ID: 1062666129

View in Genome Browser
Species Human (GRCh38)
Location 9:137673615-137673637
Sequence CAGTTTCGCCAGGAGTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062666129_1062666131 -5 Left 1062666129 9:137673615-137673637 CCAGACAACTCCTGGCGAAACTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1062666131 9:137673633-137673655 AACTGCGCTGCTGCCCTGCCTGG No data
1062666129_1062666144 29 Left 1062666129 9:137673615-137673637 CCAGACAACTCCTGGCGAAACTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1062666144 9:137673667-137673689 CCCTCAGGGAGGCTCTGGCCGGG No data
1062666129_1062666138 18 Left 1062666129 9:137673615-137673637 CCAGACAACTCCTGGCGAAACTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1062666138 9:137673656-137673678 CACTGGCCCTGCCCTCAGGGAGG No data
1062666129_1062666137 15 Left 1062666129 9:137673615-137673637 CCAGACAACTCCTGGCGAAACTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1062666137 9:137673653-137673675 TGGCACTGGCCCTGCCCTCAGGG No data
1062666129_1062666136 14 Left 1062666129 9:137673615-137673637 CCAGACAACTCCTGGCGAAACTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1062666136 9:137673652-137673674 CTGGCACTGGCCCTGCCCTCAGG No data
1062666129_1062666140 24 Left 1062666129 9:137673615-137673637 CCAGACAACTCCTGGCGAAACTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1062666140 9:137673662-137673684 CCCTGCCCTCAGGGAGGCTCTGG No data
1062666129_1062666142 28 Left 1062666129 9:137673615-137673637 CCAGACAACTCCTGGCGAAACTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1062666142 9:137673666-137673688 GCCCTCAGGGAGGCTCTGGCCGG No data
1062666129_1062666132 1 Left 1062666129 9:137673615-137673637 CCAGACAACTCCTGGCGAAACTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1062666132 9:137673639-137673661 GCTGCTGCCCTGCCTGGCACTGG No data
1062666129_1062666146 30 Left 1062666129 9:137673615-137673637 CCAGACAACTCCTGGCGAAACTG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1062666146 9:137673668-137673690 CCTCAGGGAGGCTCTGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062666129 Original CRISPR CAGTTTCGCCAGGAGTTGTC TGG (reversed) Intronic
901535367 1:9879294-9879316 CAGTTTCTCAAAGTGTTGTCTGG - Intronic
903818585 1:26083366-26083388 CAGCTTTGCCAGGATTTATCAGG - Intergenic
910075640 1:83274955-83274977 CAGTTTTTGCAGGAGTTGTTGGG - Intergenic
911260171 1:95676754-95676776 CAGTTTGCCCAGGAGCTGTCAGG - Intergenic
912260175 1:108103295-108103317 CAGTTTCACCAGTTGTTCTCAGG - Intergenic
916693241 1:167211154-167211176 CAGGAGCGCCAGGAGTGGTCAGG - Intergenic
916950226 1:169772552-169772574 CATTTTCCCCAGTAGTTGCCTGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
1067752840 10:48983317-48983339 CTGCTGAGCCAGGAGTTGTCTGG - Intergenic
1069457061 10:68561371-68561393 CAGTCTTGCTAGGAGTTGGCTGG + Intronic
1080901375 11:36495591-36495613 AAGTTTAGAAAGGAGTTGTCGGG + Intronic
1082293654 11:50412460-50412482 CAGTTTGGCCTGGTCTTGTCTGG + Intergenic
