ID: 1062679845

View in Genome Browser
Species Human (GRCh38)
Location 9:137773264-137773286
Sequence GGTTCAGGACCAGCGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 208}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062679845_1062679851 2 Left 1062679845 9:137773264-137773286 CCTGCAGCCGCTGGTCCTGAACC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1062679851 9:137773289-137773311 GGAGTCACTGCAGAAGCATTTGG No data
1062679845_1062679855 16 Left 1062679845 9:137773264-137773286 CCTGCAGCCGCTGGTCCTGAACC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1062679855 9:137773303-137773325 AGCATTTGGTGGTGGTGGTGTGG No data
1062679845_1062679858 21 Left 1062679845 9:137773264-137773286 CCTGCAGCCGCTGGTCCTGAACC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1062679858 9:137773308-137773330 TTGGTGGTGGTGGTGTGGAGGGG No data
1062679845_1062679853 8 Left 1062679845 9:137773264-137773286 CCTGCAGCCGCTGGTCCTGAACC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1062679853 9:137773295-137773317 ACTGCAGAAGCATTTGGTGGTGG No data
1062679845_1062679854 11 Left 1062679845 9:137773264-137773286 CCTGCAGCCGCTGGTCCTGAACC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1062679854 9:137773298-137773320 GCAGAAGCATTTGGTGGTGGTGG No data
1062679845_1062679852 5 Left 1062679845 9:137773264-137773286 CCTGCAGCCGCTGGTCCTGAACC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1062679852 9:137773292-137773314 GTCACTGCAGAAGCATTTGGTGG No data
1062679845_1062679857 20 Left 1062679845 9:137773264-137773286 CCTGCAGCCGCTGGTCCTGAACC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1062679857 9:137773307-137773329 TTTGGTGGTGGTGGTGTGGAGGG No data
1062679845_1062679859 22 Left 1062679845 9:137773264-137773286 CCTGCAGCCGCTGGTCCTGAACC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1062679859 9:137773309-137773331 TGGTGGTGGTGGTGTGGAGGGGG No data
1062679845_1062679856 19 Left 1062679845 9:137773264-137773286 CCTGCAGCCGCTGGTCCTGAACC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1062679856 9:137773306-137773328 ATTTGGTGGTGGTGGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062679845 Original CRISPR GGTTCAGGACCAGCGGCTGC AGG (reversed) Intronic
900160387 1:1220491-1220513 GGCTCAGGAAGAGCAGCTGCCGG - Intronic
900166898 1:1247462-1247484 CGGCCAGGACCAGCGGCTGGAGG - Intergenic
900352497 1:2242172-2242194 GGTTCACCACTAGCGGCTGGGGG - Intronic
901627164 1:10630894-10630916 TGTTCAGGTCCAGTGGCTGCCGG + Intergenic
901748252 1:11388891-11388913 GTTTCATGATCAGAGGCTGCCGG - Intergenic
