ID: 1062689149

View in Genome Browser
Species Human (GRCh38)
Location 9:137832517-137832539
Sequence GTGGGGGGAGGGCCTGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 0, 2: 7, 3: 67, 4: 784}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062689149_1062689170 25 Left 1062689149 9:137832517-137832539 CCCTCCGCAGGCCCTCCCCCCAC 0: 1
1: 0
2: 7
3: 67
4: 784
Right 1062689170 9:137832565-137832587 TCTCCAGTCCTAGGATTGGCTGG No data
1062689149_1062689169 21 Left 1062689149 9:137832517-137832539 CCCTCCGCAGGCCCTCCCCCCAC 0: 1
1: 0
2: 7
3: 67
4: 784
Right 1062689169 9:137832561-137832583 CTTCTCTCCAGTCCTAGGATTGG No data
1062689149_1062689167 16 Left 1062689149 9:137832517-137832539 CCCTCCGCAGGCCCTCCCCCCAC 0: 1
1: 0
2: 7
3: 67
4: 784
Right 1062689167 9:137832556-137832578 TGTGCCTTCTCTCCAGTCCTAGG No data
1062689149_1062689171 26 Left 1062689149 9:137832517-137832539 CCCTCCGCAGGCCCTCCCCCCAC 0: 1
1: 0
2: 7
3: 67
4: 784
Right 1062689171 9:137832566-137832588 CTCCAGTCCTAGGATTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062689149 Original CRISPR GTGGGGGGAGGGCCTGCGGA GGG (reversed) Intronic
900033273 1:386569-386591 GTGGGGGGAGGGCGTGTGTGTGG - Intergenic
900054111 1:616458-616480 GTGGGGGGAGGGCGTGTGTGTGG - Intergenic
900154567 1:1198795-1198817 GTGGGGGGTGGGCCTGGGGGCGG - Intergenic
900155944 1:1203339-1203361 GTGGGGGTGGGGCCCGAGGAGGG - Intergenic
900547831 1:3238213-3238235 GTGGGGGCAGGGGATGCGGAGGG + Intronic
900626818 1:3612073-3612095 GTCGGGGAAGGGCTTGAGGAGGG + Intergenic
900996960 1:6127983-6128005 GTGGGGGGCGGGGCTGCGGATGG + Intronic
900996967 1:6128002-6128024 ATGGAGGGCGGGGCTGCGGATGG + Intronic
901025505 1:6276940-6276962 CTGGGGGAAGGGGCTGCAGAGGG - Intronic
901076846 1:6560517-6560539 CTTGGCGGAGGGCCTGCAGATGG + Intronic
901149014 1:7087988-7088010 GTGAGGGGGTGGCCTGGGGAAGG + Intronic
901185222 1:7368553-7368575 GTGGGGGTGGGGCCTGGGAAGGG - Intronic
901296179 1:8162425-8162447 GTGGAGGGAGGGACAGGGGAAGG - Intergenic
901500965 1:9652368-9652390 GTGGGGAGCGGGGCTGCAGAGGG + Intronic
901608109 1:10475142-10475164 GGGTGGGGAGGACCTGGGGAGGG - Intronic
901636447 1:10672476-10672498 GAGGGGGGCGGGCCGGCGGGCGG - Intronic
901906459 1:12416222-12416244 GTGGGTGGGGGGCCTGAAGAAGG - Intronic
901923129 1:12549922-12549944 ATGGGGGGCGGGGCTGCGGCTGG - Intergenic
901929157 1:12585836-12585858 GTGGGTTGGGGGCCTGCAGAGGG + Intronic
902203759 1:14852502-14852524 GAGGGGGCAGGGCCTGCAGGTGG - Intronic
902283031 1:15388303-15388325 GGTGGGGCAGGGCCTGGGGAGGG - Intronic
902283048 1:15388336-15388358 GGTGGGGCAGGGCCTGGGGAGGG - Intronic
902724076 1:18323636-18323658 GTGAGGGGAGGGCTTAGGGAGGG + Intronic
902730248 1:18364409-18364431 GTGGAGGGAGGGACTGCAGGGGG - Intronic
902770507 1:18642985-18643007 GTGTGGGGAGGGGATGCGAAGGG + Intronic
902776682 1:18679335-18679357 GAGGGGTGAGGGCGTGGGGAGGG + Intronic
903173799 1:21569097-21569119 GTGGGGGTAGGGACTAGGGAAGG + Intronic
903249385 1:22041533-22041555 ATTGGGAGAGGGCCTGAGGAAGG - Intergenic
903267005 1:22163587-22163609 GTGGGGGCAGGGGCTGGGGAGGG + Intergenic
903674445 1:25055337-25055359 GTGCGGGGAGGGACTGCTGGCGG - Intergenic
903786718 1:25866132-25866154 GTTGGGGGAGGGCCTGGAGAGGG - Intronic
903986985 1:27235199-27235221 GTCCGGGGAGGCTCTGCGGAGGG + Intronic
904052692 1:27649383-27649405 CTGGTGGCAGGGTCTGCGGAAGG + Intergenic
904319065 1:29684769-29684791 GTGTGGGAGGGGCCTGCTGAGGG + Intergenic