1082656961 11:55868251-55868273 TAGTGTTGCCAGGAGATGTCAGG + Intergenic
1084614508 11:70226681-70226703 GAGGTTCCCCAGGAGGTGTCTGG + Intergenic
1089094857 11:115911340-115911362 CAGGTTTGCTAGGAGGTGTCAGG + Intergenic
1095336128 12:41028566-41028588 CAGTTTATCAAGGAGTTTTCTGG - Intronic
1095961983 12:47841159-47841181 CAGTTTTGCCAGTAGCTGTTTGG + Intergenic
1096802981 12:54123780-54123802 CTGTTTCAGCAGGAGTTGTGGGG - Intergenic
1097353992 12:58580739-58580761 TATTTTTGCCAGGTGTTGTCTGG - Intronic
1103360412 12:120350374-120350396 GAGTTTGGCCACTAGTTGTCAGG - Intronic
1106137607 13:26985460-26985482 CAGTCTGGCCAGTAGATGTCAGG + Intergenic
1107882751 13:44847148-44847170 CATTGTTGCCAGGAGTTGTGGGG - Intergenic
1112294623 13:98176304-98176326 CAGTTTCGCCATCAGTTCTTTGG + Exonic
1113893573 13:113749156-113749178 CTGTTGCCCCAGGAGGTGTCTGG + Intergenic
1118886264 14:69868808-69868830 CAATTTTGCCAGCATTTGTCTGG - Intronic
1119388695 14:74275722-74275744 CAGCTTTGCCAGGGGTGGTCAGG - Intergenic
1127039476 15:54958368-54958390 GGGTTTCTCCAGGTGTTGTCAGG + Intergenic
1128242776 15:66112690-66112712 CAGTTTCCCTAGGATGTGTCTGG - Intronic
1128848967 15:70931827-70931849 CAGTTTTGCCAGGAGTGTTAGGG + Intronic
1132402670 15:101523044-101523066 CAGTGTCTCCACGAGATGTCAGG + Intronic
1133621652 16:7532247-7532269 CAGTTATGCCGGGAGTTGCCTGG + Intronic
1135429647 16:22372590-22372612 TAGTTTCTCCAGGATTTGTGAGG - Intronic
1136376028 16:29865421-29865443 CCTTTTCACCAGGAGTTGGCAGG - Intergenic
1146103813 17:30012287-30012309 CAGGCTCGCCCGCAGTTGTCTGG + Intronic
1148543925 17:48502503-48502525 CAGTTTGGCCAGAAGGTGGCTGG + Intergenic
1151208808 17:72528425-72528447 CTGCTTCTCCATGAGTTGTCTGG - Intergenic
1161571702 19:5034326-5034348 CAGTTAGGCCAGGGGTTGGCGGG + Intronic
934045942 2:88172489-88172511 CAGTTCGCCCAGGAGTTTTCTGG - Exonic
937752147 2:125489168-125489190 CATTTTCTCCAGGAGTTTGCTGG + Intergenic
938242006 2:129749680-129749702 CAATATCTCCAGGAGTTCTCTGG - Intergenic
939735712 2:145841984-145842006 CAGTTTTCCCAGGAATGGTCAGG + Intergenic
940104975 2:150089221-150089243 CACTTTCCTCAGCAGTTGTCGGG + Intergenic
942989239 2:182179296-182179318 CTGTTTCAGCAGGAGTTTTCTGG - Intronic
946249262 2:218402875-218402897 CAGTTTCCCCAGCAGTGGTCAGG + Intronic
946668217 2:222073695-222073717 CAGTTTCTCCAGGATTGGTTGGG - Intergenic
947477131 2:230460551-230460573 AAGTGTCACCAGGAGGTGTCTGG + Intronic
947711384 2:232318355-232318377 CAGTTTCGCCAAGTGTTCTCTGG + Intronic
948792884 2:240388336-240388358 CAGTTTCCCCAGGTGTACTCAGG - Intergenic
948792893 2:240388381-240388403 CAGTTTCCCCAGGTGTACTCAGG - Intergenic
948792902 2:240388426-240388448 CAGTTTCCCCAGGTGTATTCAGG - Intergenic
1171793774 20:29550808-29550830 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1178755033 21:35340770-35340792 GAGTTTCTCCAAGTGTTGTCAGG + Intronic
1179496803 21:41776878-41776900 GAGCTTCCCCTGGAGTTGTCTGG + Intergenic
1180107511 21:45629784-45629806 CAATTTCTCCAGGGGTTCTCTGG + Intergenic
1181001827 22:19991359-19991381 CAGTGTTGCCAGGAGCTCTCAGG - Intronic
