ID: 1062679699

View in Genome Browser
Species Human (GRCh38)
Location 9:137772207-137772229
Sequence TTGTGCTTGGAGAGGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062679699_1062679705 -10 Left 1062679699 9:137772207-137772229 CCAGCACACCTCTCCAAGCACAA 0: 1
1: 0
2: 2
3: 37
4: 236
Right 1062679705 9:137772220-137772242 CCAAGCACAAAAGGTTATAGGGG No data
1062679699_1062679707 19 Left 1062679699 9:137772207-137772229 CCAGCACACCTCTCCAAGCACAA 0: 1
1: 0
2: 2
3: 37
4: 236
Right 1062679707 9:137772249-137772271 TGAACGAGAAGAGAAAATACTGG No data
1062679699_1062679706 -6 Left 1062679699 9:137772207-137772229 CCAGCACACCTCTCCAAGCACAA 0: 1
1: 0
2: 2
3: 37
4: 236
Right 1062679706 9:137772224-137772246 GCACAAAAGGTTATAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062679699 Original CRISPR TTGTGCTTGGAGAGGTGTGC TGG (reversed) Intronic
900554631 1:3273730-3273752 GTGTGCATGGATAGGTGTGTGGG + Intronic
900575105 1:3379129-3379151 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575110 1:3379143-3379165 GTGTGCTGGGAGGGGTGTGCTGG - Intronic
900575125 1:3379185-3379207 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575130 1:3379199-3379221 GTGTGCTGGGAGAGGTGTGCTGG - Intronic
900575133 1:3379213-3379235 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575143 1:3379255-3379277 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575153 1:3379283-3379305 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575158 1:3379297-3379319 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575163 1:3379311-3379333 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575168 1:3379325-3379347 GTGTGCTGGGAGGGGTGTGCTGG - Intronic
900575173 1:3379339-3379361 GTGTGTTGGGAGAGGTGTGCTGG - Intronic
900575176 1:3379353-3379375 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575181 1:3379367-3379389 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575186 1:3379381-3379403 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575191 1:3379395-3379417 GTGTGCTGGGAGGGGTGTGCTGG - Intronic
900575196 1:3379409-3379431 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575201 1:3379423-3379445 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575206 1:3379437-3379459 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575222 1:3379493-3379515 GTGTGCTGGGAGGGGTGTGCTGG - Intronic
900575234 1:3379535-3379557 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575239 1:3379549-3379571 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575244 1:3379563-3379585 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575249 1:3379577-3379599 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575254 1:3379591-3379613 GTGTGCTGGGAGGGGTGTGCTGG - Intronic
900575259 1:3379605-3379627 GTGTGCTGGGAGGGGTGTGCTGG - Intronic
900575264 1:3379619-3379641 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575275 1:3379661-3379683 GTGTGCTGGGAGGGGTGTGCTGG - Intronic