904326073 1:29727786-29727808 GTGGAGGGTGGGCTTGGGGAGGG + Intergenic
904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG + Intergenic
904373567 1:30066059-30066081 GTGGAGGGAGGGCTGGGGGAGGG - Intergenic
904373587 1:30066115-30066137 GTGGAGGGAGGGCTTGGGGAGGG - Intergenic
904373609 1:30066171-30066193 GTGGAGGGAGGGCTGGAGGAGGG - Intergenic
904373661 1:30066309-30066331 GTGGAGGGAGGGCTTGGGGAGGG - Intergenic
904420111 1:30385738-30385760 GTGGAGTGAGGGGCTGTGGATGG - Intergenic
904591419 1:31617632-31617654 GGGGAGGGAGGGCCGGCGGGAGG - Intergenic
904710556 1:32426840-32426862 GTGGGGGGAGGGTAAGCGCATGG + Intergenic
904858507 1:33517893-33517915 GTGGGGACAGTTCCTGCGGAGGG - Intronic
905215107 1:36401237-36401259 GTGGAGGGTGGGCCCCCGGAAGG + Intergenic
905224772 1:36472037-36472059 GTGGAGGGATGGCCTTCAGAGGG + Intronic
905789461 1:40782678-40782700 CCTGGGGCAGGGCCTGCGGAGGG + Intergenic
905856830 1:41319993-41320015 GTGGGGGGAGGGCCGGCCTTGGG - Intergenic
905910982 1:41654237-41654259 GTGGGGGCAGTCCCTGGGGAAGG + Intronic
906214515 1:44031002-44031024 GTGGGGGGAGCTCCTGCGTGGGG - Intronic
906564741 1:46790891-46790913 GTGGGGGTGGGGCCTGCAGAAGG - Intronic
906671790 1:47661198-47661220 GTGTGGAGAGGGCCTCCTGAGGG + Intergenic
907332419 1:53679751-53679773 CCGGGAGGAGGGCCTGGGGAGGG + Intronic
907406714 1:54258245-54258267 GTGGGCGGCGGGCGTGCGGGGGG + Intronic
910632004 1:89364939-89364961 GTGGGTGGAGGGCAAGGGGAGGG - Intronic
910786484 1:91003530-91003552 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
911139599 1:94484635-94484657 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
912246391 1:107965289-107965311 GCGGGGGAGGGGCCGGCGGAGGG + Intergenic
912413691 1:109494294-109494316 GTGCGGGGCGGGGTTGCGGAAGG + Intronic
912494668 1:110083911-110083933 GTGGGTGCGGGGACTGCGGAGGG + Intergenic
913011422 1:114687578-114687600 ATGGGGGGAGGACCTAAGGAGGG + Intronic
913169185 1:116216956-116216978 GTGGGGGGAGGGGGTGGGAATGG + Intergenic
913988325 1:143585652-143585674 GAGGGGTGAGGGCCCACGGAAGG + Intergenic
914391561 1:147228151-147228173 GTGGGGTGGGGGGCTGGGGAAGG - Intronic
914458626 1:147861126-147861148 GTGGGGTGAGGGCCTAGGGGAGG + Intergenic
914902095 1:151716403-151716425 GCGGGGAAAGGGCCTGAGGAGGG + Exonic
915163042 1:153933094-153933116 GAGGTGGGAGGGGCTGGGGAAGG - Intronic
915524255 1:156466538-156466560 GGGGTGGGAGGGCCTACGGATGG - Exonic
915674257 1:157515809-157515831 GGTGGGGGAGGGCATGCAGAAGG + Intronic
915852701 1:159343049-159343071 GTGGGGGGGGGGCGGGCGGAGGG + Intergenic
918135539 1:181670745-181670767 GTGGGGTGGGGGCATGGGGAAGG - Intronic
918620755 1:186602069-186602091 GTGGGGGGAGGGCGGGGGGACGG - Intergenic
919050652 1:192507283-192507305 GTGTGGGGAGTGGCTGGGGAAGG - Intergenic
919686295 1:200486733-200486755 CTGTGGGGAGGGCCGGTGGAGGG - Intergenic
920183647 1:204147547-204147569 TTGGGGGGTGGGACAGCGGAAGG - Intronic
920379907 1:205529285-205529307 GGGTGGGGAGGGCCTGCGTGAGG - Intronic
921406477 1:214785153-214785175 GGGGGGTGAGGGCCTGGGGGAGG + Intergenic
922196259 1:223363240-223363262 GTGGTGGGAGGGCCTGGGGATGG - Intronic
922253376 1:223870763-223870785 CTGGGGGGAGGGGCTGCTGTGGG - Intergenic
922378610 1:224996963-224996985 GTGGGGGCAGGGTCTGAGGCTGG + Intronic
922769923 1:228176174-228176196 GTGGGGTGGGGGCCAGCGCAGGG + Exonic
922851186 1:228735425-228735447 GTGGGGGGCGGGCAGGCGGGCGG - Exonic
923306872 1:232696661-232696683 GATGGGGGTGGGCCTGGGGAAGG + Intergenic
923485154 1:234422603-234422625 GTAGGGGGAGGGTGTGGGGATGG + Intronic
923673786 1:236064042-236064064 GTGGGGGGTTGGCCGGGGGAAGG - Intronic
923688966 1:236174891-236174913 GAGGGGGCAGGGCCTCCGAATGG + Intronic
923713643 1:236406780-236406802 GTGGGAGAAGAGCCTGCAGAGGG - Intronic
923859975 1:237883651-237883673 GGCGGGGGAGGGCCGGGGGAGGG + Intronic
924037128 1:239949192-239949214 GTTGGGGGAGGGACTGAGAATGG - Intergenic
924269509 1:242318260-242318282 GAGGTGGGATGGCCTGCAGAGGG + Intronic
924336829 1:242993588-242993610 GTGGGGGGAGGGCGTGTGTGTGG - Intergenic
924581849 1:245330419-245330441 GTGGGGGGAGGGAGTGGGGGAGG + Intronic
1062923361 10:1296591-1296613 GTTGGGGGAGGGCAGGGGGAAGG + Intronic
1062939001 10:1407809-1407831 GGGGAAGGAGGGCCTGGGGATGG - Intronic
1063031288 10:2237909-2237931 GTGGGGGGAGGGTAAGCAGATGG + Intergenic
1064791414 10:18960871-18960893 GTGAGGGGAGGGGCAGCCGATGG + Intergenic
1064816616 10:19272674-19272696 GTGGGTGGAGGGCAAGGGGAGGG - Intronic
1065810036 10:29433864-29433886 GTGGGGGGTGGGAATGGGGATGG - Intergenic
1065820578 10:29521359-29521381 GTGGTGGGAGGTGCTGAGGAAGG + Intronic
1065841241 10:29703327-29703349 GTGGGGGGCTGGTCTGGGGAAGG - Intronic
1065942212 10:30575230-30575252 GCTGGAGGAGGGCCTGGGGAGGG - Intergenic
1066715393 10:38280511-38280533 GAGGTGGGATGGCCTGCAGAGGG - Intergenic
1066782702 10:38970201-38970223 GAGGTGGGATGGCCTGCAGAGGG + Intergenic
1067060271 10:43074853-43074875 GGGTGGGGAGGGCCTGCAGGGGG - Intergenic
1067217702 10:44316608-44316630 GTGGTGGGAGGGGCTGAGGCTGG - Intergenic
1067217759 10:44316760-44316782 GTGGTGGGAGGGGCTGAGGGTGG - Intergenic
1067217767 10:44316779-44316801 GTGGTGGGAGGGGCTGAGGGTGG - Intergenic
1067837051 10:49648022-49648044 GGGAGGGGAGGGCCTGCAAAGGG + Intronic
1067901043 10:50241886-50241908 GTGGGTGGAGGGCTAGGGGAGGG + Intronic
1069349565 10:67509332-67509354 GTGGGTGGAGGGCTGGGGGAGGG - Intronic
1069537528 10:69265838-69265860 GTGGCGGGTGGGGCTGGGGAGGG + Intronic
1069821146 10:71229489-71229511 GGCGGGGCAGGGCCTGCTGAGGG + Intronic
1070210881 10:74319597-74319619 GTGGCAGGAGGGTCTGTGGAGGG + Intronic
1070288722 10:75101087-75101109 GTGGGGAGAAGGCCTGCAGAAGG + Intronic
1070304878 10:75234253-75234275 GTGGGAGGCGGGGCTTCGGAGGG + Intronic
1072251515 10:93585785-93585807 GTGTGGGAAGGGCCTGCCCATGG - Intronic
1072719456 10:97771797-97771819 GGCGGGGGGGGGCGTGCGGACGG - Exonic
1072926315 10:99620283-99620305 GTGGCGGGGGGGCCGGCGGCAGG - Exonic
1073325805 10:102643572-102643594 GAAGGGGGAGGGCCGGGGGAGGG + Intergenic
1073604544 10:104880639-104880661 GACGGGGGAGGGCCTGCTGGAGG - Intronic
1074415831 10:113265869-113265891 GTGGGTGGAAGGCCTGTGGGAGG - Intergenic
1074554669 10:114477333-114477355 GTGGGGAGAGGGTGTGCGGCAGG + Intronic
1075115050 10:119619180-119619202 GTGGGGAGAGGGTCTGCTGGAGG + Intergenic
1075204041 10:120431285-120431307 GTGGCTGAAGGGCCTGCAGAGGG - Intergenic
1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG + Intergenic
1076305501 10:129463211-129463233 GTGGGTGCAGGGCCTGGAGATGG - Intergenic
1076356427 10:129857027-129857049 GTGGGGGAAGGGCCTGGTGTGGG + Intronic
1076542618 10:131223830-131223852 GCAGGGGGAGGGCCAGGGGAGGG - Intronic
1076783563 10:132737659-132737681 GGGCGGTGAGGGCCTGCAGAGGG + Intronic
1076808937 10:132876655-132876677 GTGCTGGGAGGGCCTGTGGGAGG + Intronic
1077122588 11:916964-916986 GTGGGGGTGGGGCCTCCAGAAGG + Intergenic
1077140512 11:1022246-1022268 GTGGGGCGCGGGGCTGCAGAGGG - Intronic
1077183490 11:1226569-1226591 GTGGGGGGCTGGCATGGGGATGG + Intronic
1077232025 11:1462032-1462054 GTGTGGGGAGGGCCAGCTGAGGG - Intronic
1077333894 11:1994887-1994909 GCGGGGGCTGGGCTTGCGGAGGG - Intergenic
1077436047 11:2539714-2539736 GTGGGGGGTGCGCCTGCTGCAGG + Intronic
1079182845 11:18209070-18209092 GTGCGGGGCGGGCGTGGGGAAGG + Intronic
1079238606 11:18706667-18706689 GACGGTGGAGGGGCTGCGGAGGG - Intronic
1079689889 11:23405646-23405668 CTGGGGGCAGGGCCTGAGGCTGG + Intergenic
1080169452 11:29281776-29281798 GTGAGGGGAGGGCTGGGGGAGGG + Intergenic
1081409345 11:42738239-42738261 GTGGGGGGAGGGCCTAGGGGAGG + Intergenic
1081804086 11:45880668-45880690 CTGGGTGGAGGGCCTGCAGTGGG + Intronic
1081806475 11:45893660-45893682 GAGGGAGGCCGGCCTGCGGAGGG + Intronic
1081979564 11:47257938-47257960 CTGAGGGGAGGGACTGCCGAGGG - Intronic
1082798092 11:57393100-57393122 CTGTGGGGAGGGCTTGCAGATGG - Intronic
1082807148 11:57458619-57458641 CTGGGGGGAGGGCCTGGAGGCGG - Intergenic
1083256103 11:61496350-61496372 GTGGTGGGAGGCCCTGCGTGGGG + Intergenic
1083631082 11:64095857-64095879 CTGAGGGGAGGGTCTGGGGAAGG + Intronic
1083636160 11:64122205-64122227 GTGGCGGGAGGCCGTGGGGAGGG - Intronic
1083764597 11:64835889-64835911 GTGGGCAGAGGGGCTGCCGAGGG - Intronic
1083805910 11:65073819-65073841 GACAGGGGAGGGCCTGCAGATGG + Intronic
1083876934 11:65529199-65529221 GGGCGGGGAGGGCCTTTGGAGGG + Intronic
1083880233 11:65544801-65544823 GAGGGAGGAGAGCCAGCGGAAGG - Intronic
1084295765 11:68212961-68212983 GCGGGGGGCGGGGCTGCGGCCGG - Intronic
1084308562 11:68302436-68302458 GCGGGGAGGGGGCCTGCAGAAGG + Intergenic
1084433976 11:69127259-69127281 GTGGGGGGGGGGTGTGCCGAGGG + Intergenic
1084563775 11:69918494-69918516 GTGGGGGTGGGGCGTGCTGAGGG - Intergenic
1085297619 11:75439819-75439841 GTGGGGGCTGGGCCTGCTGCAGG + Intronic
1085935578 11:81137808-81137830 GTGGGTGGAGGGCTAGGGGAGGG - Intergenic
1086361912 11:86068860-86068882 GTGGGGGTAGGGGGTGCGGTGGG - Exonic
1087094747 11:94307764-94307786 TTTAGGGGAGGGCCTGAGGAAGG - Intergenic
1087094772 11:94307843-94307865 TTTAGGGGAGGGCCTGAGGAAGG + Intergenic
1087165055 11:94994763-94994785 GTGGGGGCAGGACCTGGGGTTGG + Intronic
1087585917 11:100121497-100121519 GTGGGGGCAGGGGGTGGGGAGGG + Intronic
1087694812 11:101364619-101364641 GGGGTGGGAGGGCTAGCGGAGGG - Intergenic
1088058203 11:105610461-105610483 GTGGGCGAGGGGCGTGCGGAGGG + Intronic
1088543599 11:110937860-110937882 TTGGGGACAGGGCCTGGGGAAGG + Intergenic
1088663804 11:112074383-112074405 GTGTGGGGAGGGCGTTTGGAGGG + Exonic
1088853116 11:113721748-113721770 GTGGGGTGAGGGGTTGGGGATGG - Intergenic
1089385184 11:118062637-118062659 GTGGAGGGAGGGCCAGGAGAGGG - Intergenic
1089498570 11:118919933-118919955 GCAGGGGGAGGGCCTGGGCAAGG - Intronic
1089515285 11:119028193-119028215 ATGTGGGAAGGTCCTGCGGAAGG - Exonic
1089583916 11:119498063-119498085 GAGGGAGGAGGCCCTGGGGAGGG - Intergenic
1090398817 11:126435557-126435579 CTCGGGGGAGGGCATGGGGATGG + Intronic
1090556136 11:127878543-127878565 GAGGGTGGTGGGCCTGAGGAGGG - Intergenic
1090719245 11:129457279-129457301 GTGGGGGGAAGCCCTTGGGATGG - Intergenic
1091042212 11:132292397-132292419 GTGGGGGAGGGGCCGGAGGAGGG - Intronic
1202816877 11_KI270721v1_random:50069-50091 GCGGGGGCTGGGCTTGCGGAGGG - Intergenic
1091460598 12:641437-641459 GTGGGGAGAGGCCATGAGGATGG + Intronic
1091589360 12:1834310-1834332 GAGGGGGAAGGACATGCGGATGG + Exonic
1092091709 12:5809122-5809144 GTGGGGAGAGGGAGTGCAGATGG + Intronic
1092241216 12:6837603-6837625 CTGGGGGCAGGGCCTGAGGTTGG - Intronic
1092285926 12:7129307-7129329 GTGAGGGGAGGGGGTGAGGATGG + Intergenic
1092564354 12:9648593-9648615 GTTGGGGGAGGGCCCGTGGGTGG - Intergenic
1092839135 12:12522186-12522208 GTAGGGAGATGGCCTCCGGAAGG - Intronic
1093398648 12:18715167-18715189 GTGGGGGGGGGGGGGGCGGAGGG + Intronic
1096085649 12:48863427-48863449 GTGGGGGGAGGGCGTTTGGGCGG + Intronic
1096090273 12:48894814-48894836 GTGGGAGGAGTGCCTGAGTAGGG + Intergenic
1096159767 12:49367039-49367061 GTGGCGCGCGAGCCTGCGGACGG + Intronic
1096193876 12:49636578-49636600 GTGGGGGAAGGGCCTGGAGGGGG - Exonic
1096220880 12:49827797-49827819 GGGGCGGTAGGGCCTGGGGAAGG - Intronic
1096714100 12:53480833-53480855 GTGGGGGGAGGGGCGGTGGGAGG - Intronic
1096760699 12:53839593-53839615 GTGGGTGGATGGGCTGGGGATGG + Intergenic
1096855109 12:54475379-54475401 TCGGGGGGAGGGGGTGCGGAGGG - Intergenic
1096870148 12:54587985-54588007 GTGCGGGAGGGGCCTGGGGAGGG - Intronic
1097158274 12:57028304-57028326 GTGGGTGGAGGGGCTGCGGGGGG - Intronic
1097188009 12:57205839-57205861 GTGGGGGCAGGTCCTGGGGCTGG + Intronic
1097196157 12:57243412-57243434 TTGAGGAGAGGGCCTGCGGAGGG - Intergenic
1097232978 12:57523204-57523226 TTGGGGAGAGGGCGGGCGGAGGG - Intronic
1097247462 12:57614410-57614432 GAGGGGGCAGGGCCTGGGGCGGG + Intronic
1097863906 12:64543464-64543486 GTGGGGGGTGGGCAGGCGGGTGG - Intergenic
1099141225 12:78978007-78978029 GTGGCGGCGGGGCCGGCGGAGGG + Intronic
1099583008 12:84477179-84477201 GTGGGGAGGGGGCCAGGGGAAGG + Intergenic
1100391342 12:94148490-94148512 GTGGAGGGAGGGCGGGCGGGCGG + Intergenic
1100860427 12:98799839-98799861 GTGGGGGGAGGGCAAGGGGCAGG - Intronic
1102033578 12:109758631-109758653 GTGGGGGCAGGGACGGCGGCTGG - Intronic
1102278344 12:111599342-111599364 GGCGGGGGAGGGGCGGCGGAGGG + Exonic
1102671893 12:114626748-114626770 GAGGGGGGAGGGTCAGAGGAGGG + Intergenic
1103016641 12:117499913-117499935 CTGGGAGGAGGGCCTGTGTAAGG + Intronic
1103932308 12:124457305-124457327 GCGTGGGGAGGGCCTGCAGGGGG - Intronic
1104049373 12:125185880-125185902 GAGAGGGGAGGGCCTCCGGGAGG - Intergenic
1104761502 12:131299772-131299794 GTGGGCTGAGGGGCTGCGGGTGG + Intergenic
1104763916 12:131314269-131314291 GTGGGGGCACAGCCTGCAGATGG - Intergenic
1104818274 12:131661020-131661042 GTGGGCTGAGGGGCTGCGGGTGG - Intergenic
1104969816 12:132526196-132526218 GTGGGTGGAGGGCAGGCGGACGG + Intronic
1105874016 13:24537964-24537986 GTGGGGAGAGTGCCTCAGGATGG + Intergenic
1107214676 13:37902508-37902530 GTGGGGTGGGGGGCTGGGGAAGG + Intergenic
1107238086 13:38197474-38197496 GTGGGGGGTGGGGGTGCGGGGGG + Intergenic
1108603219 13:52012175-52012197 GTGGGGGGTTGGGCTGAGGAGGG - Intergenic
1108925115 13:55732750-55732772 GTGGGGGGGGGGCTTGAGCAGGG + Intergenic
1110416582 13:75260089-75260111 GTGGAGGGAGGGCATGTGAAAGG - Intergenic
1110461088 13:75746472-75746494 GTGGTGGAATGGCCTGCGGGTGG + Intronic
1110822690 13:79934771-79934793 GTGGGTGGAGGGCAAGGGGAGGG + Intergenic
1111043516 13:82783796-82783818 GTGGGTGGAGGGCTAGGGGAGGG - Intergenic
1113751241 13:112777847-112777869 GTGTGGGGAGCGCATGGGGAGGG - Intronic
1113841650 13:113364359-113364381 GGCGGGGGAGGGCCGGGGGAGGG + Intergenic
1113867351 13:113535777-113535799 GTCTGGGGAGGGGCTGGGGATGG + Intronic
1113867381 13:113535909-113535931 GTCTGGGGAGGGACTGGGGATGG + Intronic
1113987129 13:114326993-114327015 GTGGGGGGTGGGGATGGGGAGGG - Exonic
1114533542 14:23409701-23409723 GTGGGGGGAAGGCCAGAGCAGGG - Intergenic
1115136022 14:30108642-30108664 GTGGGGTGAGGGGATGGGGAGGG + Intronic
1115888734 14:38003728-38003750 GTGGGGGGCGGGGGTGGGGATGG + Intronic
1117888194 14:60387623-60387645 GTGGGGCGGGGGCCTGGGGGAGG + Intergenic
1118854623 14:69611554-69611576 GGCGGGGGAGGCCCCGCGGAGGG - Intergenic
1119530182 14:75354671-75354693 TGGGGAGGAGGGCCTCCGGATGG - Intergenic
1119548901 14:75493668-75493690 GTGGGGAGGGGGACTGGGGAGGG + Intergenic
1119774891 14:77242284-77242306 GTGGGGGGATGGGCTTAGGAGGG - Intronic
1120022648 14:79548178-79548200 GTGGGTGGAGGGCTAGGGGAGGG - Intronic
1121780182 14:96617259-96617281 GGGTGGGGAGGGGCTGAGGACGG + Intergenic
1121959711 14:98247979-98248001 GTGGGGGGAGGGGCGGGGGAGGG + Intergenic
1122264409 14:100539948-100539970 GTGAGGGGAGGGTCGGGGGACGG + Intronic
1122371198 14:101229950-101229972 GGGGGGGGCGAGGCTGCGGAGGG - Intergenic
1122371230 14:101230020-101230042 GTGGGGGGCGAGGCTGCGGAGGG - Intergenic
1122383659 14:101329236-101329258 GTGTGGGGAGGGCCTGCCAGAGG - Intergenic
1122594157 14:102877717-102877739 GTTGAGGGAGGGCCTGTGGAAGG - Intronic
1122594176 14:102877824-102877846 GTTGAGGGAGGGCCTGCGGAAGG - Intronic
1122748001 14:103911015-103911037 GTGGGGGGTGGGGGTGGGGAGGG + Intergenic
1122897719 14:104768784-104768806 GTGGGAGGAGGGGCTGCAGGGGG - Intergenic
1122905742 14:104800741-104800763 GCGGGGAGAGGGCCGGCGGGCGG - Intronic
1122938434 14:104970538-104970560 ATGGGGGGAGGAGCTGTGGAGGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123043250 14:105499224-105499246 GCAGGGGGAGGGCCAGCGGCAGG - Intronic
1123053934 14:105560457-105560479 GTGAGGCCAGGGACTGCGGATGG - Intergenic
1202863524 14_GL000225v1_random:100429-100451 GTGGGGGGATGGCGTGGTGATGG + Intergenic
1123433274 15:20236219-20236241 GAGTGGGGAGGGACTGCTGAAGG - Intergenic
1124250707 15:28104928-28104950 GTGGGGGGAGGGTGTACGCATGG + Intergenic
1124513611 15:30348085-30348107 GTGGTGGGATGGCCTGCGAGAGG - Intergenic
1124625842 15:31307033-31307055 CTGGGGGGATGGCCTGGGGCTGG + Intergenic
1124729310 15:32182680-32182702 GTGGTGGGATGGCCTGCGAGAGG + Intergenic
1124966480 15:34436582-34436604 GTGCGGGGAACGCCCGCGGAGGG - Intronic
1125283989 15:38072929-38072951 GTGCGGGCCGGGCCTGCAGAGGG + Intergenic
1127142748 15:55993798-55993820 GAGTGGGGAGGGCGTGCGGCGGG + Intergenic
1128551307 15:68599734-68599756 GGGAGGGGAGAGCCTGGGGAGGG - Intronic
1128834106 15:70795221-70795243 GTGGGTGGAGGGGCTGAGGGAGG + Intergenic
1128988206 15:72236568-72236590 GTGGGGGGTGGCCATGGGGAGGG + Intergenic
1129151826 15:73693901-73693923 GTGGGGGGAGGGGCAGGGAAAGG + Intronic
1129235272 15:74220007-74220029 GCTGGGAGAGGGCCTGGGGATGG + Intergenic
1129330891 15:74826587-74826609 GTGGGGCGCGGGCCCGCGGCGGG + Exonic
1129579036 15:76785875-76785897 GTGGGGTGAGGGACTGTGGGAGG + Intronic
1129672065 15:77612966-77612988 GTGGGGGATGGGGCTGCCGAGGG - Intergenic
1129676260 15:77633640-77633662 CTGGGTGCAGGGCCTCCGGACGG - Intronic
1129705574 15:77792273-77792295 GTGGGAGGAGGGCTTGCGTTTGG - Intronic
1129732499 15:77940171-77940193 GAGGGAGGCGGGCCTGCAGAGGG - Intergenic
1130260269 15:82348944-82348966 GTGAGGGCAGGGCCTGGGGCTGG + Intronic
1130268461 15:82430489-82430511 GTGAGGGCAGGGCCTGGGGCTGG - Intronic
1130280964 15:82520063-82520085 GTGAGGGCAGGGCCTGGGGCTGG - Intergenic
1130472334 15:84236244-84236266 GTGAGGGCAGGGCCTGGGGCTGG - Intronic
1130479825 15:84350815-84350837 GTGAGGGCAGGGCCTGGGGCTGG - Intergenic
1130491945 15:84437314-84437336 GTGAGGGCAGGGCCTGGGGCTGG + Intergenic
1130503559 15:84516354-84516376 GTGAGGGCAGGGCCTGGGGCTGG + Intergenic
1130531092 15:84748460-84748482 GGGGGGGGGGGGCAGGCGGAAGG - Intergenic
1130594632 15:85240880-85240902 GTGAGGGCAGGGCCTGGGGCTGG - Intergenic
1131043586 15:89295720-89295742 GTGGGGGGGGCGCCAGGGGAAGG - Intronic
1131260392 15:90884640-90884662 GTGGGGGTAGGGGCCGCGGAAGG + Intronic
1132146739 15:99433675-99433697 ATTGGGGCAGGGCCTGGGGAAGG + Intergenic
1132237445 15:100232751-100232773 GTGAGAGGAGGGCCTGGGCAGGG - Intronic
1132625430 16:889341-889363 GTGGGGTGTGAGGCTGCGGATGG + Intronic
1132650803 16:1020712-1020734 GTGGAGGGAGGGCAGGCGGTGGG + Intergenic
1132668885 16:1094760-1094782 GTGGAGGGGGGACCTGTGGAGGG - Exonic
1132677432 16:1126574-1126596 GTGGGGGGAGGGCGGGGGGAGGG - Intergenic
1132711646 16:1271539-1271561 GTGGGTGAAGGGCCTGGGGATGG + Intergenic
1132711671 16:1271623-1271645 GTGGGTAAAGGGCCTGGGGACGG + Intergenic
1132711692 16:1271707-1271729 ATGGGTGAAGGGCCTGGGGACGG + Intergenic
1132711715 16:1271791-1271813 ATGGGTGAAGGGCCTGGGGATGG + Intergenic
1132748395 16:1446398-1446420 GTGGAGGCTGGGCCTGCGCAAGG + Exonic
1133033090 16:3020938-3020960 GCGGGGGGAGGGACTGGGGTCGG + Intronic
1133160349 16:3907749-3907771 GTGTGGGCAGGGCCTGCAGAGGG + Intergenic
1133343609 16:5055370-5055392 CTGGGGGGCAGGCCTGCAGAGGG - Intronic
1133950416 16:10386401-10386423 CTGGGGTTAGGGACTGCGGAGGG + Intronic
1134045964 16:11101315-11101337 GTTGGGGGTGAGGCTGCGGAGGG - Intronic
1134077171 16:11300063-11300085 GTGGCTGGGGGGCCTGGGGAAGG - Intronic
1134925284 16:18153732-18153754 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
1135298796 16:21306714-21306736 GTGGGTGGAGGGCTAGGGGAGGG - Intergenic
1135565879 16:23510543-23510565 GTGGAGGGGGGGCCTGGGGTGGG - Intronic
1135895901 16:26402276-26402298 GTGGGGTGGGGGCCTGGGGGAGG - Intergenic
1136069548 16:27779512-27779534 GTGCAGGGAGGGCCTGCTCAAGG - Exonic
1136237501 16:28923981-28924003 GAGGGGGGAGTGTCTGGGGAAGG + Intronic
1136499641 16:30664074-30664096 GTGGGGGGCGGTCCTGGGGCTGG + Intronic
1136579314 16:31142363-31142385 GAGAGGGCGGGGCCTGCGGAAGG - Intronic
1136851351 16:33614903-33614925 GAGTGGGGAGGGACTGCTGAAGG + Intergenic
1137456677 16:48623114-48623136 GTGGGTGGGGGGCAAGCGGAGGG - Intergenic
1137632551 16:49957134-49957156 GTGAGGGGAGGACCAGTGGAAGG + Intergenic
1137695668 16:50460596-50460618 TTGGGGGAAGGGCCTGCCAAGGG - Intergenic
1137706603 16:50539812-50539834 GTGGGGGGGGGGCCTGGGGAAGG + Intergenic
1138534584 16:57653193-57653215 GTGTGGGGAGGACCTGGGGGAGG - Exonic
1138546405 16:57722282-57722304 CTGGGGCTAGGGCCTGGGGATGG + Intronic
1138795027 16:59957590-59957612 GGGGGGTGAGGGGCTGGGGAAGG - Intergenic
1139040321 16:62992506-62992528 GTGGGGGGAGGGGCGAGGGATGG - Intergenic
1139414978 16:66801109-66801131 GAGCGGGGAGGGCCTGCTGAGGG - Intronic
1139472094 16:67183849-67183871 GTGGGGGCACGGCACGCGGACGG - Exonic
1139475231 16:67199603-67199625 GCCGGGCCAGGGCCTGCGGAGGG + Intronic
1139489136 16:67277357-67277379 GTTGGGGAAGGGCCAGGGGAGGG + Intergenic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1140663083 16:77206708-77206730 GTGGGGGGAGGGAGTAGGGATGG - Intronic
1141174474 16:81709936-81709958 GAGGGGGGAGGGGGTGGGGAGGG + Exonic
1141199132 16:81883624-81883646 GAGGGGTGAGGGCCTGAGGATGG + Intronic
