ID: 1062674955

View in Genome Browser
Species Human (GRCh38)
Location 9:137736905-137736927
Sequence ATATATACAGAGATTTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062674950_1062674955 23 Left 1062674950 9:137736859-137736881 CCAGCCTGGGTGACAGAGTGAGC 0: 195
1: 32163
2: 82823
3: 157786
4: 174308
Right 1062674955 9:137736905-137736927 ATATATACAGAGATTTGGCTGGG No data
1062674951_1062674955 19 Left 1062674951 9:137736863-137736885 CCTGGGTGACAGAGTGAGCCTGT 0: 9
1: 1473
2: 14966
3: 56111
4: 114711
Right 1062674955 9:137736905-137736927 ATATATACAGAGATTTGGCTGGG No data
1062674952_1062674955 1 Left 1062674952 9:137736881-137736903 CCTGTGTCTCAAAAAAAAAGAAA 0: 2
1: 50
2: 912
3: 4964
4: 32012
Right 1062674955 9:137736905-137736927 ATATATACAGAGATTTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062674955 Original CRISPR ATATATACAGAGATTTGGCT GGG Intronic
No off target data available for this crispr