900575287 1:3379703-3379725 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575299 1:3379745-3379767 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575309 1:3379773-3379795 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575314 1:3379787-3379809 GTGTGCTGGGAGGGGTGTGCTGG - Intronic
900575319 1:3379801-3379823 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575333 1:3379843-3379865 GTGTGCTGGGAGGGGTGTGCTGG - Intronic
900575338 1:3379857-3379879 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575343 1:3379871-3379893 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575348 1:3379885-3379907 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575353 1:3379899-3379921 GTGTGCTGGGAGGGGTGTGTTGG - Intronic
900575358 1:3379913-3379935 GTGTGCTGGGAGGGGTGTGCTGG - Intronic
900575363 1:3379927-3379949 GTGTGTTGGGAGGGGTGTGCTGG - Intronic
900575384 1:3379997-3380019 TTGCACTGGGAGGGGTGTGCTGG - Intronic
901237321 1:7674171-7674193 TTTTGCTTGGGCAGGTGTGTTGG - Intronic
901761023 1:11471717-11471739 CTGTGCTTGGAGAGCTGGGCTGG - Intergenic
902521323 1:17018649-17018671 TTGTCCTTGGAGAGATGGACAGG - Intergenic
903387328 1:22936025-22936047 TTGTGGTTGGAGAGGGGAGCGGG - Intergenic
903651079 1:24922729-24922751 TTGTTCTGAGAAAGGTGTGCGGG + Intronic
904032193 1:27540206-27540228 TTGTGCTTGGAGAGGTCCACAGG + Intronic
904936325 1:34132192-34132214 ATGTCCATGGAGGGGTGTGCTGG - Intronic
905183951 1:36182928-36182950 ATGGGGTTGGAGAGGTGGGCAGG + Intergenic
905398169 1:37681184-37681206 TGGGGCTAGGAGAGGGGTGCGGG - Intergenic
905464330 1:38141232-38141254 TTGTGGCTGGAGAGGAGTGCAGG - Intergenic
909294516 1:73930311-73930333 TTGTGGTTGAAGAGATGTACAGG - Intergenic
911173653 1:94796667-94796689 TTGTGCATGGAGAGGACTGCAGG - Intergenic
913273922 1:117120105-117120127 TGGAGCTTGGTGAGGTGGGCTGG - Intronic
913481501 1:119293654-119293676 TTGTGGTTGGAGGTGTGTGATGG - Intergenic
914828526 1:151153665-151153687 TTGTTCTTGGCCAGGTGTGGTGG + Intergenic
915108838 1:153550219-153550241 GTGTGCGTGGATAGGTGGGCAGG - Intergenic
917927504 1:179801362-179801384 TGGGGCTTGGAGAGCTGTGTGGG - Intronic
918904181 1:190471043-190471065 TTGTAATTGGATAGGTCTGCAGG + Intronic
919522329 1:198603497-198603519 GTGTGCATGCATAGGTGTGCAGG + Intergenic
921708683 1:218352034-218352056 TGGCCCTGGGAGAGGTGTGCAGG + Intronic
922915746 1:229256215-229256237 TTGGGCATGGTGAGGTGGGCAGG + Intergenic
924228919 1:241947006-241947028 TTGTGCTTGAAGAGCTTTCCAGG + Intergenic
1062826473 10:572481-572503 TTGTTTTTGGAGGGGTGTGATGG - Intronic
1063961138 10:11306208-11306230 CTCTGCTTGAAGAGGTGTTCTGG + Intronic
1064877488 10:20011274-20011296 TGGCTCATGGAGAGGTGTGCTGG + Intronic
1065660978 10:28003978-28004000 TTGGTCTTGGAGAGGTGGGATGG + Intergenic
1070401086 10:76054242-76054264 TGCTGCTTGGAGAGGTGTGAGGG - Intronic