1182448557 22:30404303-30404325 CAGTTCTGCCAGGACGTGTCCGG + Intronic
1182759548 22:32711133-32711155 CAGTTTGCCCAGGAGTTTCCTGG - Intronic
953890929 3:46751003-46751025 CAGTTTTGCGGGGAGCTGTCGGG - Intronic
956256714 3:67291017-67291039 CAGTTTGGCCAGGAGTTGGTGGG + Intergenic
973115730 4:46455971-46455993 CAGTTTCTCCAGGTGTTTTTTGG - Intronic
975484817 4:74924123-74924145 CAGTTTGGCCAGGAGTGGGAGGG + Intergenic
980003877 4:127518983-127519005 CAGTTTTGCCAGAAATTGCCAGG + Intergenic
981582549 4:146264654-146264676 CAGTTGCAGCAGGAGTTGTGAGG - Intronic
987146851 5:14999911-14999933 AACTTGCTCCAGGAGTTGTCAGG - Intergenic
989491427 5:42060195-42060217 GAGTTTGGCCAGGGGTGGTCGGG + Intergenic
989571622 5:42951196-42951218 CAGTTGCGCCTGGAGTTACCGGG - Intergenic
997963411 5:138338829-138338851 CAGTCTCCCCAGGAGGTGTGGGG + Intronic
999038002 5:148375103-148375125 CAGATTCACCTGGAGTTGTCAGG - Intergenic
1000300510 5:159952018-159952040 CAGTTTCTCCTGGATTTGGCTGG + Intronic
1005600279 6:27419876-27419898 CAGTTTTAGCAGGAGTTTTCTGG - Intergenic
1007225708 6:40312515-40312537 CAGTTTGGGCAGGAGTTGGTGGG - Intergenic
1011722505 6:90172525-90172547 CAGTTTTACCAGGCTTTGTCTGG - Intronic
1012534031 6:100274319-100274341 CAGTTTTCCCAGGACTTGCCTGG + Intergenic
1013968119 6:115980858-115980880 CAGTTTAGCCAGGGGTTCTCTGG - Intronic
1024297535 7:47857391-47857413 TAGTTTTGCCAGGAGTTTTCTGG + Intronic
1026906079 7:74063469-74063491 CAGTGGAGCCAGGAGGTGTCTGG - Intronic
1032119883 7:129148126-129148148 CAGCTTGGCCATGTGTTGTCAGG + Intronic
1036203449 8:6788032-6788054 CAGTTTTGCCAGGAGGAGTGAGG - Intergenic
1038463742 8:27740913-27740935 CAGTGTGGGCAGGAGCTGTCAGG + Intronic
1039385407 8:37131285-37131307 CAGTTTTGCCAGTAGGTTTCAGG - Intergenic
1042558717 8:70056227-70056249 CAGTTTCGAGAGGAGTTGCCAGG - Intronic
1052498273 9:29256730-29256752 CAGTTAGGCTAGGTGTTGTCAGG - Intergenic
1054152655 9:61617957-61617979 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1056282092 9:85051560-85051582 ATGTTGCGCCAGGAGTTGTGTGG + Intergenic
1056639023 9:88354455-88354477 CAGCTTCCACTGGAGTTGTCAGG + Intergenic
1058453228 9:105116153-105116175 CACCTTCCCCTGGAGTTGTCAGG + Intergenic
1058829927 9:108807260-108807282 CTGTTTCTCCAGGATTTGTGGGG - Intergenic
1059632249 9:116137127-116137149 AAGTTTAGCCAGGCTTTGTCAGG - Intergenic
1061437994 9:130579038-130579060 CACTTCCGCCTGGGGTTGTCTGG - Intronic
1062645493 9:137546002-137546024 CAGGTTCGCCCGCAGTTATCCGG + Intronic
1062666129 9:137673615-137673637 CAGTTTCGCCAGGAGTTGTCTGG - Intronic
1187291208 X:17955177-17955199 CAGTTGCTACAGGAGTTGTGAGG - Intergenic
1189873130 X:45404981-45405003 CTGTTTGGCCAGGAGCTGTGGGG - Intergenic
1191816658 X:65253294-65253316 CTTTTTCCCCAGGAGTTGTTGGG - Intergenic
1194727775 X:97418211-97418233 CAGTTATGCAAGGAGTTGGCAGG + Intronic
1199685115 X:150258544-150258566 CAGTTTCCCCTGGAGTTCCCTGG - Intergenic
1200412665 Y:2876970-2876992 CAGGTTCGCCCGCAGTTATCCGG + Intronic
1201518714 Y:14848039-14848061 CAGTTTTTACAGGAGTTGTTAGG - Intergenic