ID: 1062674661

View in Genome Browser
Species Human (GRCh38)
Location 9:137733708-137733730
Sequence GTGACGGCCAAGAAATCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062674656_1062674661 8 Left 1062674656 9:137733677-137733699 CCTCTCATCCGGTTGTAAGCCTT 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1062674661 9:137733708-137733730 GTGACGGCCAAGAAATCTAAAGG No data
1062674655_1062674661 9 Left 1062674655 9:137733676-137733698 CCCTCTCATCCGGTTGTAAGCCT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1062674661 9:137733708-137733730 GTGACGGCCAAGAAATCTAAAGG No data
1062674651_1062674661 30 Left 1062674651 9:137733655-137733677 CCCCAGGTGCATACAGAGAGGCC 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1062674661 9:137733708-137733730 GTGACGGCCAAGAAATCTAAAGG No data
1062674653_1062674661 28 Left 1062674653 9:137733657-137733679 CCAGGTGCATACAGAGAGGCCCT 0: 1
1: 0
2: 1
3: 17
4: 200
Right 1062674661 9:137733708-137733730 GTGACGGCCAAGAAATCTAAAGG No data
1062674652_1062674661 29 Left 1062674652 9:137733656-137733678 CCCAGGTGCATACAGAGAGGCCC 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1062674661 9:137733708-137733730 GTGACGGCCAAGAAATCTAAAGG No data
1062674657_1062674661 0 Left 1062674657 9:137733685-137733707 CCGGTTGTAAGCCTTTCTTCCAT 0: 1
1: 0
2: 1
3: 10
4: 208
Right 1062674661 9:137733708-137733730 GTGACGGCCAAGAAATCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062674661 Original CRISPR GTGACGGCCAAGAAATCTAA AGG Intronic
No off target data available for this crispr