1071471111 10:85984539-85984561 TGGAGCTGGGAGAGGTGGGCAGG + Intronic
1073275788 10:102310021-102310043 TTGGGCTTGAAGAGTTGTACTGG + Intronic
1074641485 10:115388199-115388221 TTGTACTAAGAGTGGTGTGCTGG + Intronic
1075921892 10:126220418-126220440 TTGTGCCTGGAGAGGAGAGCTGG + Intronic
1075963903 10:126593812-126593834 TTGTGCTTGGTGAGGAGTCAGGG + Intronic
1076314406 10:129530768-129530790 GTGTGCCTGGAGAGGCGTGGGGG - Intronic
1076690630 10:132222364-132222386 TCGTGCTTGCCCAGGTGTGCTGG - Intronic
1077508192 11:2941715-2941737 TTGGGCCTGGGGAGGTTTGCTGG + Intergenic
1078169568 11:8919240-8919262 CTGTCCTTGCAGAGGTGTGATGG - Intronic
1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG + Intergenic
1082877409 11:58002241-58002263 CTGTGCTTGGCCAGGTGTGGTGG - Intergenic
1084022207 11:66424491-66424513 GTGTGCTTGGAATGCTGTGCTGG - Exonic
1086999984 11:93408147-93408169 GTGTGTTTGGAGACTTGTGCTGG - Intronic
1088553394 11:111037367-111037389 TAGTGCTGGGAGAGGTATGGAGG + Intergenic
1090354385 11:126130098-126130120 TAGTGACTGGAGTGGTGTGCTGG + Intergenic
1090736248 11:129614266-129614288 TTGGCCTTGGAGAGGTTAGCTGG - Intergenic
1091148713 11:133305281-133305303 TCGTCCTTGGAGAGGGGTACAGG - Intronic
1093021930 12:14212021-14212043 TTGTGCTGGGAGAGGGGTGTGGG + Intergenic
1094148525 12:27256354-27256376 GTGTGGTTGGAGAGGTGAGTAGG - Intronic
1094395065 12:29996681-29996703 TTGGACTTTGAGAGGTGAGCAGG - Intergenic
1097204833 12:57311901-57311923 TTGTGGTTGGAGAACTGTGTAGG - Intronic
1097951155 12:65429464-65429486 ATGTGTTTGGAGAGGTAGGCAGG + Intronic
1098324930 12:69291263-69291285 TTCTACTTGAAGAGGTTTGCAGG - Intergenic
1099231615 12:80032429-80032451 TTCTGCTTGGAAACATGTGCTGG - Intergenic
1101073039 12:101096662-101096684 CTCAGCTTGGGGAGGTGTGCAGG - Intronic
1101802814 12:108036993-108037015 CTGTGGATGGAGAGGTGTGTGGG + Intergenic
1103354737 12:120311425-120311447 TGGTGATTGGAGAGGTGAGAAGG + Intronic
1104040736 12:125128662-125128684 CTGTGCTAGGAGGGGTGAGCAGG + Intronic
1105797386 13:23868829-23868851 TTGTGCTAGGTGAGGTGTTACGG - Intronic
1105946370 13:25193239-25193261 TTGAGCTTGGAGAGATGAACTGG + Intergenic
1106141160 13:27013265-27013287 GTTTGCTTGTAGAGGTGGGCTGG + Intergenic
1111139796 13:84101499-84101521 TTGTGCTTGGCAAGGTGTTGTGG + Intergenic
1112652069 13:101410272-101410294 CAGTGATGGGAGAGGTGTGCAGG - Intronic
1118666684 14:68077666-68077688 TTGTGCTTGGCCAGGAGTGGTGG + Intronic
1118734332 14:68691033-68691055 TTGTGCTTTCAGAGGTCTGGGGG - Intronic
1119014088 14:71031332-71031354 AAGTGCTGGGACAGGTGTGCAGG + Intronic
1122508509 14:102247631-102247653 TTGTGATTGGAGAGTTGTGATGG - Intronic
1124005686 15:25793839-25793861 TTGGGCTTGCAGAGGTCTGGGGG - Intronic
1124612123 15:31215926-31215948 TTGTGCTTGGAAAGGGGCCCGGG - Intergenic
1125074204 15:35594011-35594033 ATGAGCTTCAAGAGGTGTGCAGG - Intergenic
1125770133 15:42159689-42159711 GTGTGGTTGGAGAGTTGTGCTGG - Exonic
