCATGTAGGAGATGG + Intronic
1084030078 11:66476074-66476096 GGCAGGCGGCATGGAAAGCATGG - Exonic
1084144802 11:67259324-67259346 GGCTACCAACATGGAGGACAGGG - Intergenic
1084387065 11:68850316-68850338 GGCAAGAGGCATGGGGGCCATGG - Intergenic
1085151857 11:74258675-74258697 GGGCAGGGGCATGGAGGACTAGG + Intronic
1086741706 11:90377647-90377669 GGCAAGCTGCATGAAGAACTAGG - Intergenic
1087396113 11:97601616-97601638 TGCAAGCTACATAGAGGACACGG - Intergenic
1090236810 11:125154448-125154470 GACAAGAGGAATGGAGGGCAAGG - Intergenic
1090256450 11:125287867-125287889 GGCAAGCGACTTGGAAGCCAGGG + Intronic
1091763449 12:3102966-3102988 AGCAAGTGGCCTGGAGCACATGG - Intronic
1092638952 12:10482345-10482367 GTCAGGCGGCATGGGGGTCAGGG - Intergenic
1092762564 12:11822832-11822854 GGCAACAGGCATGGAGGAATGGG + Intronic
1095313456 12:40728801-40728823 GGCAGGCAGCATGGTGGCCAAGG + Intronic
1096551074 12:52371981-52372003 GGCAAGCCACTTGGATGACAGGG - Intergenic
1096978707 12:55716306-55716328 GGCAACGGGCATGGGGGAGAGGG + Intronic
1100699144 12:97127924-97127946 GGCTGGCGGGATGGTGGACAGGG + Intergenic
1104522575 12:129488770-129488792 GGCTAGGGGCAAGGAGGATATGG + Intronic
1105805371 13:23949087-23949109 GGCAAGGGGGCTGGAGGCCAAGG - Intergenic
1109033916 13:57230626-57230648 GTCAAAAGGCATGGGGGACAGGG - Intergenic
1110621205 13:77598043-77598065 GGCTAGCGGCCAGGAGGTCAAGG - Intronic
1111347763 13:86983877-86983899 GGAAAGTGGCATGGAGGATATGG + Intergenic
1112701667 13:102016985-102017007 GGCAAGAGGCAAGTAGAACAAGG + Intronic
1114696236 14:24630295-24630317 GGTAAGACCCATGGAGGACAAGG - Intergenic
1117746925 14:58879044-58879066 GGAAAGGGGCAGGGAGGAAATGG + Intergenic
1119147358 14:72329462-72329484 GGCAGGCGGCCTGGTGGCCAAGG + Intronic
1119969037 14:78948782-78948804 GGTAAAGGGCATGGAGGATATGG - Intronic
1120605949 14:86578114-86578136 CGAATGCGGCATGGAGGACCTGG - Intergenic
1121515741 14:94548751-94548773 GGCAAGCGTCATGGAGAAGGGGG - Intergenic
1121975206 14:98397031-98397053 GGCAAGGGGCATGGTGGTGAAGG + Intergenic
1123067044 14:105624030-105624052 GGCATGCGGGTCGGAGGACAGGG + Intergenic
1123090728 14:105741027-105741049 GGCATGCGGGTCGGAGGACAGGG + Intergenic
1123096360 14:105768791-105768813 GGCATGCGGGTCGGAGGACAGGG + Intergenic
1124484637 15:30103732-30103754 GGCAAGGGGCACCGAGGACTTGG - Intergenic
1124518944 15:30393506-30393528 GGCAAGGGGCACCGAGGACTTGG + Exonic
1124539712 15:30572740-30572762 GGCAAGGGGCACCGAGGACTTGG - Intergenic
1124758940 15:32434842-32434864 GGCAAGGGGCACCGAGGACTTGG + Intergenic
1128873677 15:71184399-71184421 GGCACGGGGCATGGAGAACCTGG - Intronic
1128947518 15:71839214-71839236 GGCAATCGGGAAGGAGCACAAGG - Intronic
1130120366 15:81042398-81042420 GAGAAGAGGCATGGAGGACGAGG + Intronic
1131625311 15:94112286-94112308 GGAAAGCGGGATGAAGGAAATGG - Intergenic
1132606033 16:794150-794172 AGGCAGCGGCATGCAGGACACGG - Exonic
1132678428 16:1130204-1130226 GGCTAGGGGCCTGGAGGACAGGG - Intergenic
1133337467 16:5015343-5015365 GGCAAGCTGCAGGGAGGAGAAGG - Exonic
1133577411 16:7106909-7106931 GGCATGCAACAAGGAGGACATGG + Intronic
1136076300 16:27819681-27819703 GGCAAGGGGCCCGGAGTACACGG + Intronic
1136587948 16:31199912-31199934 AGCTAGAGGCAGGGAGGACAAGG + Intergenic
1137828162 16:51517456-51517478 GTCAGGAGGCATGGAGGTCAGGG - Intergenic
1139952160 16:70677741-70677763 GGCCAGGGGCAGGGAGGAGATGG - Intronic
1140724818 16:77802380-77802402 GGCAAGGGGGGTGGAGCACAAGG + Intronic
1141684522 16:85562672-85562694 GGCAAGCGACACGGAGCACCAGG - Intergenic
1142126383 16:88412613-88412635 AGCATGCAGCATGGGGGACAGGG + Intergenic
1142169627 16:88614928-88614950 GGCAGACGGAATGGAGGAAATGG - Intronic
1142561669 17:813387-813409 GGCCCCCGGCTTGGAGGACAAGG + Intronic
1144207993 17:12992880-12992902 GGCAGGCGGCCTGGAGGATGGGG - Exonic
1144880864 17:18429950-18429972 AGCAAGCTGCATGGACCACAGGG + Intergenic
1145151370 17:20514437-20514459 AGCAAGCTGCATGGACCACAGGG - Intergenic
1145864040 17:28228664-28228686 GGCAAGCTTCTTGGAGGAAAGGG - Intergenic
1146380535 17:32323985-32324007 GGAAAGAGGCACAGAGGACACGG - Exonic
1146610256 17:34298731-34298753 GGCATGCAGTATGGATGACATGG + Intergenic
1146906536 17:36621745-36621767 GGCAGGTGGCATGGAGGGCAAGG + Intergenic
1147926851 17:43951872-43951894 GGCAAGCTTCTTGGAGGAAAGGG + Intergenic
1151324056 17:73368157-73368179 GGCAAACGGTGGGGAGGACAGGG + Intronic
1151459319 17:74245391-74245413 GGGAAGCTGCAGGGAGCACACGG + Intronic
1151979129 17:77498613-77498635 GGCCAACGGCATGGAGGAGAAGG + Exonic
1155181819 18:23354692-23354714 GGCTAGAGGCATAGAGGAGAGGG - Intronic
1155910911 18:31503686-31503708 GGCAACAGGCATTGAGGACTTGG + Intronic
1156272076 18:35545022-35545044 GGCACACAGCATGGAGGACAGGG - Intergenic
1157564180 18:48668584-48668606 GGCAAGGGGCATGGTGGAGCTGG - Intronic
1157867245 18:51197375-51197397 GGCGAGCCCCATGGCGGACAGGG + Intronic
1158211462 18:55055167-55055189 TGCTAGGTGCATGGAGGACAAGG - Intergenic
1159354396 18:67318936-67318958 GGTTAGCAGCATGTAGGACATGG - Intergenic
1160750696 19:732902-732924 GGCAGGCGACCTGGAGGACGTGG + Intronic
1161061471 19:2217276-2217298 GGCAGGTGCCATGGAGGACATGG + Intronic
1161332181 19:3693579-3693601 GGCAGGCGGCAGGGAGGCCTGGG + Intronic
1162141903 19:8590085-8590107 GGCTAGAGGCAGGGAGGCCAGGG + Intronic
1163414572 19:17178235-17178257 GGCATGGTGCATGGAGCACAGGG + Intronic
1163561422 19:18021595-18021617 GGCAAGGGGCCAGGAGGAAATGG + Intergenic
1163580514 19:18135940-18135962 GGGAAGCTGCATGGAGGAGGGGG + Intronic
1165121288 19:33560483-33560505 GGGATGGGGCAGGGAGGACAAGG + Intergenic
1166024517 19:40068793-40068815 GACAAGAGGCATGGGGAACATGG + Intergenic
1166785285 19:45363664-45363686 GGCTACAGGCGTGGAGGACACGG + Intronic
926155853 2:10453723-10453745 TGCAAGTGGCAGGCAGGACAAGG + Intergenic
927694118 2:25229025-25229047 AGCAAGGAGCAGGGAGGACAAGG - Exonic
929585985 2:43114805-43114827 GGCAACAGACATGGAGGAAAGGG - Intergenic
930300606 2:49611219-49611241 GGCAAGGGAAAGGGAGGACAAGG + Intergenic
935737343 2:106116784-106116806 GGGAAACTGCATGGAGCACATGG + Intronic
936937028 2:117848471-117848493 GGCAAGCTGCAAGAAGGCCATGG + Intergenic
937484606 2:122301501-122301523 GGCAAGAGGCATGTGAGACAAGG + Intergenic
937905543 2:127051106-127051128 GGCGGGCGGCAGGGAGGAAAAGG + Intronic
937913759 2:127088977-127088999 GGCAGGGGGCAGGGAGGACCAGG + Intronic
941622474 2:167793576-167793598 GGCAAGGTGCATGGAGGAAAAGG + Intergenic
941716226 2:168766372-168766394 GGCAAGAGGCACTCAGGACAGGG - Intronic
945329668 2:208524988-208525010 GTCAGGAGGCATGGAGGTCAGGG + Intronic
945891649 2:215436375-215436397 GGGAAGCGGCTGGGAGGAAAGGG + Intergenic
946053111 2:216880452-216880474 GGCAGGAGGCCTGGAAGACAAGG + Intergenic
947311507 2:228808785-228808807 GTCAAGAGGCATGGGGGTCAGGG + Intergenic
948775317 2:240285035-240285057 GGCATGCAGCATGGACGGCAAGG - Intergenic
1169403502 20:5303738-5303760 GATAAGAGGCATGAAGGACAGGG + Intronic
1170167828 20:13380536-13380558 GTCAGGAGGCATGGAGGCCAGGG + Intergenic
1171063930 20:21994718-21994740 AGAAAGCTGAATGGAGGACAGGG + Intergenic
1172120163 20:32593694-32593716 GGCAGGCTTCATGGAGGAAATGG - Intronic
1172649261 20:36491507-36491529 GGCAGGAAGCATGGAGAACAGGG + Intronic
1172786280 20:37470822-37470844 GTCACGGGGCATGGGGGACATGG + Intergenic
1173340168 20:42146165-42146187 GGCAAGTTGCCTGGAGGAGATGG - Intronic
1174677753 20:52374825-52374847 GGCAGGCTTCATGGAGGACAGGG - Intergenic
1175244409 20:57572986-57573008 GGCAACTGGCATGGCAGACAAGG - Intergenic
1175769105 20:61611719-61611741 GCCAAGCCGCTTGGGGGACAGGG + Intronic
1176179420 20:63742449-63742471 GGCAGGCGGCATGGAGGCCGTGG - Exonic
1177050339 21:16225283-16225305 GTCAAGAGGCATGGAGATCAGGG - Intergenic
1179630447 21:42674609-42674631 AGAATCCGGCATGGAGGACAAGG - Intronic
1179708211 21:43194603-43194625 GGCTGCCGGCATGGAGGTCAAGG - Intergenic
1179979866 21:44890285-44890307 GGCAAGGGGCCTGGAGGACAGGG - Intronic
1180962309 22:19767477-19767499 GGCAGGAGGCGTGGCGGACAGGG - Intronic
1181548263 22:23617807-23617829 GGCATGAGGCATGGAGGCCTTGG + Intronic
1181756564 22:25028659-25028681 GGCCAGCAGTGTGGAGGACACGG + Exonic
1182426527 22:30276141-30276163 GGCAGGAGGCACGGAGGACAGGG + Intergenic
1184778736 22:46635732-46635754 GGCGGGGGGCAGGGAGGACACGG - Intronic
1185101793 22:48844573-48844595 GGCCAGGGGCATGGAGGCCTAGG - Intronic
949246441 3:1930260-1930282 GTCAAGAGGCATGGGGGTCAGGG - Intergenic
952342983 3:32460547-32460569 GGCAGACGGCATGGAGGCCGAGG - Intronic
954193768 3:48983847-48983869 TGCAATGGGCATGGAGCACAAGG + Exonic
