ID: 1062677092

View in Genome Browser
Species Human (GRCh38)
Location 9:137753009-137753031
Sequence GCACCCTGGTCTGCGGGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062677085_1062677092 14 Left 1062677085 9:137752972-137752994 CCTGTTATTCCTTGAGGAGGGTC 0: 1
1: 0
2: 1
3: 3
4: 57
Right 1062677092 9:137753009-137753031 GCACCCTGGTCTGCGGGAATTGG No data
1062677087_1062677092 5 Left 1062677087 9:137752981-137753003 CCTTGAGGAGGGTCCAGATCGGA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1062677092 9:137753009-137753031 GCACCCTGGTCTGCGGGAATTGG No data
1062677079_1062677092 29 Left 1062677079 9:137752957-137752979 CCGTCCCTACTGAAGCCTGTTAT 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1062677092 9:137753009-137753031 GCACCCTGGTCTGCGGGAATTGG No data
1062677080_1062677092 25 Left 1062677080 9:137752961-137752983 CCCTACTGAAGCCTGTTATTCCT 0: 1
1: 0
2: 1
3: 12
4: 171
Right 1062677092 9:137753009-137753031 GCACCCTGGTCTGCGGGAATTGG No data
1062677081_1062677092 24 Left 1062677081 9:137752962-137752984 CCTACTGAAGCCTGTTATTCCTT 0: 1
1: 1
2: 1
3: 14
4: 198
Right 1062677092 9:137753009-137753031 GCACCCTGGTCTGCGGGAATTGG No data
1062677088_1062677092 -8 Left 1062677088 9:137752994-137753016 CCAGATCGGAATTGTGCACCCTG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1062677092 9:137753009-137753031 GCACCCTGGTCTGCGGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062677092 Original CRISPR GCACCCTGGTCTGCGGGAAT TGG Intronic
No off target data available for this crispr