1129691018 15:77713512-77713534 TTGGGCGGGGAGGGGTGTGCTGG + Intronic
1132025566 15:98401873-98401895 CTGTGCTTGGGGAGGTGGCCAGG - Intergenic
1136104212 16:28017657-28017679 TTGTGCATGTTGATGTGTGCAGG - Intronic
1136481146 16:30542706-30542728 TTGTGATTGGAGAGTTGTAATGG + Intronic
1137559436 16:49493302-49493324 AGGTGCCTGGAGAGGTCTGCAGG - Intronic
1138623033 16:58226901-58226923 TTTTGCTTGGGGAAGTTTGCAGG - Intergenic
1139650277 16:68358927-68358949 TGGTGCTGAGGGAGGTGTGCGGG + Exonic
1141646041 16:85368304-85368326 TTGTGCTGGGAGAGTTCTGAAGG + Intergenic
1146063910 17:29620992-29621014 TGGTGCATGGAGAGGTGGGAGGG + Intronic
1148832188 17:50440830-50440852 TGGTGCCAGGAGAGGTGAGCTGG + Intronic
1150291521 17:63985079-63985101 TTGTGCTGGGAGCTGTGTGTGGG + Intergenic
1152503611 17:80730717-80730739 TGGTGCTTGGAGAGCGGTGCTGG + Intronic
1153975611 18:10266108-10266130 TGGTGCTGGGAGAGGTTTGTTGG + Intergenic
1154003835 18:10508599-10508621 TTGTTCTTGGAGAACTGTGTAGG - Intergenic
1156266540 18:35494038-35494060 GTTGGCTTGGAGAGGTTTGCTGG - Intronic
1158586589 18:58743085-58743107 TTGTTCTTGGCCAGGTGTGGTGG + Intronic
1160867506 19:1262380-1262402 TGGTGCTGGGAGAGGAGGGCGGG - Intronic
1161373937 19:3929318-3929340 TTGGGCTGGGAGTGGTGTGAGGG - Intergenic
1162408840 19:10492303-10492325 TCCTGCTTGGTGAGGTGTGGGGG - Intronic
1162973377 19:14194658-14194680 TTGGGCTTGGTGAGCTGTGGGGG + Intronic
1163056851 19:14726304-14726326 TTGTGATGGGAGAGGTGGCCTGG + Intronic
1163765573 19:19161478-19161500 GTGTGTTTGGAGAGCTGTGTGGG - Intronic
1164708713 19:30339443-30339465 TACTGCTGGGAAAGGTGTGCAGG + Intronic
1165334316 19:35158363-35158385 TTGGGGTTGGAGAGGTGGGCTGG - Exonic
1165723800 19:38098691-38098713 TTGTGCTTGGTGAGGACTTCTGG - Intronic
1166380140 19:42351370-42351392 ATGTGCCTGGGGATGTGTGCTGG + Intronic
925179471 2:1807548-1807570 TGGTGCTTGAAGAGGTTTGCAGG + Intronic
925734963 2:6955913-6955935 GTGTGGTTGGAGAGGTGGACAGG - Intronic
928112492 2:28521990-28522012 CTGTGCATGGAGTGGTGGGCTGG - Intronic
929609574 2:43260219-43260241 TTGTTCTTGGCCAGGTGTGGTGG - Intronic
937288901 2:120770181-120770203 TTGTGTTTGGAGCTGGGTGCTGG - Intronic
944489301 2:200241751-200241773 CTGTGCTTGGAGAGGTGCAGTGG - Intergenic
946759203 2:222976538-222976560 TTGTTCTTGGTAAGATGTGCAGG - Intergenic
946832156 2:223737955-223737977 TTGGGATGGGAGAGGTCTGCAGG - Intergenic
947905316 2:233757128-233757150 ATGAGCTTGGACAGGTGGGCTGG + Intronic
948754195 2:240149745-240149767 TTGTGCTTGGCCAGCTGTGAAGG - Intergenic
948921766 2:241069204-241069226 TTGTGCTGGGACAGCTGTCCAGG + Intronic
1168958764 20:1853783-1853805 TGGAGCTGGGAGAGGTGAGCAGG - Intergenic
1169332234 20:4724990-4725012 TTTTGGTTGGAGAGGGGCGCAGG + Exonic
1170447079 20:16439427-16439449 ATGAGGTTGGAGAGGTGGGCAGG - Intronic
1170459417 20:16563250-16563272 TTGTGCTTGGATGAATGTGCGGG + Intronic
1171283505 20:23920166-23920188 TCGTGCTTGTAGATGTGGGCTGG - Intergenic
