ID: 1062675746

View in Genome Browser
Species Human (GRCh38)
Location 9:137742679-137742701
Sequence AGGGAGAAGCAAATGTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062675746_1062675754 22 Left 1062675746 9:137742679-137742701 CCCCCAGACATTTGCTTCTCCCT 0: 1
1: 0
2: 1
3: 25
4: 301
Right 1062675754 9:137742724-137742746 GAGAGCTGGACCGTAGCTCCAGG No data
1062675746_1062675753 8 Left 1062675746 9:137742679-137742701 CCCCCAGACATTTGCTTCTCCCT 0: 1
1: 0
2: 1
3: 25
4: 301
Right 1062675753 9:137742710-137742732 CTTATCTTTTAATAGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062675746 Original CRISPR AGGGAGAAGCAAATGTCTGG GGG (reversed) Intronic
900707699 1:4090683-4090705 AGGGAGAAGGCAGTGTCAGGAGG + Intergenic
902983956 1:20144158-20144180 AGGGAGGGACAAAGGTCTGGAGG - Intronic
903053659 1:20620118-20620140 AGGCAGAACCAAGTGTCAGGTGG + Intergenic
903186496 1:21632193-21632215 AGGGTGAAGCAAGGGTGTGGGGG + Intronic
904600672 1:31671021-31671043 CTGGAGAAGAAAATGGCTGGTGG - Intronic
909154224 1:72050824-72050846 TGGGAGAAGCTAATGTCATGAGG + Intronic
909197348 1:72644671-72644693 AGGGAGAAGTACATGGCTGGAGG - Intergenic
909642647 1:77885288-77885310 CTGGAGAAGCAAATATTTGGAGG - Intergenic
910194158 1:84623338-84623360 TGGGAGAATCAAATGTAAGGAGG - Intergenic
910225010 1:84927569-84927591 AAGGAGAATCAAATGTGTGCTGG + Intronic
911295595 1:96111047-96111069 TGGGACAACCAAATGTGTGGAGG - Intergenic
911780083 1:101865445-101865467 AAGGAGAAGTAAATGCCTAGGGG - Intronic
912723313 1:112038121-112038143 AGGGTGAAGAACAAGTCTGGGGG - Intergenic
913670923 1:121096959-121096981 AAGGTAAAGCAAATCTCTGGAGG - Intergenic
914022686 1:143884382-143884404 AAGGTAAAGCAAATCTCTGGAGG - Intergenic
914661174 1:149792324-149792346 AAGGTAAAGCAAATCTCTGGAGG - Exonic
916060872 1:161098012-161098034 AAGGAGAAGCAAAAGTCAGAGGG - Intergenic
916505465 1:165424706-165424728 AGGGAGGAGGAAGTGTCTAGGGG - Intronic
916523258 1:165584867-165584889 AGGGAGAAATAAATTTCTGTTGG + Intergenic
916884022 1:169049457-169049479 GGGGAGAAACAAATGTCAAGTGG + Intergenic
917005462 1:170411473-170411495 AAGGAGAAGCAAGTACCTGGGGG - Intergenic
917516263 1:175711086-175711108 AGGGAGAAACCAATGTCAGAAGG - Intronic
918102456 1:181388083-181388105 GGGGAGAAACAAATGTCTATCGG - Intergenic
918536751 1:185583276-185583298 ATGGAAAAGCAGCTGTCTGGTGG - Intergenic
918870005 1:189958848-189958870 AGGGAGAAGTAATTATCAGGAGG + Intergenic
920743436 1:208602840-208602862 AGGTAGAAGGAACTGTCTGTTGG + Intergenic
921549260 1:216513221-216513243 AGAGAGAAAGAAATTTCTGGTGG + Intronic
921811502 1:219519518-219519540 GGGGAATAGCAAATGACTGGGGG + Intergenic
922665971 1:227469779-227469801 AGGTAGTAGAAAATGTCTGTGGG - Intergenic
923010010 1:230081170-230081192 AGGAAGAAGCAAAGGGCTGCAGG - Intronic
923065082 1:230510133-230510155 AGGGAGAAGAAGGTGGCTGGAGG - Intergenic
923544991 1:234917626-234917648 GGGGAGAAGCAATTGGCTGCAGG - Intergenic
1063349660 10:5342504-5342526 AGTGACAAGCATATGTGTGGTGG - Intergenic