957933270 3:86910694-86910716 GGAAAACGGCATGAAGGAGATGG - Intergenic
958073228 3:88641443-88641465 GGCCAGCAGCAGGCAGGACAGGG - Intergenic
958622235 3:96576237-96576259 GGTAAGCGGTATTGAAGACAGGG - Intergenic
960948430 3:122982803-122982825 GGCAAGGTGCCTGGAGGAAATGG - Intronic
961813010 3:129532520-129532542 GGGCAGCGGCCTGCAGGACACGG - Exonic
962396466 3:135018970-135018992 GGCATGAGGCAGAGAGGACAGGG + Intronic
966508856 3:180737745-180737767 GGCATGCTGCAGGGAAGACAGGG - Intronic
966656043 3:182359813-182359835 GGGAAGCAGCATGAAGGAGAGGG + Intergenic
967378481 3:188831540-188831562 GGCAGGGAGCCTGGAGGACAAGG + Intronic
967792323 3:193562514-193562536 GGCAAATGGCAAGGAGAACAGGG - Intronic
968074873 3:195810704-195810726 GGGAAGCGACAAGGAGGAGAGGG - Intronic
968463572 4:738079-738101 GGCGACCGGCAAGGAGGCCAAGG + Intronic
968505176 4:968133-968155 GGCGGGCGGCAGGAAGGACACGG - Intronic
970483606 4:16502753-16502775 GGCCAACGGCATGGACGACGAGG - Exonic
973221946 4:47736747-47736769 GGCAAGTTCCATGAAGGACAAGG - Intronic
976464331 4:85350611-85350633 GGCAAGCCACATGTAGGAGAAGG - Intergenic
977665911 4:99647273-99647295 AGCAAGGGGAAGGGAGGACAGGG - Intronic
978587931 4:110293248-110293270 GACCAGCGGCCTGGAGGACCAGG + Intergenic
979662131 4:123269250-123269272 AGGAAGAGGCATGCAGGACAGGG - Intronic
981659071 4:147145287-147145309 TTCAAGGGGCATGGAGGAGAAGG + Intergenic
983148594 4:164247668-164247690 GGCAATGGGAATGAAGGACAAGG + Intronic
985554963 5:554128-554150 GGCAAGCGGCATAGGGGCCAGGG - Intergenic
986420367 5:7574491-7574513 GGCAATGGGCATGGAGTACCTGG + Intronic
990625898 5:57610998-57611020 GGCAAGAGGCCTGGAGAACCTGG + Intergenic
993960906 5:94295884-94295906 GTCAGGAGGCATGGAGGTCAGGG + Intronic
996426552 5:123319774-123319796 GTCAAGAGGCATGGGGGTCAGGG + Intergenic
996444905 5:123536223-123536245 GGCAGGTGGGATGGAAGACAAGG + Intronic
998381587 5:141729765-141729787 GCCCAGCAGCCTGGAGGACAGGG + Intergenic
998752027 5:145333230-145333252 GTCAGGAGGCATGGAGGTCAGGG + Intergenic
999233977 5:150079495-150079517 GCCAAGAGGCAGGGAGGAGATGG - Intronic
999971692 5:156870039-156870061 GGCAAGGGGCCTGCAGGCCAGGG + Intergenic
1001196609 5:169678828-169678850 GGCAAGAAGGTTGGAGGACATGG + Intronic
1002066449 5:176654415-176654437 GCCAGCCGGCATGGAGGAAATGG + Intronic
1002526299 5:179817662-179817684 GGCAAGAGGCACGGGGGCCATGG - Intronic
1002789546 6:427304-427326 TGCAAGCCGCATGGAGGAGGGGG - Intergenic
1003040772 6:2685482-2685504 GACCAGAGGCATGAAGGACAAGG - Exonic
1004037815 6:11941147-11941169 GGCTGGCGGCATGGAACACACGG - Intergenic
1005375011 6:25173097-25173119 GGCAAGTGGGCTGGAGGGCAGGG - Intergenic
1013565424 6:111354920-111354942 GGCAAGGGGCACGGAGGGGAAGG + Intronic
1014176971 6:118342003-118342025 GTCAAGAGGCATGGGGGTCAGGG + Intergenic
1014804378 6:125812753-125812775 GGCAGGCTGCATGTAGGACAGGG - Intronic