1171458216 20:25283613-25283635 TTGCCCCTGGAGAGCTGTGCAGG + Intronic
1172600346 20:36178685-36178707 TTGTGTTTGGGGAGGTGGGTGGG + Intronic
1173784508 20:45782937-45782959 TTGAGGTTGGAGAGGTAGGCAGG - Intronic
1175605325 20:60308011-60308033 TTCTAGTTGGACAGGTGTGCAGG + Intergenic
1176343693 21:5721390-5721412 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
1176501134 21:7603066-7603088 CTGTCCTTGGAGGGGTATGCAGG + Intergenic
1176538014 21:8119459-8119481 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
1176851002 21:13913984-13914006 TTGTGCTTGGCCAGGCGTGGTGG - Intergenic
1182620735 22:31617123-31617145 TGTTGCCTGGAGAGGTGGGCAGG + Intronic
1184978321 22:48078868-48078890 TTGTGCTTGGAGGGTTTTGTGGG + Intergenic
1185123116 22:48985459-48985481 TTGTGTGTGGTGTGGTGTGCGGG + Intergenic
1203242961 22_KI270733v1_random:35814-35836 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
950261387 3:11545160-11545182 GGGAGCTTGGAGGGGTGTGCAGG + Intronic
955584303 3:60459871-60459893 TTGGGGTTGGGGAGGTGAGCAGG + Intronic
956625603 3:71263519-71263541 TTGTGATGTGCGAGGTGTGCAGG + Intronic
958672622 3:97223774-97223796 ATGTGGTTGGAGAGGTAGGCAGG + Intronic
960051247 3:113241355-113241377 TTGTGTGTGCAGATGTGTGCAGG - Intronic
962060932 3:131926678-131926700 TTTTGCTTAGTGAGGTTTGCAGG - Intronic
962437138 3:135377603-135377625 TGGTGCTTGGAGAGGTGGGCAGG - Intergenic
962603773 3:137014824-137014846 TTGCTCTTGGAGATGTTTGCAGG - Intergenic
962816463 3:139005567-139005589 TAGAGGTTGGAGAGGTGAGCTGG + Exonic
962817959 3:139019963-139019985 TAGAGGTTGGAGAGGTGAGCTGG + Exonic
962820458 3:139043922-139043944 TAGAGGTTGGAGAGGTGAGCTGG + Exonic
963112242 3:141697359-141697381 TTGTGATTGGAGAGTTGTAATGG + Intergenic
964633413 3:158836438-158836460 ATGTGCTAAGAGAGGTGTGGAGG + Intergenic
965566864 3:170128941-170128963 TTGGGATTGGAGAGGACTGCAGG + Exonic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967417820 3:189238651-189238673 CTGTGCTAGGAGAGATGTGAAGG + Intronic
968138748 3:196238728-196238750 TTGTGCCTGGAGAGATTTGCTGG + Exonic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
969301521 4:6300074-6300096 TTTTGCTGGGAGAGTGGTGCTGG + Intronic
970723119 4:19010810-19010832 ATGTGCTTGGAGAGATTTCCAGG + Intergenic
972632357 4:40853372-40853394 TTGTGCTGGAAGAGGTGGGTGGG - Intronic
974894266 4:67919864-67919886 GTGAGCTTGGAGAGGTAAGCAGG + Intronic
977833738 4:101622861-101622883 TTCTTCTTGGACAGGTGTGGTGG - Intronic
986194339 5:5524363-5524385 ATGTGCTTGTAGACGTGTGTGGG - Intergenic
986301455 5:6481477-6481499 TTCTGCAGGGAGAGGTGTGCGGG - Intronic
987160806 5:15140195-15140217 TTGATCTTGCAGAGGTGTGCTGG - Intergenic
990695341 5:58409980-58410002 TTAGGCTTGGAGAAGAGTGCTGG - Intergenic
991126499 5:63075611-63075633 TTGTGACAGGAGAGGTGTGTTGG - Intergenic
993532668 5:89043317-89043339 TGGTGATTGGAGGGGTTTGCTGG + Intergenic
993561670 5:89417925-89417947 TTGTCCAGGCAGAGGTGTGCTGG + Intergenic