1064277754 10:13922174-13922196 AGTGAGAAATAAATGTCTGTTGG + Intronic
1064295674 10:14076975-14076997 AGGGAGAGGGAAGAGTCTGGAGG + Intronic
1064512386 10:16109878-16109900 AGGGAGAAGCAGAGGACGGGAGG + Intergenic
1064907507 10:20362609-20362631 AGGGTGAAGCAAAGCTTTGGGGG + Intergenic
1067155385 10:43777020-43777042 AGGGAGATGCAAGTTGCTGGGGG - Intergenic
1067674537 10:48360472-48360494 AAGCATAAGCAAATGTGTGGGGG + Intronic
1067765720 10:49084606-49084628 AAGGAGAGGCACATGTCTTGAGG - Intronic
1068292792 10:55026726-55026748 AAGGAGAAGTCAATATCTGGAGG + Intronic
1068571041 10:58629542-58629564 AGGGACAACCAAAAGGCTGGGGG + Intronic
1068913371 10:62402863-62402885 AGAGAGAAGTATGTGTCTGGTGG + Intronic
1069637688 10:69935676-69935698 TGGGAGAAGCAGATGTTTGATGG - Intronic
1069770664 10:70897331-70897353 ATGGAGAGGCAAAATTCTGGGGG - Intergenic
1070767202 10:79063620-79063642 AGGGACAAGAAAATACCTGGAGG - Intergenic
1070828865 10:79406651-79406673 AGGGAGGATGAAATGGCTGGTGG - Intronic
1071117041 10:82233677-82233699 AGGGAGAAGCAAGAGTGGGGAGG - Intronic
1071188730 10:83076457-83076479 AGGGAGAAGACAATTTCTAGAGG - Intergenic
1071998317 10:91168585-91168607 AGGGAGAAGGCAATGACTTGAGG + Intronic
1074049309 10:109867773-109867795 AATGAAAAGCAAATGACTGGTGG - Intronic
1074663129 10:115686995-115687017 AGGTGGAAGGAAATTTCTGGAGG - Intronic
1076100444 10:127773671-127773693 AGTGAGAAGCATGTGTATGGTGG + Intergenic
1077773200 11:5243636-5243658 TGGGAGAGGCAAAGGGCTGGGGG - Intergenic
1078026833 11:7703752-7703774 AGGCAGAAGCATATTTGTGGAGG - Exonic
1078481824 11:11683378-11683400 AAGGAGAAGCAAAGGCATGGTGG - Intergenic
1078903868 11:15666448-15666470 AGGGATAAGCAACTGTCTTCTGG + Intergenic
1079108569 11:17590268-17590290 AGGGAGAAGCAAGTTTGAGGGGG - Intronic
1079382162 11:19947824-19947846 TGAGAAAAGCAAAAGTCTGGGGG + Intronic
1081513124 11:43796202-43796224 AGTGAGAGGGAAATCTCTGGAGG + Intronic
1081598371 11:44475032-44475054 AGGTAGAAGACCATGTCTGGAGG + Intergenic
1082309702 11:50631802-50631824 TGGCAGAAGGGAATGTCTGGAGG - Intergenic
1084748380 11:71188086-71188108 TGGGAGGAGCAGATGTGTGGTGG - Intronic
1084948417 11:72651475-72651497 AGGGAGAGGCCAGGGTCTGGGGG + Intronic
1085350723 11:75796511-75796533 AGGGAGTACCTGATGTCTGGAGG + Exonic
1085868997 11:80327263-80327285 AATGAGAAACAAATGTCTAGTGG - Intergenic
1086906305 11:92422106-92422128 AGGGAGACGCACATGTCTCAGGG + Intronic
1087201094 11:95345427-95345449 AGGGAGAAGCAGCTGACAGGAGG + Intergenic
1087824733 11:102752278-102752300 CTCGTGAAGCAAATGTCTGGAGG - Intergenic
1091016362 11:132054539-132054561 AGGGAGAGGCAGATGGATGGAGG + Intronic
1091131169 11:133148391-133148413 AGTAAGAAGCAGATATCTGGAGG - Intronic
1092446348 12:8561042-8561064 ATGGAAAAGCAGCTGTCTGGTGG - Intergenic
1092595567 12:10000955-10000977 AGAGAAAAGAAAATGTGTGGAGG + Intronic
1095153650 12:38825694-38825716 TGAGAGAGGCATATGTCTGGAGG - Intronic