1015328480 6:131950987-131951009 GGCCGGCTGCAGGGAGGACAGGG + Exonic
1018229200 6:161659663-161659685 GGCAACGGCCCTGGAGGACATGG + Intronic
1018667174 6:166149292-166149314 AGCAAGGGGCAGGGAGGACAGGG + Intergenic
1019083823 6:169455687-169455709 GCCAGGGGGCATGGAGGGCAGGG - Intergenic
1020001967 7:4761301-4761323 GGGATGTGGCATGGAGAACAGGG - Intronic
1021332267 7:19353383-19353405 GGCATGTGGCATAGAGGGCATGG - Intergenic
1022927097 7:35067503-35067525 GGCAACAGTCATGGAGGAAATGG - Intergenic
1023679232 7:42667283-42667305 GGCAGGCAGCAAGGAGGAAAGGG + Intergenic
1024296867 7:47851191-47851213 GCCAAGCCTCATTGAGGACATGG + Intronic
1024664844 7:51536221-51536243 GTCAAGAGGCATGGGGGTCAGGG + Intergenic
1025078304 7:55962491-55962513 GGCCAGTGGGATGGAGGCCAAGG - Intronic
1025301645 7:57823199-57823221 AGCAAGAGGCATCTAGGACAGGG - Intergenic
1029438606 7:100575545-100575567 GGCAGGGGGCATGCAGGGCAGGG + Intronic
1034590549 7:152134382-152134404 GGCAAGCTCCATGGTGGACTAGG + Intergenic
1035651339 8:1267691-1267713 GGCCAGCGACACGGAGGACGTGG - Intergenic
1035657525 8:1321488-1321510 GCCAAGCAGCATGGTGGTCACGG - Intergenic
1035692436 8:1568940-1568962 GGACAGTGGCATGGAGGCCACGG - Intronic
1035950605 8:4016478-4016500 TGCAAGCTTCCTGGAGGACAAGG + Intronic
1036748893 8:11430757-11430779 GGCAAGGGGGCTGGAGGAGACGG + Intronic
1038062272 8:23926698-23926720 GGCAACCTGGATGGAGAACAAGG - Intergenic
1044378075 8:91499819-91499841 GTCAAGAGGCATGGGGGTCAGGG + Intergenic
1049451808 8:142666038-142666060 GGCAGCCGGCTTGGAGGCCATGG + Exonic
1050496063 9:6243779-6243801 GGAAAGGAGCATGAAGGACAAGG - Intronic
1052937955 9:34109274-34109296 GGGAAGTGGCATGGATGAGATGG - Intronic
1056001038 9:82216593-82216615 GTCACGAGGCATGGGGGACATGG - Intergenic
1057524074 9:95784124-95784146 GTCCAGGGGCATGGAGCACATGG - Intergenic
1059115981 9:111600121-111600143 GGCAAGCGGCAGGGCTGACGGGG - Intergenic
1060820401 9:126658417-126658439 GGCAGGCGGCAGGGAGGGCAGGG - Intronic
1061579208 9:131526605-131526627 GGGAAGCAGCCTGGAGAACATGG + Intronic
1061749782 9:132769834-132769856 GGCAAGCGGAGGGGCGGACAAGG - Intronic
1061960695 9:133987530-133987552 GGGAAGAGGCAGGGAGCACAGGG + Intronic
1062533225 9:137010729-137010751 GGCATGCGCCTTGGGGGACAGGG + Exonic
1062665068 9:137666159-137666181 GGCAAGCGGCATGGAGGACAAGG - Intronic
1185734880 X:2489036-2489058 GACAGGCGGCGTGGAGGACCAGG - Exonic
1187154781 X:16712523-16712545 GGCCAGCAGCAGGGAGGAGAGGG - Intronic
1197142256 X:123130326-123130348 GTCAAGAGGCATGGGGGTCAGGG - Intergenic
1197800526 X:130342997-130343019 GGCAAGGAACAGGGAGGACATGG - Intronic
1199571349 X:149270099-149270121 GGCAAGGTGCATGCATGACATGG - Intergenic
1200242759 X:154506515-154506537 GGCGTGAGGAATGGAGGACAGGG + Exonic
1201981764 Y:19916715-19916737 GGCAACTGGCCTGGAGGAGAGGG - Intergenic