ID: 1062668856

View in Genome Browser
Species Human (GRCh38)
Location 9:137694418-137694440
Sequence GTCCTGCGCCACCGCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062668856_1062668864 7 Left 1062668856 9:137694418-137694440 CCCACCATGCGGTGGCGCAGGAC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1062668864 9:137694448-137694470 CTGGAGGAGGCGCACAGCTGAGG No data
1062668856_1062668862 -9 Left 1062668856 9:137694418-137694440 CCCACCATGCGGTGGCGCAGGAC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1062668862 9:137694432-137694454 GCGCAGGACGCTGGGACTGGAGG No data
1062668856_1062668863 -6 Left 1062668856 9:137694418-137694440 CCCACCATGCGGTGGCGCAGGAC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1062668863 9:137694435-137694457 CAGGACGCTGGGACTGGAGGAGG No data
1062668856_1062668865 11 Left 1062668856 9:137694418-137694440 CCCACCATGCGGTGGCGCAGGAC 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1062668865 9:137694452-137694474 AGGAGGCGCACAGCTGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062668856 Original CRISPR GTCCTGCGCCACCGCATGGT GGG (reversed) Intronic
900402900 1:2479907-2479929 GGCCTGCGCTACCTCATGGCCGG + Exonic
900500594 1:3002691-3002713 GTCCGGGGCCACTGCAGGGTTGG - Intergenic
900642818 1:3695472-3695494 ACCCTGCCCCTCCGCATGGTGGG + Intronic
905956839 1:42004113-42004135 GGCCTGCTCCACCACCTGGTTGG - Intronic
921156988 1:212446447-212446469 GTCCTGCGGGGCCGGATGGTGGG + Intergenic
1062909005 10:1200016-1200038 GTCATGAGCCACCGCATGGAGGG - Exonic
1064052196 10:12068778-12068800 GCCCTGCTCCACCGCAGGGCGGG - Intergenic
1069296810 10:66856224-66856246 GTCCTTTGCCACAACATGGTTGG - Intronic
1095409423 12:41906091-41906113 CTCCTGTGCCACCCAATGGTGGG + Intergenic
1101899790 12:108783127-108783149 GGCCTGCGCCACCCCACGGCTGG + Exonic
1115574127 14:34694306-34694328 GTCCTGGGCCTCCGGAAGGTGGG - Intergenic
1116816590 14:49589880-49589902 GTCCTGTGCAACAGCATGGATGG + Intronic
1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG + Intronic
1119922494 14:78459452-78459474 GTCCTGCTCCAACCCATGGAAGG + Intronic
1121562451 14:94885414-94885436 TTCCTGCCGCACCCCATGGTAGG - Intergenic
1127433318 15:58933281-58933303 GACCTGCGGAACGGCATGGTAGG - Intronic
1128301030 15:66566242-66566264 GTCCTGCGCCACCCCCAGCTTGG - Intergenic
1129600426 15:76995265-76995287 GTCCTCCATCACCGCAGGGTCGG + Exonic
1132604064 16:786323-786345 GCCCTGGGCCACCCCGTGGTGGG - Exonic
1132711772 16:1272027-1272049 GTCCTGGGCCTCTGCATGGTTGG + Intergenic
1134090203 16:11387446-11387468 GTCCTCCTCCACCTCATGATGGG - Intronic
1142479974 17:213310-213332 GTCCTGGGCCAGCCCATGGGAGG + Exonic
1143515344 17:7416931-7416953 ATCCTGCGGCACCGGCTGGTTGG - Exonic
1152793089 17:82292708-82292730 TTCCTGCGCCTCCGCAACGTCGG - Intergenic
1165388894 19:35527307-35527329 GGCCTGCCCCGCAGCATGGTGGG + Exonic
1165388912 19:35527361-35527383 GGCCTGCCCCGCAGCATGGTGGG + Exonic