1095178396 12:39119306-39119328 AGGGAGAGAAAAATCTCTGGAGG - Intergenic
1095494972 12:42774715-42774737 AGTAAGAAGGAAATGTCTGTTGG - Intergenic
1095674986 12:44906170-44906192 AGGGAATAGCAAATGTCTTGAGG + Intronic
1096670616 12:53196320-53196342 AGGGAGAAGCAAGGTACTGGAGG - Intronic
1097308431 12:58093842-58093864 ATGGAGCAGCCAATATCTGGAGG - Intergenic
1097586689 12:61523832-61523854 TGAGAGAAGCAAATGCCTGGAGG - Intergenic
1099809691 12:87565399-87565421 AGGGATAAGCAAAGGGCCGGAGG + Intergenic
1100118296 12:91336573-91336595 AGGCACAAGGAAACGTCTGGAGG - Intergenic
1104445528 12:128830014-128830036 AAGGAGAGGCAACTGTCTGGCGG - Intergenic
1106225557 13:27783725-27783747 AGAGAAAAGGAAATGGCTGGGGG + Intergenic
1107601290 13:42015497-42015519 AGGAGGAAGCAAATGTCCAGTGG + Intergenic
1107790556 13:43998120-43998142 AAGCACAAGCAGATGTCTGGAGG - Intergenic
1107878013 13:44807397-44807419 AAGGAGAAGAAAATGGCGGGGGG + Intergenic
1108317866 13:49255395-49255417 TGGGACAAGGAAATCTCTGGCGG + Intronic
1108747269 13:53408766-53408788 AGGGAGAAGCTGAGGTCTGCAGG + Intergenic
1110583022 13:77154322-77154344 TAGGAGAAGCAAATATATGGAGG + Intronic
1110604568 13:77416942-77416964 AAGCAGAAGCATGTGTCTGGTGG + Intergenic
1110949479 13:81466774-81466796 AGGGAGAATCATATGGCTAGGGG + Intergenic
1110973664 13:81801131-81801153 AGAGAAATGCAAAAGTCTGGTGG - Intergenic
1111041511 13:82755862-82755884 AGGAAGAAGAAAATGTCAGAAGG + Intergenic
1111496426 13:89056383-89056405 AGGGAGAAGGAAAGGAGTGGGGG - Intergenic
1111742318 13:92219418-92219440 AGGCAGGAGAAAAGGTCTGGAGG + Intronic
1112672435 13:101655669-101655691 ATGGAGAAGCAAATGAATGTTGG - Intronic
1113596570 13:111538034-111538056 CTGGAGAAGAAAGTGTCTGGGGG + Intergenic
1113743176 13:112724993-112725015 AGGGAGAAGAAAATGACGTGGGG - Intronic
1115990903 14:39148485-39148507 AGGGAGAACGAAATGGCTGATGG + Exonic
1116277522 14:42855086-42855108 AGGGAGAAATATAAGTCTGGTGG - Intergenic
1116795044 14:49381090-49381112 AGGGATGAGAAAATGTCAGGGGG + Intergenic
1119215210 14:72864228-72864250 AGGGAGAGGCATTTGTCGGGAGG - Intronic
1119583097 14:75805403-75805425 AGGGAGAAGCAGATGCCCAGGGG - Intronic
1120651680 14:87141191-87141213 AGGGAGAAGCTAGGCTCTGGAGG + Intergenic
1120766105 14:88327415-88327437 AGGGGGAAGAAAATTTTTGGTGG - Intergenic
1121064682 14:90951658-90951680 TGGCAGAAGGGAATGTCTGGAGG + Intronic
1123037544 14:105477643-105477665 GGGGAGATGCATATGTGTGGGGG + Intronic
1123959045 15:25374986-25375008 AGTGAGAAGCATATATCTGAAGG + Intronic
1126055948 15:44729508-44729530 GGGGAGAAGCAGGTGTCTGTGGG + Exonic
1126252776 15:46588298-46588320 AGGCACAAGCAAATGTGTGGTGG + Intergenic
1126365166 15:47886607-47886629 AGGGAGAAGCAACTTCCTGGGGG + Intergenic
1127358780 15:58226753-58226775 TGGGAGAAGCAAGGGTGTGGGGG - Intronic
1127713140 15:61621219-61621241 AGGGAGATGCACCTGGCTGGTGG + Intergenic
1129138790 15:73578022-73578044 AGGGAAATGCAAAGGTCTTGAGG + Intronic
1130386397 15:83416006-83416028 AGAGAGTAGCAAATATCAGGTGG + Intergenic