902097809 1:13960850-13960872 GCTTCAGGACCTGGGGCTTCAGG + Intergenic
902227204 1:15003909-15003931 TGTTCAGCTCCAGGGGCTGCAGG + Intronic
902386388 1:16078274-16078296 GGCTCAGGACTGGGGGCTGCTGG + Intergenic
902403751 1:16172191-16172213 GTCTCAGGACCAGCTGCTCCCGG - Intergenic
903115649 1:21176631-21176653 GGGCCAGCACCACCGGCTGCCGG + Intronic
903539053 1:24086576-24086598 GGCTCAGGACCTGAAGCTGCAGG - Intronic
905206153 1:36343921-36343943 GGTCAAGGACCAGCAGCTTCCGG + Exonic
907905646 1:58782401-58782423 CGTGCAGCACCCGCGGCTGCAGG - Exonic
911143621 1:94531928-94531950 GCTTCTGGACCAGCTGCAGCAGG - Intronic
912953370 1:114135786-114135808 GGGTGAGGGCCAGGGGCTGCAGG - Intronic
914814905 1:151056192-151056214 GGTTAAGGAGCAGTGGCTGGTGG + Intronic
915107353 1:153542717-153542739 GGTTCAAGGCCAGTGGCTCCAGG - Intergenic
1065961664 10:30738783-30738805 GGGACAGGATCAGCTGCTGCAGG + Intergenic
1067478440 10:46580800-46580822 GGTTGAGCACCAGGGGCTGGAGG - Intronic
1067527813 10:47048811-47048833 GGTCCAGGGCCAGAGGCTGAAGG + Intergenic
1067616297 10:47761001-47761023 GGTTGAGCACCAGGGGCTGGAGG + Intergenic
1069949209 10:72007877-72007899 GGTCCTCGGCCAGCGGCTGCAGG - Exonic
1069950338 10:72014351-72014373 GTAGCAGGACCAGCAGCTGCAGG + Intergenic
1072716336 10:97755267-97755289 GGTTCAGGAGCAGAGGCCGCAGG - Intronic
1073562703 10:104510423-104510445 GGTTCTGGCCAAGAGGCTGCTGG + Intergenic
1075689592 10:124386396-124386418 GGGTCAGGCGCAGCTGCTGCAGG + Intergenic
1076109721 10:127851278-127851300 TGTGCAGGAGCAGCGTCTGCGGG + Intergenic
1077064861 11:636682-636704 GGCTGAGGGCCAGAGGCTGCGGG + Intergenic
1077146673 11:1049596-1049618 GGTTCAGGGCCAGCAGGTGCTGG - Intergenic
1077227353 11:1444269-1444291 AGGTCAGGACCAGCAGCTGGGGG - Intronic
1078562019 11:12380375-12380397 GGTTATGGACGAGGGGCTGCTGG + Intronic
1080753073 11:35168510-35168532 GGTTATGGACCAGGAGCTGCAGG + Intronic
1081871674 11:46385555-46385577 GGTTGAGGGCCCGCGGCTGCAGG + Exonic
1083328906 11:61888059-61888081 GGATGAGGCCCAGCCGCTGCTGG - Intronic
1083369331 11:62165918-62165940 CGCTCGGGACCAGGGGCTGCTGG + Intergenic
1083448525 11:62727054-62727076 GGATCTGGCGCAGCGGCTGCAGG - Exonic
1084188735 11:67489260-67489282 GGTACAGGACCACATGCTGCGGG - Exonic
1084693349 11:70739523-70739545 GGATCATGACCTGTGGCTGCTGG + Intronic
1084771923 11:71348902-71348924 GGCTCAGAACCAGTGGCTGAGGG + Intergenic
1086411857 11:86551788-86551810 GGCTCAGGGCCAAGGGCTGCTGG + Intronic
1087729737 11:101765223-101765245 GCTTCTGGAGCAGAGGCTGCTGG - Intronic
1088613971 11:111604012-111604034 GGTTCAGGACCAGCAGGGGAAGG - Intronic
1088750105 11:112836014-112836036 GGTTCAGGCCCAGGAGCTGAAGG - Intergenic
1089600482 11:119611445-119611467 CGTTCAGGGCCAGCTGCTGAGGG + Intergenic
1089681943 11:120123507-120123529 GGTTCAGTCCCAGCCACTGCTGG + Intronic
1091396940 12:159290-159312 GGAGCAGGACCAGAGGCTCCCGG - Intronic
1091801470 12:3327264-3327286 GCTTCTGGACCAGCGGCTCATGG + Intergenic
1091807287 12:3365806-3365828 GGTTAAGGACCCCCTGCTGCGGG + Intergenic
1091973781 12:4809589-4809611 GCTTCGGTACCAGCGGCAGCCGG + Exonic
1092040144 12:5377030-5377052 GCTTCAGGCCCAGTGGCTCCAGG + Intergenic
1092365441 12:7873094-7873116 GGTCCAGCCCCGGCGGCTGCTGG + Intronic
1095096644 12:38152777-38152799 GGTTCTGGCACAGAGGCTGCTGG - Intergenic
1096660416 12:53120758-53120780 GGTTGGGGACAAGAGGCTGCAGG - Intronic
1100679931 12:96907726-96907748 GGTTTAGGGACAGCGGCTACAGG - Intronic
1102243713 12:111341865-111341887 GGCTCAGGTCCTGGGGCTGCAGG - Exonic
1102948474 12:117011192-117011214 GGCTGAGGGCCAGGGGCTGCTGG + Intronic
1103913339 12:124363714-124363736 GCTTCAGGTCCAGTGGCTTCTGG + Exonic
1105535194 13:21259360-21259382 GGTTAGGGAGCAGCGGCTGGGGG + Intergenic
1106099938 13:26685704-26685726 GGTGCAGGAGCAGCGGGAGCAGG + Exonic
1106304379 13:28496388-28496410 GGCTCAGGTCCTGCGGCTCCAGG - Intergenic
1108285810 13:48906938-48906960 GGGCCAGGACCTGCGGCTGTAGG - Intergenic
1113634660 13:111911325-111911347 GCGTCAGGACCAGTGTCTGCAGG - Intergenic
1113941945 13:114023070-114023092 GGCTCAGGCCCTACGGCTGCTGG - Intronic
1114453140 14:22839226-22839248 GGTTGAGGAGCAGCTGCTTCAGG - Intronic
1117062123 14:51973693-51973715 GCTTCAGGCCCAGGGGCTGCAGG + Intronic
1118326758 14:64786532-64786554 GCTTCTGGGCCAGCGGCTGGAGG - Exonic
1119400913 14:74361626-74361648 TGTTCAAGACCAGAGGCAGCTGG - Intergenic
1121775136 14:96585322-96585344 GCCCCAGGCCCAGCGGCTGCAGG + Intergenic
1122871534 14:104641079-104641101 GGGTCAGGAGCAGAGGGTGCTGG + Intergenic
1123470419 15:20547410-20547432 GGTTCAGAAACAGAGGCTGATGG - Intergenic
1123647638 15:22453290-22453312 GGTTCAGAAACAGAGGCTGATGG + Intergenic
1123730720 15:23142387-23142409 GGTTCAGAAACAGAGGCTGATGG - Intergenic
1123748859 15:23339813-23339835 GGTTCAGAAACAGAGGCTGATGG - Intergenic
1123761953 15:23440256-23440278 GGAGCAGGACGAGAGGCTGCGGG - Exonic
1123762027 15:23440712-23440734 GGAGCAGGACGAGAGGCTGCGGG - Exonic
1124281231 15:28363696-28363718 GGTTCAGAAACAGAGGCTGATGG - Intergenic
1124301472 15:28547925-28547947 GGTTCAGAAACAGAGGCTGATGG + Intergenic
1125565680 15:40676871-40676893 GGATCCGGCCCAGGGGCTGCAGG + Intergenic
1128730117 15:70015199-70015221 GGTTCAGGAAGAGAGGCTGGAGG + Intergenic
1129136385 15:73555971-73555993 GATTCAGGACCAGGTGCTGGAGG - Intronic
1130956382 15:88630149-88630171 GGGGCAGGTCCAGAGGCTGCGGG - Exonic
1132586848 16:709299-709321 GGATGAGGACCAGAGGCTGCTGG + Intronic
1136631882 16:31493669-31493691 GCTTCAGGACCAGCCGGAGCCGG + Exonic
1137279125 16:46960242-46960264 GGTTCTGGACCAGCAGCTTCAGG + Intronic
1137339502 16:47586317-47586339 GGTTCAGCAGCAGCTGCCGCTGG - Intronic
1138067666 16:53958867-53958889 GGTTCAGCTCCAGCAGCTGATGG + Intronic
1139511733 16:67431697-67431719 GGTTCACTACCTGCCGCTGCGGG + Intronic
1140891294 16:79287435-79287457 GCTTGAGGACCAGCAGCTGGCGG + Intergenic
1141686399 16:85572657-85572679 GGTTCCGGAGCAGCCCCTGCTGG - Intergenic
1141688453 16:85583309-85583331 GGAACAGGACCAGGGGCTGCTGG - Intergenic
1141737106 16:85861050-85861072 GGTTGGGGAGCAGAGGCTGCAGG + Intergenic
1141815219 16:86404946-86404968 GCATCAGGACCAGCGGGGGCAGG - Intergenic
1142356738 16:89604938-89604960 GGGTGGGGAGCAGCGGCTGCGGG + Intergenic
1142878336 17:2865981-2866003 GCTTCAGGAGCATGGGCTGCTGG - Intronic
1145062960 17:19743905-19743927 GATGCAGGACCAAGGGCTGCTGG + Intronic
1146595058 17:34161471-34161493 GGTTCAGGTCAATCGGCAGCTGG - Intronic
1147518905 17:41149492-41149514 GCTGCAGGACCACCTGCTGCAGG - Exonic
1147522714 17:41189924-41189946 GCTGCAGGACCACCTGCTGCAGG + Exonic
1147526251 17:41226692-41226714 GCTGCAGGACCACCTGCTGCAGG + Exonic
1147528414 17:41249758-41249780 GCTGCAGGACCACCTGCTGCAGG + Exonic
1147530424 17:41271348-41271370 GCTGCAGGACCACCTGCTGCAGG + Intergenic
1147686528 17:42289423-42289445 GATCCAGGCCCAGCAGCTGCAGG + Exonic
1147943480 17:44066509-44066531 GTGCCAGGAGCAGCGGCTGCAGG - Exonic
1147947528 17:44088443-44088465 GTTGCATGACCAGCTGCTGCAGG + Exonic
1151016718 17:70562928-70562950 GGTTCAGTACCCACGGCTTCAGG - Intergenic
1151475771 17:74343718-74343740 GGCACAGCACCAGCAGCTGCTGG + Intronic
1152352196 17:79790215-79790237 CGTTCAGGACCCGAGGCTGCGGG + Intergenic
1152709954 17:81866459-81866481 GGGTCTGGACCAGCTTCTGCAGG + Intergenic
1153688701 18:7569192-7569214 GGTCCAGGACCATTGGCTGCTGG + Intronic
1156340044 18:36202534-36202556 GGGTCAGGGCCAGAGGCAGCTGG + Intronic
1160805429 19:990404-990426 GGCTGAGGACCTGCGGCTGCTGG - Intronic
1160841966 19:1150312-1150334 GGGTCAGCACCTGCGGCTTCGGG + Intronic
1161455812 19:4369306-4369328 TGCTCAGAGCCAGCGGCTGCCGG + Intronic
1162463785 19:10829256-10829278 GCTTCCGGACCTGTGGCTGCTGG - Exonic
1164590668 19:29505156-29505178 GGCTCAGGCCCAGGAGCTGCAGG - Intergenic
1164727442 19:30475776-30475798 GCTTTAGGACCAGCCGCTCCTGG + Intronic
1166939840 19:46355926-46355948 GGGTAAGGAGCAGGGGCTGCAGG + Intronic