993930740 5:93935555-93935577 ATGAGGTTGGAGAGGTGGGCAGG + Intronic
994009936 5:94889930-94889952 TTTTTCTTGGAGTGGTTTGCTGG - Intronic
998731403 5:145081556-145081578 TTATGCTTCCAGAGGTGTGGAGG + Intergenic
1000794423 5:165647212-165647234 TTGTGCTTGGTGTGGTGAGGAGG - Intergenic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1001097210 5:168784900-168784922 GTATGTTTGCAGAGGTGTGCAGG - Intronic
1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG + Intergenic
1005348350 6:24911167-24911189 TTGTGCTGGGAGGGGAGGGCGGG + Intronic
1005718819 6:28580795-28580817 TTGTGCTTGGGGGGGTGGGGGGG - Intronic
1005912766 6:30325939-30325961 GTATGCTGGGAGAGGTGTGAGGG - Intergenic
1010831816 6:80540582-80540604 TTTTGCTTGGAGTGGTGTGATGG + Intergenic
1014036227 6:116769588-116769610 TTGAGCTTGGAGAGGTAGGCAGG - Intergenic
1015927288 6:138323047-138323069 TTTTGCTTGTAGAGGAGTGATGG + Intronic
1017907037 6:158764009-158764031 AGGTCCTTGGAGATGTGTGCAGG - Intronic
1020632656 7:10658053-10658075 TTGTGCTTAGAAAAGTGTGTAGG - Intergenic
1022190104 7:28009397-28009419 TTGTGTCTGGAGGGGTGTACTGG - Intronic
1023071633 7:36440527-36440549 TTGTGCTTGCAGAGGTATGTAGG + Intronic
1025072806 7:55915737-55915759 GTGAGCTTGGAGAAGTGAGCAGG + Intronic
1025823787 7:64994895-64994917 TTGTGCTGGAAGGGGTCTGCTGG - Intronic
1026364215 7:69631252-69631274 TTGTGCTTGCACAGCTGTTCTGG + Intronic
1026381160 7:69800754-69800776 TTGACCCTGGAGAGGTGGGCAGG - Intronic
1027559919 7:79716892-79716914 GTGTACTTAGAGTGGTGTGCTGG - Intergenic
1027696420 7:81416702-81416724 TTGGGCTGGGAGAGGAGTGGTGG - Intergenic
1029481012 7:100812972-100812994 GTGAGTTTGGCGAGGTGTGCCGG - Exonic
1029737221 7:102471669-102471691 GTCTGCTTGGAGAAGTGTCCCGG - Intronic
1030283851 7:107804659-107804681 ATGAGGTTGGAGAGTTGTGCAGG - Intergenic
1032070585 7:128803696-128803718 TGGTGCTTAGAGACATGTGCTGG + Intronic
1034420705 7:150989150-150989172 TTGACCTTGGAGGGCTGTGCTGG - Intergenic
1034900155 7:154903325-154903347 AGGTGCCTGGAGAGGTGAGCAGG + Intergenic
1035042183 7:155937020-155937042 TTATGCTTGGAGAGCAGTGCTGG + Intergenic
1036032941 8:4992607-4992629 TTGTGCCCTGTGAGGTGTGCTGG - Intronic
1036452316 8:8879740-8879762 TTGGGCTTGGGGAGCTGTGTTGG - Intronic
1036786620 8:11692272-11692294 CTGTGCTTGAAAAGGTGTGATGG - Intronic
1038370676 8:26986683-26986705 TTGGGCTTGGAGTGGAGTGAAGG - Intergenic
1042157480 8:65861085-65861107 TTTTGTTTGATGAGGTGTGCAGG + Intergenic
1042722262 8:71839400-71839422 TTGGGGTTGGAGAAGTGGGCAGG - Intronic
1042889413 8:73590663-73590685 GTGTGCTTGGTAAGGTGTCCAGG - Intronic
1042937995 8:74079901-74079923 ATGTGCATGCAGATGTGTGCAGG + Intergenic
1043996128 8:86818846-86818868 TTGTGTTTGGTCAGGTGTGGTGG + Intergenic
1047215184 8:122870325-122870347 TTGGGCTTAGAAAGGTGAGCTGG + Intronic
1047496527 8:125412856-125412878 TTGGGGTTGGAGGGGTGGGCAGG - Intergenic
1048284074 8:133127935-133127957 TTGTGCTTGGACAGATGAGTAGG - Intronic