1130703977 15:86214633-86214655 AGGAAAAAGCTAATGTCTGAGGG - Intronic
1134026517 16:10958190-10958212 AGGAAGGAGAACATGTCTGGTGG + Intronic
1134611649 16:15613907-15613929 TGGGAGAAGCAAAAGTGTTGGGG + Intronic
1134877700 16:17716696-17716718 TGGGAGAAGCAATGGTCTGTGGG - Intergenic
1136568404 16:31083066-31083088 AGGGAGAAGCTGAGGTCTGCAGG - Exonic
1137246904 16:46713004-46713026 TGAAAGAAGCAAATGCCTGGAGG - Intronic
1137398791 16:48136255-48136277 AGGGAGGAGCAGAGGCCTGGAGG - Intronic
1138150350 16:54650788-54650810 AGGCAGAGGCAGCTGTCTGGTGG + Intergenic
1139070115 16:63370086-63370108 TGGGGGAAGGAAATGTCTGGCGG - Intergenic
1140869212 16:79091181-79091203 AGGAAGAGGAAAAAGTCTGGGGG - Intronic
1143273715 17:5694503-5694525 AGGAAGAAGCCAAGGGCTGGGGG + Intergenic
1143731274 17:8884357-8884379 AGGGAGAAGCCAGGGTCTCGGGG - Intronic
1143865847 17:9922855-9922877 AAGGAAAAATAAATGTCTGGTGG + Intronic
1144029201 17:11304495-11304517 AGAGAGAAGCAAAGGGCGGGTGG + Intronic
1146687832 17:34853468-34853490 ATTGAGAAGGAAATGTTTGGGGG + Intergenic
1147721327 17:42541255-42541277 AGGGAGTAGCAGATGTCAGTAGG + Intronic
1148346157 17:46904857-46904879 AGGGAGAAGCAGAGTTCTGCAGG - Intergenic
1149299316 17:55289450-55289472 TAGGAGAAGCAAATGTGAGGAGG - Intronic
1149412766 17:56425912-56425934 AGGGACAAGGAAATGTCCTGGGG - Intronic
1149486250 17:57045447-57045469 AGGGAGCAGCAAATGGCCGGCGG + Intergenic
1152522718 17:80868962-80868984 GGGCAGAAGAAAATGTCTGAGGG + Intronic
1153069554 18:1089607-1089629 AGGGAGAAGGAATTCTCTAGCGG - Intergenic
1153343216 18:3998040-3998062 ATACAGAAGCATATGTCTGGTGG + Intronic
1155817751 18:30335212-30335234 AGTGAGAAGCCATTGTCAGGTGG - Intergenic
1156069638 18:33190948-33190970 AGTGAGAAGCAAATTGCTGATGG - Intronic
1157141807 18:45115799-45115821 AAGGAGAAGCAAAGATCTGAGGG - Intergenic
1157356445 18:46939417-46939439 TGGCAGAATCAAATGTATGGAGG + Intronic
1157763816 18:50283074-50283096 AGGGAGAAGGAAAAGAATGGAGG + Intronic
1158171395 18:54604596-54604618 ATGGAAAAGCAGCTGTCTGGTGG + Intergenic
1159790713 18:72776500-72776522 AGTGAGAAGTAAATTTCTGTTGG - Intronic
1160736130 19:663169-663191 AGGGAGCAGCAAACGGCCGGCGG - Exonic
1161258259 19:3321645-3321667 AGGGAGAAGCCACTGGCTAGGGG + Intergenic
1162171194 19:8790297-8790319 AGGGAGGAGAAAATGTCCGAAGG + Intergenic
1162221226 19:9178386-9178408 AAGGAGAAGAAAGTGTGTGGGGG + Intergenic
1163544335 19:17932156-17932178 AGGGAAAAGCAAATGCTTTGGGG - Intergenic
1163751076 19:19078205-19078227 GGGCAGAAGCAGAGGTCTGGAGG + Intronic
1164756869 19:30696238-30696260 AGAGAGAAGGGAATTTCTGGAGG + Intronic
1165150333 19:33756569-33756591 AGGGTGAGGGAAATGTCTGGAGG - Intronic
1166449511 19:42886221-42886243 AGGGAGAAGGGAATGCATGGTGG - Intronic
1166460809 19:42986514-42986536 AGGGAGAAGGGAATGCATGGTGG - Intronic
1166478104 19:43146504-43146526 AGGGAGAAGGGAATGCATGGTGG - Intronic
1167327222 19:48834197-48834219 AGGCATATGCAAATGGCTGGAGG + Intronic
