ID: 1062682739

View in Genome Browser
Species Human (GRCh38)
Location 9:137790980-137791002
Sequence ACTAGGACGTTGATTCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062682739_1062682741 12 Left 1062682739 9:137790980-137791002 CCTGTCAGAATCAACGTCCTAGT 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1062682741 9:137791015-137791037 GTTTCTCAGAAAGCTGAGCAAGG 0: 1
1: 0
2: 3
3: 71
4: 1421
1062682739_1062682742 13 Left 1062682739 9:137790980-137791002 CCTGTCAGAATCAACGTCCTAGT 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1062682742 9:137791016-137791038 TTTCTCAGAAAGCTGAGCAAGGG 0: 1
1: 0
2: 2
3: 27
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062682739 Original CRISPR ACTAGGACGTTGATTCTGAC AGG (reversed) Intronic
900086354 1:899640-899662 ACCAGGATGCTGATTCTGAAAGG + Intergenic
900464362 1:2817847-2817869 TCTAGGACCTTGGTTCTTACAGG + Intergenic
905531307 1:38681072-38681094 AACAGGACGTTGTTGCTGACTGG + Intergenic
910616421 1:89203925-89203947 TTTAGGAAGTTGATTCTGACGGG - Intergenic
917263139 1:173191188-173191210 TCTGGGACGATGATGCTGACAGG + Intronic
917613709 1:176715710-176715732 GCAATGACGTTGATTCTGGCAGG + Intronic
918200301 1:182260064-182260086 ACTGGGATGTTGGTTTTGACTGG - Intergenic
921222411 1:212982458-212982480 ACTAGGATGATGATTCAGCCGGG - Intronic
922538750 1:226403141-226403163 ACTAGGCCTTTCATTGTGACAGG + Intronic
1065574727 10:27105756-27105778 ACCAGGACCTTGCTTCTGCCAGG + Intergenic
1091381720 12:66487-66509 AGAAGGACGGTGAATCTGACTGG - Intergenic
1108857189 13:54808816-54808838 CCTAGGCAGTTGAATCTGACTGG - Intergenic
1119188186 14:72659628-72659650 AAGAGGACCTTGATTCTGATGGG - Intronic
1133868914 16:9669762-9669784 AATAGGACATTGATTTTGCCTGG - Intronic
1138908478 16:61367433-61367455 ACTAGGACTTTGAGTCTCAAAGG - Intergenic
1158855404 18:61539050-61539072 TCTAAGACTTTGATTGTGACAGG - Exonic
1166575074 19:43829692-43829714 AGTATGAAGTTGATTGTGACGGG + Intronic
1166990766 19:46691352-46691374 ACTAGTTCGTAGATTCTGATTGG - Intronic
931830311 2:66044115-66044137 ACAAGGAATTTGACTCTGACTGG + Intergenic
938741069 2:134232631-134232653 ACCAGGAAGTTGATACTAACAGG + Intronic
942702341 2:178727584-178727606 ACTACGATGTTGCTTGTGACAGG - Exonic
1169770340 20:9192946-9192968 ACTAGAACATAGATTCTGAGAGG - Intronic
1173736930 20:45368571-45368593 AGTAGGGAGTTGATGCTGACAGG + Exonic
1176283486 20:64328346-64328368 AGAAGGACGGTGAATCTGACTGG + Intergenic
1179257817 21:39732064-39732086 ACTAGGAGCTTGGTTCTGGCTGG - Intergenic
1181764164 22:25079377-25079399 ACTAGAATGTTAATTCTGGCCGG - Intronic
1185277648 22:49956754-49956776 ACTGGGACATTGATTCTGGGTGG + Intergenic
965843114 3:172930414-172930436 ACTAGGTAGTTGTTTCTGAGTGG - Intronic
967747728 3:193079112-193079134 AGTAGGAGGTTGATTTTTACAGG - Intergenic
987858263 5:23449765-23449787 ACTTGGACATTAATTATGACTGG - Intergenic
989544511 5:42657634-42657656 ATTAGGAAGTTGATTATAACAGG - Intronic
1015897593 6:138032441-138032463 ATTAGGACATTGATTTTGAGGGG - Intergenic
1029182802 7:98716425-98716447 ACTAGGTTGTTGATTCTGTTGGG - Intergenic
1030822689 7:114114744-114114766 ACTATGAGGTTCATTCTGAGAGG - Intronic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1041703211 8:60815352-60815374 ACTAGTATGTTGATTCTGAAAGG + Intronic
1048067335 8:130983732-130983754 ACTAAGAAGATGATCCTGACAGG + Intronic
1058947518 9:109872486-109872508 ATTAGCAATTTGATTCTGACAGG - Intronic
1060397533 9:123326615-123326637 AGAAGGACGCTGATGCTGACAGG - Intergenic
1062682739 9:137790980-137791002 ACTAGGACGTTGATTCTGACAGG - Intronic
1189708712 X:43786452-43786474 ATTGGGACATTGATTCTAACAGG - Intronic