ID: 1062677755

View in Genome Browser
Species Human (GRCh38)
Location 9:137757812-137757834
Sequence CCGCACCCACCCAGACGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062677755_1062677759 -7 Left 1062677755 9:137757812-137757834 CCTGTGCGTCTGGGTGGGTGCGG 0: 1
1: 0
2: 2
3: 10
4: 171
Right 1062677759 9:137757828-137757850 GGTGCGGCCGCCTGGGTGCGTGG 0: 1
1: 0
2: 0
3: 14
4: 243
1062677755_1062677762 23 Left 1062677755 9:137757812-137757834 CCTGTGCGTCTGGGTGGGTGCGG 0: 1
1: 0
2: 2
3: 10
4: 171
Right 1062677762 9:137757858-137757880 TGTGTGTGCCTTTCATACCTAGG 0: 1
1: 0
2: 1
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062677755 Original CRISPR CCGCACCCACCCAGACGCAC AGG (reversed) Intronic
900103139 1:971310-971332 CCCCACCCACCCAGGAGCAGTGG + Exonic
902331221 1:15732085-15732107 CCTGACCCACCCAGACCCCCAGG + Intronic
905279735 1:36841494-36841516 CCGTACACACACAGATGCACTGG - Intronic
905741256 1:40373643-40373665 CCGCCCCCACCGCGCCGCACTGG - Intronic
905929276 1:41775769-41775791 CCGCACCCAGCCAGAAGGAGTGG + Intronic
906089365 1:43165395-43165417 TCCCACCAACCCAGACACACAGG + Intronic
907136275 1:52142217-52142239 CGGCACCCGCCCAGCCGCATCGG - Exonic
907527349 1:55061566-55061588 CCCCACCCACCCGGCCTCACGGG - Intronic
909331058 1:74411509-74411531 CCTCCCCCACCCTGACACACAGG + Intronic
912495493 1:110088878-110088900 CAGCACCCACCCATATGCGCAGG - Intergenic
912569376 1:110610266-110610288 CCACACCCACACAGAGGGACTGG + Intronic
912602285 1:110949080-110949102 CCCCACACACACACACGCACAGG - Intronic
913538349 1:119795642-119795664 TCTCACCCACCCACACGCACTGG - Intronic
920017714 1:202927097-202927119 CCGAACCCACACAGCCGCACCGG + Exonic
920260287 1:204684400-204684422 CCTCCCCCACCCAAACGAACAGG - Intronic
922766238 1:228158066-228158088 CCGCTCCTGCTCAGACGCACGGG - Exonic
922770159 1:228177308-228177330 CCTCACCCAGCCACACCCACGGG - Exonic
923042934 1:230332834-230332856 CCGCACTCACCCTGCTGCACCGG + Exonic
923221600 1:231899388-231899410 CCACACCCACCCAAAGGCAGTGG - Intronic
1062760257 10:12082-12104 CCGCACCCACCCTGGCTCCCTGG + Intergenic
1064271821 10:13872223-13872245 CCTCACCCATCCAGAGCCACAGG - Intronic
1064323546 10:14328351-14328373 CCCCACCCACACACACACACAGG - Intronic
1064809287 10:19176837-19176859 ACGCACACACACAGACACACAGG - Intronic
1069206277 10:65691263-65691285 TTGCACCCACACAGACACACAGG + Intergenic
1070552184 10:77498574-77498596 GCTCACTCACCCAGACTCACAGG + Intronic
1070957610 10:80474515-80474537 CTTCACCCACCCAGACACTCAGG - Intronic
1072302252 10:94072861-94072883 ACTCACCCACACAGATGCACTGG + Intronic
1074783252 10:116817508-116817530 CCCCACCCACACACACACACTGG - Intergenic
1075701231 10:124470453-124470475 CCGAAGGCACCCAGACACACAGG - Intronic
