ID: 1062678463

View in Genome Browser
Species Human (GRCh38)
Location 9:137762679-137762701
Sequence GGCCAACGGTCCAGATGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062678463 Original CRISPR GGCCAACGGTCCAGATGTGC TGG Exonic
901423041 1:9163641-9163663 GTCCAAGGGGCCTGATGTGCAGG + Intergenic
901767761 1:11514749-11514771 GGCAAAAGGTCCAACTGTGCAGG - Intronic
901829399 1:11883008-11883030 GGCCCAGGCTCCAGACGTGCAGG - Intergenic
904061417 1:27713952-27713974 GGCTAACGTTCCAGGTCTGCTGG - Intergenic
908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG + Intronic
911090495 1:94013444-94013466 GGGCAGCAGTGCAGATGTGCTGG + Intronic
917054291 1:170962553-170962575 GGCCAACTGTCCAGAAGTACTGG + Intronic
1063301035 10:4849004-4849026 GCCCAGCCTTCCAGATGTGCAGG + Intergenic
1065261510 10:23928234-23928256 GGGCCACGGTCCAGATGGACTGG + Intronic
1067196388 10:44123212-44123234 AGCCAGCGGTCCAGATGAGCAGG + Intergenic
1070718947 10:78743289-78743311 GGCCAAGGGGCAGGATGTGCTGG - Intergenic
1072178445 10:92953579-92953601 GGCCAAACATCCAAATGTGCAGG + Intronic
1076370563 10:129950092-129950114 GGCCTCCTCTCCAGATGTGCAGG + Intronic
1080708433 11:34721637-34721659 TGCCAACTGTCCACATCTGCAGG - Intergenic
1084041627 11:66546167-66546189 GGCCAACGGACCAGCAGTGGAGG + Exonic
1089352286 11:117828490-117828512 GGCCAACGGCCCAGCTGGACTGG - Intronic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1105388157 13:19951400-19951422 GGCAAACGGGCCAGATGCGGTGG + Intergenic
1106040378 13:26084573-26084595 GGCCAAGGCCACAGATGTGCGGG + Intergenic
1106171636 13:27293588-27293610 GGCCAACCATCCAGATGTGTAGG - Intergenic
1107556131 13:41518055-41518077 GGCCAACAAGCCAGATGTGAGGG + Intergenic
1113457807 13:110461406-110461428 GCCCAATGGTGCAGATGTGCAGG - Intronic
1115643803 14:35352788-35352810 GACCGAGGGCCCAGATGTGCAGG + Intergenic
1122952307 14:105051803-105051825 GGCCTAGGGTCCAGCGGTGCTGG + Exonic
1123816377 15:23983507-23983529 GGCCACATGTCCAGATGAGCCGG + Intergenic
1131061344 15:89406551-89406573 GGTCTAGGGGCCAGATGTGCGGG - Intergenic
1142187252 16:88700494-88700516 GGTCGAAGGTCCAGATGTCCAGG - Intronic
1142411789 16:89920755-89920777 GGCCAAGGGACCAGGTTTGCAGG + Exonic
1146677276 17:34782170-34782192 GGCCTAACGTCCAGATGTGGTGG + Intergenic
1146842048 17:36163047-36163069 GGCCACGGGTCCAGGTGAGCCGG - Intergenic
1149475737 17:56959754-56959776 TGCCCATGGTGCAGATGTGCCGG - Intronic
1151891656 17:76954518-76954540 GGACAACAGTCCAGAAATGCTGG - Intergenic
1154300462 18:13186841-13186863 GGCCAAGGGCCCAGAGCTGCTGG + Intergenic
1159867207 18:73720210-73720232 GGCCAAGGATGCAGATGTTCTGG + Intergenic
1162873282 19:13601663-13601685 GGCCAAAGGACCAGGTGTGGTGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164667114 19:30047914-30047936 GCCCTAGGGTCCAGCTGTGCTGG + Intergenic
924975958 2:175557-175579 GGCTAACCCTCCAGCTGTGCAGG - Intergenic
929640147 2:43569966-43569988 GGCCCATGGTCCAGCTGTGGAGG - Intronic
931233312 2:60392383-60392405 GGCCAGTGCTCCAGAGGTGCTGG + Intergenic
932839398 2:75067746-75067768 GCCCTAAGGTCCAAATGTGCTGG + Intronic
936086144 2:109470713-109470735 AGCCAGAGGTGCAGATGTGCAGG + Intronic
937255560 2:120552958-120552980 GGCCAACGGCCCAGAATTTCTGG - Intergenic
1169755834 20:9042345-9042367 GGCCAGCTGCCCAAATGTGCAGG + Intergenic
1172082182 20:32350805-32350827 GGCCAGCAGTCCAGAGGGGCAGG - Intergenic
1175569773 20:60010015-60010037 AGTCAATGGGCCAGATGTGCAGG + Intronic
1180004937 21:45016180-45016202 TGCCAAGGGGCCAGATGTTCGGG + Intergenic
954373871 3:50184232-50184254 GGCCTGCAGTCCAGCTGTGCAGG + Intronic
967451325 3:189626647-189626669 GGCCATCAGTCCAGATGATCAGG + Intergenic
969289643 4:6230474-6230496 GGCCATGGGGCCACATGTGCAGG + Intergenic
975583353 4:75926715-75926737 GGGCAAAGGGCCAGATGTGCTGG + Intronic
977441479 4:97073390-97073412 GGCCACCGATCCACATGTGTTGG - Intergenic
988484495 5:31657384-31657406 AGCCAACGGTAGAGCTGTGCAGG - Intronic
994598484 5:101870497-101870519 GGCCAACTTTTCATATGTGCAGG - Intergenic
1003256943 6:4483052-4483074 GGGCAAGGGTGCAGATGTTCAGG - Intergenic
1007281091 6:40713084-40713106 TTCCAACACTCCAGATGTGCAGG - Intergenic
1019601995 7:1889438-1889460 GGCCTAGGGTCCAGAGCTGCTGG - Intronic
1022599786 7:31746920-31746942 GGCCAGAGGTCCAAATGTGTGGG + Intergenic
1024984078 7:55180833-55180855 AGCCAGCGTTCCTGATGTGCAGG + Intronic
1025060174 7:55798691-55798713 GGCTGACGGTCCAGTTGTCCTGG - Intronic
1029052478 7:97703405-97703427 GGCCAACAGTCCCTTTGTGCAGG + Intergenic
1029675097 7:102063200-102063222 GGCCATTAGTGCAGATGTGCGGG + Intronic
1031014576 7:116559122-116559144 GTACAACTGCCCAGATGTGCAGG - Exonic
1056715749 9:89026808-89026830 GTCCAAGGGCCCAGGTGTGCAGG - Intronic
1061969259 9:134035137-134035159 GGCCAACGTCCCTCATGTGCAGG + Intronic
1062150460 9:135015808-135015830 GACCAAGGGTCCAGATGTCCAGG + Intergenic
1062678463 9:137762679-137762701 GGCCAACGGTCCAGATGTGCTGG + Exonic