1167326803 19:48831694-48831716 GGTTCAGCTCCAGCAGCTGGCGG + Exonic
1168115407 19:54219487-54219509 GGTGCAGGAACAAGGGCTGCAGG - Intronic
1168124727 19:54277167-54277189 GGTGCAGGAACAAGGGCTGCAGG - Intronic
1168177260 19:54634381-54634403 GGTGCAGGAACAAGGGCTGCAGG + Intronic
1202638250 1_KI270706v1_random:60325-60347 GGAGCAGGAGCTGCGGCTGCTGG + Intergenic
925442774 2:3902880-3902902 GGTTCAGGAAAAGTGGCTGCAGG + Intergenic
926101859 2:10122976-10122998 CGCTCAGGGCCGGCGGCTGCGGG - Exonic
926138375 2:10353462-10353484 GGTTCAGGGCCAGTGGCCCCTGG + Intronic
927241685 2:20925015-20925037 GGTGCTGGAGCAGCGGTTGCTGG + Intergenic
927651053 2:24914021-24914043 GGCTCAGGACCAGGACCTGCAGG - Intronic
927943220 2:27118744-27118766 GGATCTGGACCAGAGGCTGGAGG + Intronic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
931217450 2:60259973-60259995 GGTTTTGGGCCAGAGGCTGCTGG - Intergenic
932487523 2:72093623-72093645 GATTTAGCACCAGAGGCTGCTGG - Intergenic
933780200 2:85795875-85795897 GGCTCAGGACCTGGGGCTGGGGG - Intergenic
934652097 2:96098618-96098640 GGTCCAGGACTGGCGGCTGCTGG + Intergenic
936341033 2:111632946-111632968 GATTCAGGAGCAGCAGCTTCTGG + Intergenic
936981265 2:118267546-118267568 AGATCAAGACCAGTGGCTGCTGG + Intergenic
942452365 2:176116328-176116350 GGTCCAGGACAAGCGGGTGGGGG - Intronic
944669619 2:201984178-201984200 GGTTCATCTCCAGGGGCTGCGGG - Intergenic
948696685 2:239736420-239736442 GGCTCAGGCCCAGGGGCAGCCGG - Intergenic
948746123 2:240095571-240095593 GGTGCAGGAGCTGCGGGTGCAGG + Intergenic
948746191 2:240095795-240095817 GGTGCAGGAGCTGCGGGTGCTGG + Intergenic
948877394 2:240836935-240836957 GGACCAGGACCAGCTGCTCCTGG + Intergenic
949031899 2:241801373-241801395 GGTTTAGACCCAGCAGCTGCCGG - Intronic
1172525557 20:35599099-35599121 TGCACAGGACCAGGGGCTGCAGG - Intergenic
1175593129 20:60209257-60209279 GGGGCAGGGCCAGCTGCTGCTGG - Intergenic
1175771373 20:61626672-61626694 GCTCCAGGACCACCTGCTGCTGG - Intronic
1176151315 20:63592551-63592573 GGTCCTGGACCCGCTGCTGCAGG + Exonic
1178914637 21:36699559-36699581 AGCTCAGGCCCGGCGGCTGCGGG + Exonic
1179251467 21:39674635-39674657 GGCTCGGGACCTGCTGCTGCAGG - Intergenic
1179491070 21:41741896-41741918 GGTCCACGTCCTGCGGCTGCAGG + Exonic
1182442842 22:30374127-30374149 GGCTCAGGGCCAGCAGCTGAGGG + Intronic
1182473116 22:30560788-30560810 GGTTCAGGCCCAGCAGCAGGGGG + Intronic
1184430800 22:44440708-44440730 GGTTTAGCACCAGAGGCTGCTGG + Intergenic
1184989379 22:48156751-48156773 TGTCCAGGAAGAGCGGCTGCAGG + Intergenic
1185359019 22:50394022-50394044 GGCTCAGAACCAGAAGCTGCTGG + Exonic
950428192 3:12935938-12935960 GCGGCAGGAGCAGCGGCTGCGGG - Exonic
953799542 3:46011770-46011792 GGTTCATGACCAGGGGTTCCTGG - Intergenic
953904281 3:46860724-46860746 GGTTCTGGCCCAGCGCCCGCAGG + Exonic
954405256 3:50341817-50341839 AGAGCAGGACCTGCGGCTGCAGG - Exonic
964227904 3:154428756-154428778 GCTTCAGCCCCAGCGGCAGCGGG + Exonic
964569751 3:158098263-158098285 GGTTCAGGCGCAGCTGCAGCTGG - Exonic
965701240 3:171460640-171460662 GGTTCAGGAACAGCCCCTTCGGG - Intergenic
968583537 4:1405740-1405762 GGGTCAGGCCCAGGGGCTGCAGG - Intronic
969651552 4:8471160-8471182 TGTTCCGGAGCAGCGTCTGCAGG - Exonic
969868477 4:10090678-10090700 GGTGCAGGGCCAGGGCCTGCTGG - Intronic
972788207 4:42346636-42346658 GCTTCAGGACTATCAGCTGCAGG + Intergenic
973705509 4:53576225-53576247 GCATCAGGACCCTCGGCTGCAGG - Intronic
976688275 4:87840011-87840033 GCTTCAGGACCTGTGGCTGCAGG + Intronic
978387739 4:108192535-108192557 GGTTCAGGGCTAGAGGCTGGGGG + Intergenic
982137480 4:152285375-152285397 GGCTCAGGAGCAGTGGCAGCGGG + Intergenic
1202765589 4_GL000008v2_random:146183-146205 GGAGCAGGAGCTGCGGCTGCTGG + Intergenic
985485148 5:144653-144675 GGTGCAGGCCCATCGGCTGGAGG - Intronic
985649662 5:1101491-1101513 GGTTCTCCACCAGCGGCTGTCGG - Intronic
985859834 5:2462205-2462227 GATTCAGGCCCAGCGGGAGCTGG + Intergenic
1002196441 5:177504102-177504124 GGCCCAGTACCGGCGGCTGCTGG - Exonic
1002964427 6:1948943-1948965 GGTTCAGGACCATCTTCTGTTGG + Intronic
1003524391 6:6885861-6885883 GGTCCAGGCCCAGTGGCTGGGGG + Intergenic
1005962525 6:30704198-30704220 GGCTCAAGATCAGAGGCTGCTGG + Exonic
1005966610 6:30731058-30731080 GATTGAGGAGCAGCGGGTGCAGG - Exonic
1006121696 6:31810784-31810806 GGTACAGGACCTGCTGCTGCTGG - Exonic
1006122718 6:31816917-31816939 CGTGCAGGACCTGCTGCTGCTGG + Exonic
1006124581 6:31829111-31829133 CGTGCAGGACCTGCTGCTGCTGG + Exonic
1006744834 6:36334277-36334299 GGCTCAGCAGCAGCAGCTGCGGG - Intronic
1011186020 6:84676721-84676743 GGTTCAGCCCCAGAGGCTGATGG + Intergenic
1018681911 6:166271693-166271715 GGGTCTGGAAGAGCGGCTGCAGG - Intergenic
1019427201 7:983319-983341 GGTTCCCGACGAGCGGCAGCGGG - Exonic
1019598573 7:1869855-1869877 GGTTCAGGTCCAGCTGCTGACGG + Intronic
1020262112 7:6536454-6536476 GCTTGGGGACCAGCGGCGGCTGG + Intronic
1021174464 7:17435071-17435093 GATACAGGACCATCTGCTGCTGG + Intergenic
1021640515 7:22731474-22731496 GGCACAGAACCAGTGGCTGCAGG + Exonic
1023418127 7:39950770-39950792 GTTGCAGGAGCTGCGGCTGCAGG - Exonic
1023881957 7:44325720-44325742 GGTGCAGGAGCAGCGTGTGCAGG - Intronic
1032452005 7:132039788-132039810 GGTTTAGGACAAGCCCCTGCAGG + Intergenic