1076589062 10:131570726-131570748 CTGCCCACACCCAGACACACAGG + Intergenic
1076672691 10:132131794-132131816 CTGCACCCACACAGACACCCGGG - Intronic
1078660020 11:13278482-13278504 CCGCCCCCACCCAGCCTCGCGGG - Intronic
1079467293 11:20743060-20743082 CCGTGCCCACCCAGAGTCACTGG - Intronic
1080154155 11:29088705-29088727 CAACACCCTCCCAGACACACTGG - Intergenic
1084556169 11:69877431-69877453 CCGCACCCACCCCGGAGAACAGG + Intergenic
1084597074 11:70123300-70123322 CTGCCCCCACCCAAACTCACAGG - Intronic
1089219357 11:116858075-116858097 CCTCACCCACCCCGCCCCACGGG - Exonic
1090194289 11:124801033-124801055 CCACACCTACCCAGACTAACTGG - Intergenic
1094449726 12:30571924-30571946 CCTCACCCTCCCAGGAGCACAGG + Intergenic
1095432026 12:42144680-42144702 CCGCGCCCGCCCCGACGAACTGG + Exonic
1100639522 12:96468738-96468760 ACGCACCCAGCCAGGCGCAGTGG - Intergenic
1104004965 12:124885387-124885409 CCCCACCCACCCCCAGGCACAGG + Intergenic
1104671056 12:130680614-130680636 CCCCACCCACTCATACACACAGG + Intronic
1104902084 12:132194970-132194992 CCACCCCCAGCCAGACTCACAGG - Intergenic
1106874994 13:34061973-34061995 TCCGACCTACCCAGACGCACAGG - Intergenic
1107315435 13:39126636-39126658 CCCTACCCACACAGACACACAGG - Intergenic
1107693062 13:42971433-42971455 CCACCCCCACACAGACTCACAGG - Intronic
1107781618 13:43909615-43909637 CCCCACCCACCCAGACTCTAGGG - Intergenic
1108639712 13:52371736-52371758 CCACACCCACCCACCCACACCGG + Intergenic
1109253352 13:60048016-60048038 CCTAACCCACCCAGTCGCACGGG + Intronic
1110402048 13:75103523-75103545 CTGCACCAACCCTGAAGCACAGG - Intergenic
1112933160 13:104766489-104766511 CCCCACCCACACACACACACAGG + Intergenic
1116946673 14:50841846-50841868 CCTCAACCTCCCAGACTCACAGG - Intergenic
1118590061 14:67394546-67394568 CTGCACCCACCTAGACCCATAGG + Intronic
1121120213 14:91371752-91371774 GCTCACCCACCCAGGCCCACAGG + Intronic
1122081831 14:99272095-99272117 CCGCACCGACCCAGGCGCACTGG - Intergenic
1122829320 14:104388035-104388057 CCACACACACCCAGCCGCTCAGG - Intergenic
1124621243 15:31275298-31275320 CCGCACACCCTCAGACACACAGG - Intergenic
1125200778 15:37099270-37099292 TCGCACACACGCAGAGGCACGGG + Intronic
1125594199 15:40873892-40873914 CCGCAGCCACGCGGCCGCACGGG + Intronic
1128037646 15:64540737-64540759 CCGCGCCCAGCCAGACACAAAGG - Intronic
1128227996 15:66015883-66015905 CCCCACCCACACAGTAGCACAGG - Intronic
1129719893 15:77872234-77872256 ATGCACCCACCCAGGCTCACTGG - Intergenic
1130423625 15:83773690-83773712 CTCCACCCATCCAGAGGCACTGG - Intronic
1132210882 15:100021210-100021232 GCACACCCACCCAGAACCACAGG - Intronic
1132572001 16:648261-648283 CGGCACCCAGCCAGGCGCAGTGG - Exonic
1133100646 16:3477434-3477456 CCGCTTCCACAAAGACGCACAGG - Intronic
1133187417 16:4109962-4109984 CCGCCCCCACAGAGAAGCACAGG + Intronic
1133230138 16:4362480-4362502 CCCCCCTCACCCAGACTCACTGG - Intronic
1133529968 16:6646188-6646210 CGGAACCCACCCAGAGACACCGG + Intronic
1136412568 16:30085872-30085894 CCCCACCCCCCCACACACACTGG - Exonic
1136541045 16:30927844-30927866 CCGCCCCCGCCCAGGCGCAAGGG + Exonic
1139511490 16:67430821-67430843 GCGCCCCCACCCACACGCCCGGG - Intronic
1140111501 16:72008990-72009012 CAGCACCCACCCAGACCTGCAGG - Intronic
1141187515 16:81798444-81798466 CCCCAGCCTCCCAGAAGCACTGG - Intronic
1141645396 16:85364757-85364779 CACACCCCACCCAGACGCACGGG + Intergenic
1141969318 16:87469810-87469832 CAGCACACCCCCAGAAGCACTGG + Intronic
1143720447 17:8805494-8805516 GCTCACCCATTCAGACGCACAGG - Intronic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1144677165 17:17169013-17169035 TCGGCCCCACCCAGACACACAGG + Intronic
1145902753 17:28498879-28498901 CAGCTCCCACTCAGACCCACAGG + Intronic
1146954977 17:36932242-36932264 CCGCACACCCCCAGACCCGCGGG + Intergenic
1149515292 17:57276617-57276639 CCACACCCACCCAGGCACTCTGG - Intronic
1151939166 17:77281869-77281891 ATTCACCCACACAGACGCACAGG - Intronic
1152230024 17:79109791-79109813 CCGCGCCCACCCACAGGCGCTGG + Intronic
1152452959 17:80395022-80395044 CAGCTCACACCCAGACTCACTGG + Exonic
1152953165 18:12436-12458 CCGCACCCACCCTGGCTCCCTGG + Intergenic
1153016206 18:584580-584602 CCGCACACAGCCAGATCCACTGG + Intergenic
1153596349 18:6729336-6729358 GCGCACACACACAGACACACAGG + Intergenic
1153835920 18:8963658-8963680 CCGTCCCCACCCACACACACAGG + Intergenic
1155192851 18:23446726-23446748 CCGCACCCAGCCAAACTCACTGG - Intergenic
1160169960 18:76544770-76544792 CTGCACCAGCCCAGACCCACAGG - Intergenic
1160796356 19:947528-947550 CAGCCCCCACCCAGATGCCCCGG + Intronic
1161005545 19:1934101-1934123 ACACACACACCCAGATGCACAGG + Intergenic
1161582258 19:5087325-5087347 CCTCCCCCACACAGACACACAGG - Intronic
1162359873 19:10212590-10212612 CCACACCCAGCCAGCCTCACTGG - Intronic
1163272282 19:16261551-16261573 CTGCCCCCACCCAGCCACACGGG - Intergenic
1164830074 19:31313579-31313601 CCTCACCCTCACAGAGGCACTGG - Intronic
1165374360 19:35431341-35431363 CCCCACCCCCCCAGCCACACTGG + Intergenic
1166380129 19:42351332-42351354 CTGCACCCAGCCTGACTCACTGG - Exonic
1166837301 19:45675287-45675309 CCGCACGCACCCAGGCACAGTGG + Intronic
1166848616 19:45746255-45746277 CTGCACCCAGCCAGTCTCACTGG + Intronic
1168271078 19:55250105-55250127 CCCCATCCACCCAGACCCGCAGG - Intronic
1168350715 19:55674299-55674321 ACGCACCCACACAGACACAGAGG + Intronic
1168386258 19:55965809-55965831 CCCCACCCCCCCAGAGGCCCCGG + Intronic
927081673 2:19636550-19636572 CCACACCCACCCATAGCCACAGG - Intergenic
928253116 2:29699206-29699228 CCACACCCACCCAGGGGCAGGGG + Intronic