1165388957 19:35527523-35527545 GGCCTGCCCCGCAGCATGGTGGG + Exonic
931691094 2:64835494-64835516 GGCATGAGCCACCGCAGGGTGGG + Intergenic
931898903 2:66766169-66766191 GACCTTGGCCACAGCATGGTTGG - Intergenic
943206377 2:184902416-184902438 GTCCTGGGCCACCAGAAGGTGGG + Intronic
945721184 2:213421062-213421084 CTCCTGCTCCACCACTTGGTAGG - Intronic
946804485 2:223457623-223457645 GTGCTGAGCCACCACATGGAAGG + Intergenic
947238902 2:227973069-227973091 GTCCTGCGCTGCCACATGGGTGG - Intergenic
948753212 2:240144294-240144316 GTGCTGCTCCACAGCATGGCTGG + Intronic
949024480 2:241760074-241760096 GGCCTTCGCCACAGCATGGGTGG + Intronic
1176083096 20:63283751-63283773 GTGTTGCGGCACCCCATGGTGGG + Intronic
1179934400 21:44592959-44592981 GCCCTGGGCCATGGCATGGTGGG + Intronic
953797276 3:45995399-45995421 GTTCTGAGACGCCGCATGGTGGG + Intronic
954115812 3:48466322-48466344 GCCCTGCGCCATCCCATTGTGGG - Intronic
954718038 3:52536614-52536636 GTCCTCCGCCACTGTCTGGTAGG - Exonic
962837465 3:139202196-139202218 GTCCTGTGCCACCCCAGGGTAGG + Intronic
968651930 4:1763585-1763607 GGCCAGCGCCACCGCAGGGCGGG + Intergenic
978779012 4:112530483-112530505 GTCTTGGGCCGCCGCAAGGTGGG + Intergenic
1005851728 6:29827968-29827990 GTCCTGCGCCCCCGCCGGGCCGG - Intronic
1005859104 6:29887875-29887897 GTCCTGCGCCCCCGCCGGGCGGG - Intergenic
1005866663 6:29942677-29942699 GTCCTGCGCCCCCGCCAGGAGGG - Intronic
1007717791 6:43867371-43867393 GGCCTGCCCCAGGGCATGGTGGG + Intergenic
1017787710 6:157769949-157769971 GAGCTGAGCCAGCGCATGGTTGG + Intronic
1018268824 6:162054555-162054577 GTGCTGGGCCACTGCATGGTGGG - Intronic
1035060738 7:156067395-156067417 GTCCTGGGCCACTCCATGATTGG + Intergenic
1036699506 8:11002664-11002686 GGCCTGGGCCATCCCATGGTTGG - Intronic
1036797319 8:11765629-11765651 CACGTGCGCCCCCGCATGGTAGG - Intergenic
1038859422 8:31370464-31370486 GTCCTTCGCAGCAGCATGGTTGG - Intergenic
1040471127 8:47736860-47736882 GTCCTGCGCCACCGGCGGGCGGG + Intergenic
1047674452 8:127184968-127184990 GTCATGCCCCACAGCATGGTGGG - Intergenic
1053203268 9:36166682-36166704 CTCCAGCGCCACCGCGTGGCTGG + Intergenic
1056645429 9:88407903-88407925 GGCCTGAGCCACCCCATGCTTGG + Intronic
1062668629 9:137693538-137693560 GTCCTGCACCACTGCGTGGTGGG - Intronic
1062668654 9:137693640-137693662 GTCCTGCGCCACTGTGTGGGGGG - Intronic
1062668681 9:137693742-137693764 GTCCTGCGCCACTGTGTGGGGGG - Intronic
1062668690 9:137693776-137693798 GTCCTGCGCCACTGTGTGGGGGG - Intronic
1062668735 9:137693946-137693968 GTCCTGCGCCACTGTGTGGGGGG - Intronic
1062668744 9:137693980-137694002 GTCCTGCGCCACTGTGTGGGGGG - Intronic
1062668754 9:137694014-137694036 GTCCAGCACCATCGCCTGGTGGG - Intronic
1062668829 9:137694316-137694338 GTCCTGCGCCACTGTGTGGGGGG - Intronic
1062668839 9:137694350-137694372 GTCCAGCACCATCGCCTGGTGGG - Intronic
1062668856 9:137694418-137694440 GTCCTGCGCCACCGCATGGTGGG - Intronic
1199308580 X:146296854-146296876 GTTCTGGGCCACCGAAAGGTGGG + Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic