ID: 1062688781

View in Genome Browser
Species Human (GRCh38)
Location 9:137830200-137830222
Sequence GCAGGCGAGCCCGTCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062688778_1062688781 -8 Left 1062688778 9:137830185-137830207 CCATGGGGAGCCCATGCAGGCGA 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1062688781 9:137830200-137830222 GCAGGCGAGCCCGTCTCCTTTGG No data
1062688769_1062688781 29 Left 1062688769 9:137830148-137830170 CCATTCTTATTTAATGGTCAAAC 0: 1
1: 0
2: 1
3: 24
4: 221
Right 1062688781 9:137830200-137830222 GCAGGCGAGCCCGTCTCCTTTGG No data
1062688775_1062688781 3 Left 1062688775 9:137830174-137830196 CCCATCTTTGGCCATGGGGAGCC 0: 1
1: 1
2: 13
3: 56
4: 275
Right 1062688781 9:137830200-137830222 GCAGGCGAGCCCGTCTCCTTTGG No data
1062688774_1062688781 4 Left 1062688774 9:137830173-137830195 CCCCATCTTTGGCCATGGGGAGC 0: 1
1: 0
2: 8
3: 24
4: 208
Right 1062688781 9:137830200-137830222 GCAGGCGAGCCCGTCTCCTTTGG No data
1062688776_1062688781 2 Left 1062688776 9:137830175-137830197 CCATCTTTGGCCATGGGGAGCCC 0: 1
1: 0
2: 15
3: 122
4: 595
Right 1062688781 9:137830200-137830222 GCAGGCGAGCCCGTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062688781 Original CRISPR GCAGGCGAGCCCGTCTCCTT TGG Intronic
No off target data available for this crispr