929460838 2:42101319-42101341 CCGCCCCCGCCCCGACACACTGG + Intergenic
932772314 2:74507439-74507461 TCGCAACCACGCAGGCGCACTGG + Intronic
933003518 2:76958413-76958435 ACGCACCCACCCCTACGCAGAGG + Intronic
935178211 2:100667964-100667986 GTGCACCCACCAAGGCGCACAGG + Intergenic
943236792 2:185332084-185332106 ACGCACCCACCCAGAATCAAAGG - Intergenic
946017612 2:216616591-216616613 ACACACCCACCCACACACACAGG - Intergenic
948505855 2:238426699-238426721 CCGTCCCCACCCACACGGACGGG - Intergenic
948882751 2:240868840-240868862 CCGCACCCAACCTGCCGCTCGGG - Exonic
1171428716 20:25065201-25065223 CCACACCCAGGCAGAGGCACCGG + Intergenic
1176411391 21:6451241-6451263 CCTCACACACTCACACGCACAGG + Intergenic
1176887491 21:14273914-14273936 CCGCACCGCCCCAGGCGCACTGG + Intergenic
1178985414 21:37298819-37298841 CCCCACCCACCCAGACCCTTGGG + Intergenic
1179686884 21:43059563-43059585 CCTCACACACTCACACGCACAGG + Intronic
1180092355 21:45539625-45539647 CCGCCCCCAACCTGACACACAGG + Intronic
1180950043 22:19716847-19716869 CAGCACCCACCCAGACAGGCTGG - Intronic
1181570067 22:23763690-23763712 CCGCCTCCAGCCAGAGGCACGGG - Intronic
1183064346 22:35353042-35353064 CCCCACCCACGCACAAGCACAGG + Intergenic
1183574704 22:38680449-38680471 CCGCACCCACCCACACCCACAGG + Intergenic
1184606720 22:45578637-45578659 CCCCACCCACCCAGTGGGACAGG - Intronic
1185274361 22:49943957-49943979 ACCCAGCCAGCCAGACGCACGGG + Intergenic
954444814 3:50540911-50540933 CCCCACCCTCCCTGACGCAGGGG + Intergenic
954577067 3:51682308-51682330 CCCACCCCACCCAGAGGCACAGG - Intronic
955208164 3:56916354-56916376 CCTCATCCACCCGGACTCACCGG + Intronic
961268735 3:125671653-125671675 CCGCACCTACCCACAAGCAGAGG - Intergenic
962418911 3:135210004-135210026 CATCACCCATCCAGAGGCACAGG - Intronic
964438135 3:156675087-156675109 GCGCCCCCACCCTGACGAACGGG - Exonic
965655770 3:170982892-170982914 CTGCACCCACCCACAGGCTCTGG + Intergenic
966890821 3:184406327-184406349 CCACCCCCACCCACACCCACTGG + Intronic
974069949 4:57114278-57114300 CCCCACCCCCCCACACACACAGG - Intergenic
986173802 5:5334762-5334784 CAGCTCCCTCCCAGCCGCACTGG + Intergenic
987303658 5:16618025-16618047 CCACACTCACCCAGAAGCACCGG - Intergenic
987327268 5:16823757-16823779 CCGCCCCCAGCCAGGCGCAGTGG - Intronic
997392015 5:133524835-133524857 GGGCACCCACTCAGATGCACTGG + Intronic
998617306 5:143754191-143754213 CCACACACACCCAGGCCCACAGG - Intergenic
1000850231 5:166330899-166330921 CCACACACACCCAAACACACAGG - Intergenic
1001441668 5:171748534-171748556 CTGCACTCACCAAGACTCACAGG + Intergenic
1002448302 5:179303352-179303374 CTGCAGCCACCCAAATGCACTGG + Intronic
1002568428 5:180127229-180127251 CGGCGCCCACCGAAACGCACCGG + Intronic