1167505356 19:49868381-49868403 AGGGAAAAAAAAATGGCTGGAGG - Intergenic
1167674103 19:50873986-50874008 GGGAAGAAGGAAGTGTCTGGTGG - Intronic
1167748462 19:51366564-51366586 AGAGAGAAGGAAAGGCCTGGCGG + Intronic
1168539865 19:57201341-57201363 AGGGAGAGGCAGCTGCCTGGAGG - Intronic
1168683932 19:58336539-58336561 AGGGCCAAGCAGATGGCTGGGGG + Intronic
928357465 2:30632444-30632466 AGGGAGAAGCAACTGTTTAGAGG - Intronic
928600717 2:32901161-32901183 AGGGAGAAGTAGCAGTCTGGAGG + Intergenic
931164856 2:59735105-59735127 AGGGATAGACAAATGCCTGGTGG + Intergenic
932801640 2:74747061-74747083 AGTGACAAGCACATGTCTAGAGG + Intergenic
934725199 2:96612461-96612483 AGTGAGAAGCAAAGTGCTGGAGG - Exonic
936009873 2:108918692-108918714 AGCCAGAAGCACATGGCTGGAGG + Intronic
936779679 2:116017045-116017067 TGGGAGATGCAAATATTTGGGGG - Intergenic
937843669 2:126553765-126553787 AGGAAGAAGAAAATGTCTCATGG + Intergenic
938824703 2:134993203-134993225 AGGGTCAAACAAATGTCTGTAGG + Intronic
939846375 2:147251358-147251380 AGGGAGAAGCAAATGGGTAGAGG + Intergenic
942359668 2:175158566-175158588 GGCAAGAAGCAAACGTCTGGGGG + Intronic
942573317 2:177336118-177336140 CAGGAGAAGAGAATGTCTGGTGG + Intronic
942973622 2:181987716-181987738 ATGCAAAAGCAAATTTCTGGAGG - Intronic
943034966 2:182731961-182731983 AGGGAGAAGCAATTTACTTGAGG - Intronic
943642913 2:190378696-190378718 AAGTAGAAGCAGATGGCTGGCGG - Intergenic
943779545 2:191807096-191807118 AGGAAGAAGAAAAAGTATGGTGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
944152324 2:196573204-196573226 ATGGAGAAACAAATTTCTGGGGG - Intronic
944275069 2:197827097-197827119 AGGCAAAAGAAAATGGCTGGAGG - Intronic
945380920 2:209139039-209139061 AGGCAGAAGAAAAAGACTGGTGG - Intergenic
945812795 2:214568944-214568966 AGGGAGAAGAAAAGGGCTGGAGG - Intronic
946211811 2:218153254-218153276 AGGGAGGAGCTCATTTCTGGGGG - Intergenic
946229272 2:218281735-218281757 AGGGGGCAGCAAGTGGCTGGGGG + Intronic
947275546 2:228387635-228387657 ATGTAGAAGAAAATGTCTGTGGG + Intergenic
948331142 2:237166566-237166588 AGGCTCCAGCAAATGTCTGGTGG + Intergenic
1171030694 20:21673921-21673943 AGGAAGATTCAAATTTCTGGGGG + Intergenic
1171102636 20:22399971-22399993 AGGGAGAACAAAATTTCTTGTGG - Intergenic
1171307226 20:24116944-24116966 AGGGAGAAACCAAGATCTGGGGG - Intergenic
1173112139 20:40202034-40202056 AGAGAGAAGGAGATCTCTGGAGG - Intergenic
1175767125 20:61599363-61599385 AGGGACAGGCAAGTGTCAGGTGG + Intronic
1180669470 22:17542205-17542227 GAGGAGAAGCAAATGTGCGGGGG + Exonic
1183322442 22:37173229-37173251 AGGGAGAAGCAAATTTGGGAGGG - Intronic
1184346542 22:43917145-43917167 GGAGAGAAGCAAATGTTTGGAGG + Intergenic
949694431 3:6678195-6678217 AGATAGAAGCAAATGCCTGAAGG + Intergenic
953243392 3:41169288-41169310 AGGGAGGAGCAAATGCCAGAGGG + Intergenic
953546090 3:43864546-43864568 AAGGGGAAGCAAAAGACTGGAGG - Intergenic
953663680 3:44909855-44909877 ATGGAGAAGCAGATTTTTGGAGG + Intronic
954584244 3:51720166-51720188 AGGGAGAGCCAAAGGCCTGGGGG + Intergenic