1032545384 7:132737591-132737613 AGTTCATGAGCAGCTGCTGCTGG + Intergenic
1035201789 7:157272456-157272478 GGTTCCGGCCCAGGTGCTGCGGG - Intergenic
1035219487 7:157397376-157397398 GGTTCCGGCCCAGCACCTGCAGG - Intronic
1035837792 8:2773225-2773247 TGTCCAGGACCTGGGGCTGCAGG - Intergenic
1037824307 8:22151852-22151874 GGTGCAGGACCTGCCGCTGCGGG - Exonic
1038484143 8:27921733-27921755 GCTGCAGGACCTGCGGGTGCTGG - Exonic
1039238171 8:35525685-35525707 GTGCCAGGAGCAGCGGCTGCAGG - Intronic
1040108083 8:43551230-43551252 GGTTCAGGCGCAGGGCCTGCTGG + Intergenic
1042698333 8:71582527-71582549 CATTCAGGACCATCAGCTGCAGG - Intronic
1044625897 8:94234897-94234919 GGTTAAAGACCAGGGCCTGCGGG + Intergenic
1049040791 8:140110698-140110720 GGTTCAGGGGGAGCTGCTGCAGG - Intronic
1049646414 8:143737850-143737872 GGCCCAGGAGCAGCTGCTGCTGG - Intergenic
1049721000 8:144115508-144115530 GCTCCAGGCCCAGCGGATGCTGG + Exonic
1053146423 9:35715139-35715161 GGAGCAGCAGCAGCGGCTGCGGG - Exonic
1053550884 9:39078432-39078454 CGTTCTGGACCAGCGGATGAGGG - Exonic
1057567859 9:96180839-96180861 AATTCAGGACCTGCGGTTGCTGG + Intergenic
1060968527 9:127724802-127724824 GGCTCAGCGCCAGCGCCTGCTGG - Exonic
1061002945 9:127912665-127912687 GCTCGCGGACCAGCGGCTGCAGG + Exonic
1061401298 9:130369850-130369872 GGGTGAGGACCGGCAGCTGCTGG + Intronic
1061867192 9:133498938-133498960 GGTTCTGGAGCTGGGGCTGCAGG + Intergenic
1062079809 9:134617878-134617900 GGCTCGGGTCCAGTGGCTGCAGG - Intergenic
1062402623 9:136379117-136379139 GCTTCAGGAGAAGCGGCTTCAGG - Exonic
1062450016 9:136611243-136611265 GCTGCAGGACCAGCGGCCCCAGG + Intergenic
1062531045 9:137000526-137000548 GAATCAGGAGCAGGGGCTGCAGG - Intergenic
1062644854 9:137542659-137542681 GGTGCAGGACGGGCGGCTGGAGG - Exonic
1062679845 9:137773264-137773286 GGTTCAGGACCAGCGGCTGCAGG - Intronic
1203546335 Un_KI270743v1:131073-131095 GGAGCAGGAGCTGCGGCTGCTGG + Intergenic
1190726595 X:53194173-53194195 GGGTCAGAAGCAGGGGCTGCAGG + Exonic
1191255534 X:58278020-58278042 GGGTCAGGCGCAGGGGCTGCCGG + Intergenic
1192130989 X:68549766-68549788 GGTTCAGAACCAGCAGTTGCCGG - Intergenic
1192180818 X:68914571-68914593 GGGGCAGGACCAGCTGCTGGGGG + Intergenic
1200144827 X:153921132-153921154 GGATCTGGAGCAGCAGCTGCAGG - Exonic
1200151128 X:153951997-153952019 GGTGCAGCAGCAGCAGCTGCAGG - Exonic
1201764673 Y:17566095-17566117 GGTTCTGGCACAGAGGCTGCTGG + Intergenic
1201764762 Y:17566490-17566512 GGTTCCGGCGCAGAGGCTGCTGG + Intergenic
1201836791 Y:18339500-18339522 GGTTCCGGCGCAGAGGCTGCTGG - Intergenic
1201836880 Y:18339895-18339917 GGTTCTGGCACAGAGGCTGCTGG - Intergenic