1002931907 6:1640695-1640717 CAGCAGCCAACCAGACACACGGG + Intronic
1003981555 6:11395015-11395037 CCCCACCCACCGAGAGGCCCTGG - Intergenic
1006800388 6:36756148-36756170 CTGCACACACACAGACGCACGGG + Intronic
1013013015 6:106136532-106136554 CCGCACCCGGCCTGACCCACAGG - Intergenic
1019050989 6:169183486-169183508 CAGCATTCACCCAGACTCACAGG - Intergenic
1019295725 7:272999-273021 ACACACACACCCAGACACACAGG + Intergenic
1019348341 7:541393-541415 CCCCACCCACCCCGACACCCAGG + Intergenic
1019522499 7:1467184-1467206 CAGCAGCCACCCAGTGGCACAGG + Intergenic
1021716476 7:23467511-23467533 CTGCTCCCTCCCAGTCGCACCGG - Intronic
1023038862 7:36154929-36154951 CCCCATCCACCCACACGAACGGG + Exonic
1023746869 7:43330129-43330151 CAGCACCCACCCAGGCTCAAGGG - Intronic
1023840680 7:44096001-44096023 CTGCAGCCACGCAGGCGCACAGG + Intergenic
1034440502 7:151083392-151083414 CCGCGCCCACCCCGCCGCCCAGG - Intronic
1035255401 7:157622693-157622715 CCACACCCACCCAGATGCGGGGG - Intronic
1035404175 7:158587548-158587570 CCCCACTCACCCAGACGCCCCGG + Exonic
1035436399 7:158863389-158863411 CCCCACCCACCCAGAAGCCCAGG + Intronic
1035459594 7:159030815-159030837 CCGCACCTGCCCAGGCTCACGGG - Intronic
1035469006 7:159097969-159097991 CAGCCCCCACACAGACCCACTGG + Intronic
1037839046 8:22231285-22231307 CCCCACCCACGCACACCCACAGG + Intronic
1038546065 8:28426624-28426646 CCCTCCCCACCCAGACCCACGGG + Intronic
1038963764 8:32549065-32549087 CCGCACCCTCCCAGAGTCCCGGG + Intronic
1040530181 8:48260574-48260596 CCGCTCCCACCCAGAAGCGGGGG - Intergenic
1040975877 8:53194256-53194278 CCTCACCCACACAGACCCACTGG - Intergenic
1041812345 8:61925774-61925796 CCGCACAAACCCTGACACACAGG - Intergenic
1046741420 8:117833216-117833238 CCCCACCCACCCAGACTTGCTGG - Intronic
1048191918 8:132297774-132297796 TCGCAGCCACCCAGACTCCCCGG + Intronic
1048964024 8:139602175-139602197 CCGCACCCACCCAGGGGACCAGG + Intronic
1049656956 8:143803268-143803290 CCGCCCAGACCCAGAGGCACAGG + Intronic
1053302692 9:36963080-36963102 CTGCACCCACACACAGGCACTGG - Intronic
1055743915 9:79421934-79421956 CCCCACCCACCCACAGGCCCTGG + Intergenic
1057702411 9:97373480-97373502 CCCCAGCCACCCTGACACACAGG - Intronic
1061133220 9:128719849-128719871 CCACCCCCACCCAGAGGCCCAGG - Intronic
1062065257 9:134523315-134523337 CCCCAGCCACCCAGTCGGACTGG + Intergenic
1062351933 9:136143627-136143649 CCTCACCCTCCCGGAAGCACAGG - Intergenic
1062367019 9:136215163-136215185 CTCGACCCACCCAGATGCACTGG - Exonic
1062677755 9:137757812-137757834 CCGCACCCACCCAGACGCACAGG - Intronic
1185747932 X:2586331-2586353 ACACACCCACCCACACACACGGG - Intergenic
1190108995 X:47577854-47577876 CCACCCCCACACACACGCACTGG - Intronic
1196889633 X:120279492-120279514 CCACACTCACCCATACACACAGG - Intronic