957025181 3:75173614-75173636 GGGGAAAAGCAAATCCCTGGAGG + Intergenic
958628452 3:96656942-96656964 AGAGAGAAGCAAATGTGTTCAGG + Intergenic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
963255893 3:143144717-143144739 AAGTAGAAGCATATGTGTGGGGG - Intergenic
963490249 3:145991058-145991080 AGAAAGAAACAAATGTCTTGGGG - Intergenic
967177043 3:186870396-186870418 AGGGTGATGGAAATGTCAGGAGG + Intergenic
967372301 3:188760364-188760386 AGGAAGAAGCAAAGATCTGATGG - Intronic
967746737 3:193064292-193064314 ATGCAGCTGCAAATGTCTGGTGG + Intergenic
968555160 4:1243260-1243282 AGGAAGAAGCAGATGTGTGAAGG + Intronic
970587637 4:17529847-17529869 TGGGAGAATGAAATGTCTGGAGG - Intergenic
975448567 4:74498168-74498190 ATGGAAAAGTAAAAGTCTGGAGG - Intergenic
975493237 4:75011437-75011459 ACTGAGATGCAAATGACTGGGGG + Intronic
976184611 4:82431088-82431110 AGGGAGAAGCTAGTGTCGCGAGG - Intronic
977371846 4:96147182-96147204 ACAGAGAAGCAAATGTCTAGAGG - Intergenic
978369698 4:108017955-108017977 AGGCAGAAGCAGAGGTCTGCTGG + Intronic
982573408 4:157077006-157077028 AAGGAGAAGCAAATTTCTGAGGG + Intronic
984661219 4:182377887-182377909 ATAGAGAAGCAAATCTCTGTAGG + Intronic
987271331 5:16312521-16312543 AGGGAGGAGAAAATAGCTGGTGG + Intergenic
987565865 5:19585446-19585468 AGATAGAAGCAAATGACTGCGGG - Intronic
988272382 5:29033264-29033286 AAGGAAAAGCAATTTTCTGGAGG - Intergenic
988689589 5:33559150-33559172 ATGAAGAAACAAATGTCTAGAGG + Intronic
988693843 5:33599096-33599118 AGGAAGACTCAAATGCCTGGGGG - Intronic
988829501 5:34973641-34973663 AGGGAGAAGTAAATGCAAGGGGG + Intergenic
990995190 5:61726220-61726242 ACGGAGAAGCAAAAGGCAGGAGG + Intronic
992987762 5:82251054-82251076 AGGGAGAAACAAATGCCAGGTGG + Intronic
993621186 5:90169427-90169449 AGTTAGAAGAAAATGTATGGAGG - Intergenic
994733243 5:103519753-103519775 AGGGAGAAGCAATTGACCAGTGG - Intergenic
994780955 5:104089283-104089305 AGTGATAAGCATATGTATGGTGG + Intergenic
996347527 5:122502890-122502912 AGAGAGAAGCAGATGTATGGGGG - Intergenic
997226159 5:132210844-132210866 ACAGAGAAGAAGATGTCTGGTGG + Intronic
997858941 5:137398574-137398596 AGAGAGAAACAAATCTTTGGGGG + Intronic
997944017 5:138183216-138183238 ATGGAGAAGCGAATGTTTGCCGG - Exonic
998182362 5:139954366-139954388 AGGAAGAATGAAATGACTGGAGG + Intronic
1001185862 5:169571528-169571550 AGTGAGAGAAAAATGTCTGGCGG - Intergenic
1002082644 5:176746601-176746623 AGGGAGATGCGAAAGTCAGGGGG - Intergenic
1004049630 6:12063582-12063604 AGGCAGAGGCAGATGTCTTGGGG + Intronic
1004764395 6:18709249-18709271 TGGGAGAAATAAATGTCTGCTGG - Intergenic
1004813175 6:19282185-19282207 TGGCAAAAGCAAATATCTGGAGG + Intergenic
1006442296 6:34060116-34060138 AGGGAGAAACAAATGTTTCCAGG + Intronic
1007147114 6:39647235-39647257 AGGGAGAAAAAAATGTGAGGAGG + Intronic
1009401038 6:63256051-63256073 AGGTAGAAGGATTTGTCTGGAGG - Intergenic
1009444320 6:63722642-63722664 AGGGAGAAGAAAATGTTTCGTGG - Intronic
1011494852 6:87927610-87927632 AGGGAGTGGAAAATCTCTGGGGG - Intergenic