1049392954 8:142381471-142381493 TTGTGCTTGGTGGGGTGGGGGGG - Intronic
1049487885 8:142875930-142875952 TTGTCCTGGGAGGGGTGTCCCGG - Intronic
1049492659 8:142913503-142913525 TTGTCCTGGGAGGGGTGTCCCGG - Intronic
1049785040 8:144446485-144446507 TTGTGACTGCACAGGTGTGCAGG - Intergenic
1050415970 9:5418355-5418377 TTGTGGCTGGAGAGGGCTGCAGG - Intronic
1051226482 9:14904772-14904794 AAGAGGTTGGAGAGGTGTGCAGG - Intronic
1052834840 9:33242502-33242524 TGGGGCATGGAGAGGTGTACTGG + Intronic
1052876380 9:33569744-33569766 TTGTGCTTGGCCAGGTGTGGTGG + Intronic
1053499632 9:38574602-38574624 TTGTGCTTGGCCAGGTGTGGTGG - Intronic
1054915626 9:70492952-70492974 TTGTGGTTGGAACGGTATGCAGG - Intergenic
1055326572 9:75136728-75136750 GTGTGCTTGGTGAGGCCTGCTGG + Intronic
1056587226 9:87936732-87936754 TTGTGCTTGGCCAGGTGTGGTGG - Intergenic
1056609650 9:88116211-88116233 TTGTGCTTGGCCAGGTGTGGTGG + Intergenic
1057895112 9:98903104-98903126 GTGAGCCTGGAGAGGTGAGCAGG - Intergenic
1058113452 9:101057003-101057025 TTGTGCCTGGAAAGCTGGGCTGG - Intronic
1059945343 9:119403855-119403877 GTGTGGTGAGAGAGGTGTGCAGG + Intergenic
1060072056 9:120558560-120558582 ATGTGGTTGGAGAGGTGGACAGG - Intronic
1060611803 9:124973408-124973430 ATGTGCTTGGCCAGGTGTGGTGG + Intronic
1061070815 9:128309557-128309579 TTGGGGCTGGAGAGGGGTGCGGG - Exonic
1062391119 9:136334234-136334256 AGGTGCTGGCAGAGGTGTGCTGG + Intronic
1062479649 9:136745397-136745419 GTGTGCTTGGAGGGGTCTCCTGG - Intronic
1062679699 9:137772207-137772229 TTGTGCTTGGAGAGGTGTGCTGG - Intronic
1203459287 Un_GL000220v1:18897-18919 CTGTCCTTGGAGGGGTATGCAGG - Intergenic
1186672438 X:11781171-11781193 TAGTGCTTGGAAAGGTGGCCAGG - Intergenic
1189187934 X:39070205-39070227 GTGTGGATGGAGAGGTGTGGAGG - Intergenic
1189368354 X:40407494-40407516 TTGTGCCTGGTCAGGTGTGGTGG - Intergenic
1189386178 X:40538886-40538908 TGGTTCTTGGAGAGGTGAGTTGG - Intergenic
1192197046 X:69035351-69035373 ATGTGGTTGGAGAGGTACGCAGG - Intergenic
1192544222 X:71999374-71999396 TTTTGCTTAGAGTGGTGTGCTGG + Intergenic
1192694403 X:73399321-73399343 TGGTGCTAGGAGAGGGGTGATGG - Intergenic
1192981689 X:76350990-76351012 TTGTGCTTGGGAATGTCTGCAGG - Intergenic
1193699491 X:84744138-84744160 TTGTGATTGGAGAGTTGTAATGG - Intergenic
1194168342 X:90550860-90550882 TTGTGCATGTAAAGGTGTTCAGG - Intergenic
1195765277 X:108289832-108289854 TTCTGCTTCCAGTGGTGTGCTGG + Intronic
1195841474 X:109180618-109180640 AGGTGTTTGGAGATGTGTGCTGG - Intergenic
1196185950 X:112745141-112745163 ATGAGGTTGGAGAGGTGAGCAGG - Intergenic
1196881367 X:120200902-120200924 TGGAGCTTGGAGAGGGGGGCTGG - Intergenic
1198763805 X:140061177-140061199 TTGAGTTTGGAGAGGTGAGTAGG + Intergenic
1199509949 X:148610687-148610709 ATGTGCCTGGAGAGTTGTGGGGG + Intronic
1200166278 X:154037770-154037792 TTGTGCTGGGTGTGGAGTGCAGG + Intronic
1200514589 Y:4128642-4128664 TTGTGCATGTAAAGGTGTTCAGG - Intergenic