1012436232 6:99217924-99217946 AGGGACAATCAGATGTCTGCAGG + Intergenic
1013696612 6:112709784-112709806 AAAGAGAAGCAGATGACTGGTGG + Intergenic
1014524532 6:122486267-122486289 AGGGGGAATAAAATGACTGGAGG - Intronic
1015390508 6:132676578-132676600 AGGGAAAAGCAACTGGCTTGTGG - Intergenic
1015888011 6:137940452-137940474 AGGGGGAAGCATGTGTGTGGAGG - Intergenic
1016012602 6:139153914-139153936 ATGGAGGAGCAAATTTCTGGAGG - Intronic
1016068957 6:139714441-139714463 AGGGAGACTCAGATGTCTAGGGG + Intergenic
1016184400 6:141181400-141181422 AGGGAGTTCCTAATGTCTGGGGG + Intergenic
1016371777 6:143382157-143382179 AGAGAAATGCAAATGTCTGAGGG - Intergenic
1016988642 6:149913537-149913559 AGGGAGGAGGAAATGTCAGGAGG + Intergenic
1017007952 6:150041430-150041452 AGGGAGGAGGGAATGTCAGGAGG + Intergenic
1017071400 6:150578124-150578146 AGGTAGATGCAAGTGTCAGGAGG - Intergenic
1019162779 6:170080355-170080377 AGGGGGCAGAAACTGTCTGGCGG - Intergenic
1020440231 7:8209799-8209821 AGGGAGAAGGGAATTTCTGGTGG + Intronic
1020764286 7:12301419-12301441 AGGGAGAAGCAACTTCCTGATGG - Intergenic
1021061403 7:16117394-16117416 AAGGAAAAGCAAATGCCTGAAGG - Intronic
1021534902 7:21692310-21692332 AGGCAGAAGAGAATTTCTGGGGG - Intronic
1022408580 7:30117968-30117990 AGGGACACACAAATGTCTGATGG + Intronic
1023743101 7:43298426-43298448 AGTTAGAAGCACATGTCAGGGGG - Intronic
1025189681 7:56887148-56887170 AGGGGGAATCAAAGCTCTGGTGG - Intergenic
1025682257 7:63689769-63689791 AGGGGGAATCAAAGCTCTGGTGG + Intergenic
1026084937 7:67255158-67255180 AGGCAGATGGACATGTCTGGAGG + Intergenic
1026692237 7:72559762-72559784 AGGCAGATGGACATGTCTGGAGG - Intronic
1029543922 7:101200500-101200522 AGGGAGAAGAAAGGGCCTGGGGG + Exonic
1030262075 7:107576554-107576576 AGGAAGCAGAAAATGTGTGGCGG + Exonic
1030523629 7:110628266-110628288 ACAGAAAAGCAAATGTGTGGAGG - Intergenic
1030622215 7:111802262-111802284 AGGGGGAAGAAAATTTCTGTTGG + Intronic
1031379037 7:121062044-121062066 AGGGAGAAGTCATTGTTTGGGGG + Intronic
1031626319 7:123996676-123996698 AGGCAGAAGCAAGTGTATGGGGG - Intergenic
1034387156 7:150749336-150749358 AGGTAGAAGGAAAGGTATGGAGG - Intronic
1034973121 7:155431500-155431522 AGGGAGAAGCTAATGGAAGGGGG + Intergenic
1035023578 7:155812660-155812682 AGGGAGGAGCGCATGTCTTGTGG + Intergenic
1035519418 8:265538-265560 AGGAAGAAGCTGAGGTCTGGAGG - Intergenic
1035622517 8:1044589-1044611 CGGGAGAAACAACTGTCTGGAGG - Intergenic
1036227985 8:6975970-6975992 AGGTAGAATGAAATGTTTGGTGG - Intergenic
1036230438 8:6995087-6995109 AGGTAGAATGAAATGTTTGGTGG - Intergenic
1036232890 8:7014190-7014212 AGGTAGAATGAAATGTTTGGTGG - Intronic
1036668821 8:10766177-10766199 AGGCAGAAGCTAATGTCAGAAGG + Intronic
1036756987 8:11477310-11477332 AGGGAGGAGCAAGTGGCTGAAGG + Intergenic
1037956649 8:23065391-23065413 TGGGAGAAGCAGCTGCCTGGAGG + Intronic
1037960755 8:23096221-23096243 AGTGAGAAGCGTATGTGTGGTGG + Intronic
1037971008 8:23171902-23171924 AGTGAGAAGCGTATGTGTGGTGG - Intergenic
1038309737 8:26437186-26437208 AGGGAGAAGCAAAGATGGGGTGG + Intronic
1040796457 8:51293999-51294021 AGGGAGCTCCTAATGTCTGGGGG - Intergenic
1042384151 8:68152970-68152992 AGTGATAAGCACATGTATGGTGG - Intronic
1042510376 8:69604956-69604978 ATGGAGAAGCACATGAGTGGTGG - Intronic
1044904268 8:96983068-96983090 AGGGAGAAGGAAATGGATTGTGG - Intronic
1044944029 8:97374312-97374334 AGGGAAAATCAAAGCTCTGGGGG + Intergenic
1046159992 8:110349319-110349341 AGGGAGAAGAAAATGTTAAGTGG - Intergenic
1046776768 8:118172717-118172739 AGGCAGAAGCAAACTTTTGGAGG - Intergenic
1046863712 8:119123003-119123025 AGGAAGTAGCAAATGGCAGGAGG - Intergenic
1047001312 8:120575516-120575538 AGTGGGAGGCAAATGCCTGGGGG + Intronic
1047222776 8:122931825-122931847 TGGGAGAAGGAAATGAGTGGGGG + Intronic
1048295972 8:133213338-133213360 AGCAAGAAGCAAAGTTCTGGAGG - Intronic
1054748802 9:68883461-68883483 AGAAAGAAGCAAGTGTCTGCTGG - Intronic
1055449713 9:76419820-76419842 AGAGAGTAGCAACTGTGTGGTGG - Intergenic
1055756826 9:79567238-79567260 ACTGAGAAGCAAATTTCAGGTGG - Intergenic
1056308166 9:85311983-85312005 TGGGAGAAACAAATGGATGGTGG - Intergenic
1056697504 9:88872250-88872272 AAGCAGAAGCAAATGTCTGGAGG - Intergenic
1056820609 9:89839388-89839410 AGGGAGAAATAAATGTCCTGGGG - Intergenic
1056891813 9:90501464-90501486 AAGGAGAAGCCACTGTCTGTTGG + Intergenic
1059707330 9:116837420-116837442 AGGGAGAGGAAGATGCCTGGAGG + Intronic
1061138030 9:128747422-128747444 AGGGAGAGGCCACTGTGTGGAGG - Intronic
1061423523 9:130485052-130485074 CGGGAGCAGAGAATGTCTGGTGG - Intronic
1062347456 9:136121921-136121943 AGGGAGAAGCACGTGACTGCGGG - Intergenic
1062675746 9:137742679-137742701 AGGGAGAAGCAAATGTCTGGGGG - Intronic
1186084474 X:5971951-5971973 AAGGATAAGCCCATGTCTGGAGG - Intronic
1186188185 X:7042085-7042107 AGGGAGAAGGGAATGCATGGTGG - Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1189044726 X:37578338-37578360 AGGGAGAAGGAAATGGTTGCTGG + Intronic
1189262409 X:39688166-39688188 AGAGAGAAGACAGTGTCTGGGGG - Intergenic
1189303005 X:39966428-39966450 AGAGAGAAGCCAATGTGTGTTGG + Intergenic
1189578453 X:42380781-42380803 ATGGAAAAGGAAAAGTCTGGGGG + Intergenic
1190643578 X:52503970-52503992 AGGGAGAAGCGATTCTCTCGTGG + Intergenic
1193052963 X:77120944-77120966 AGTGAGAGAAAAATGTCTGGAGG + Intergenic
1194770355 X:97895957-97895979 AGAGAGAAGCCAAAGTTTGGAGG - Intergenic
1195240221 X:102944038-102944060 AGTGAGAAGCAAATGTTAAGAGG + Intergenic
1195256780 X:103098686-103098708 AGTGATAAGCATATGTATGGTGG + Intergenic
1195772422 X:108365640-108365662 AGGGAGAAGCGAATGTGGGCTGG + Intronic
1197780996 X:130160209-130160231 AGGGAAAAGAAAATGTGGGGAGG - Intronic
1197971775 X:132121928-132121950 AGGGAAGAGCAAATCTCTTGGGG + Intronic
1198528014 X:137521674-137521696 AAGGAGATGCAAATGTGGGGAGG - Intergenic
1198652993 X:138884247-138884269 AGGGAGAATCAAATGTCCTCAGG + Intronic
1200767867 Y:7095787-7095809 AGGACAAAGCAAATGGCTGGGGG + Intergenic