1141761823 16:86033560-86033582 CTGGGGGAAGGGGCTGCAGAAGG + Intergenic
1141788065 16:86214878-86214900 GTGGGGTCAGGGCCTGGGGCCGG - Intergenic
1141882341 16:86868280-86868302 GTGGGCGGAGGGGGTGAGGAAGG + Intergenic
1141997192 16:87643055-87643077 GTGGGTGCAGGGGCTGGGGAGGG - Intronic
1142180689 16:88668192-88668214 ATGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142180701 16:88668230-88668252 ATGGGGGGAGGGCAAGAGGAGGG - Intergenic
1142180712 16:88668268-88668290 ATGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142180724 16:88668306-88668328 ATGGGGGGAGGGCAAGAGGAGGG - Intergenic
1142180735 16:88668344-88668366 ATGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142180747 16:88668382-88668404 GAGGGGGGAGGGCAGGAGGAGGG - Intergenic
1142182762 16:88679227-88679249 GTGTGGGGAGGCCCTGCGGGAGG - Intronic
1142445575 16:90133885-90133907 GTGGGGGGGGGGGCTAGGGAGGG + Intergenic
1142477034 17:194592-194614 GAGGAGGGAGGGCGAGCGGAGGG + Intergenic
1142508687 17:381196-381218 GTGGGGGGGGGGCTTCCGGGAGG - Intronic
1142778130 17:2157907-2157929 GTGGGAGGAGAGCTTGCTGATGG - Intronic
1142810624 17:2393977-2393999 GCCGGGGGAGGGGCGGCGGAGGG + Intronic
1142831443 17:2552076-2552098 GTGGGGTGAGGGGCTGCAGAGGG + Intergenic
1142854438 17:2722002-2722024 CTGGGGGGAGGCCAGGCGGACGG + Intergenic
1142888708 17:2929311-2929333 GAGGGGGCAGGGCCTGTGGAGGG + Intronic
1143015705 17:3890184-3890206 GTGGGGGCGGGAGCTGCGGAGGG - Intronic
1143346581 17:6253983-6254005 GTGGGAGCAGAGCCTGTGGAAGG - Intergenic
1143568641 17:7740608-7740630 GAGGCAGGAGGGCCTCCGGAAGG - Intronic
1143783196 17:9240120-9240142 GTAGGGGGAGGGGCCGCCGAGGG - Exonic
1145214788 17:21043169-21043191 GTGGGGGAAGGGCCTGGCGCGGG - Intronic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1146075420 17:29724298-29724320 GTGGGTGGATGGCCTGAGGTCGG + Intronic
1146409634 17:32571331-32571353 GTGGAGGGAGGGCCAGAGGCGGG - Intronic
1146564471 17:33900421-33900443 GTGTTGGGAGGGCATGCAGATGG - Intronic
1146927561 17:36755468-36755490 GTTGGGGGAGGGGGTGCAGAGGG + Intergenic
1147179690 17:38676376-38676398 GTGGGGCGAGGGTTTGAGGAAGG + Intergenic
1147839578 17:43361779-43361801 GGAGGGGGAGGGGATGCGGAGGG - Intergenic
1147976459 17:44250744-44250766 GGCAGGGGAGGGCCTGCAGAGGG + Intronic
1148122286 17:45220541-45220563 GAGGAGGGAGGGCCCGCTGAAGG - Intergenic
1148661266 17:49334972-49334994 GAGGGGGGAGTGACTGCTGATGG + Intronic
1148755287 17:49969881-49969903 GTGGGGGGAGGGCGAAGGGATGG + Intronic
1148787009 17:50150457-50150479 GTGCGGGGAGGCGCTCCGGAGGG + Exonic
1149863189 17:60135675-60135697 GTGTGGGGCGGGCCTGGGGAAGG - Intergenic
1150572672 17:66401338-66401360 GTGAGTGGAGTGCCTGCGGCTGG + Intronic
1150603038 17:66667115-66667137 GTGGGGGAAGGGACTGGGCAGGG - Intronic
1150770454 17:68036176-68036198 GTGGGGGCAGGGGCTGGGGGTGG + Exonic
1150790138 17:68196542-68196564 GTGGGGGTAGGGGGTGGGGAAGG + Intergenic
1150810948 17:68356820-68356842 GCAGGGGGAGGCCCTGCGGAGGG - Intronic
1150826316 17:68478954-68478976 GTGGGCGGATGGCCTGAGGTTGG - Intergenic
1151620111 17:75240143-75240165 GGGTGGGGAGGGCCTGCCGCTGG + Intronic
1151979154 17:77498706-77498728 GTGGTGGGAGGGCCTGGGGGGGG - Exonic
1152168239 17:78724757-78724779 GTGGAGGCAGGGCTTGCAGAGGG - Intronic
1152209885 17:78997407-78997429 GTGGGTGGGGGGCCTGCCGGGGG + Exonic
1152230492 17:79111896-79111918 GTGCGATGAGGGGCTGCGGAAGG - Intronic
1152342547 17:79733372-79733394 GTGGGGAGTGGGCCTGGGGCAGG - Intronic
1152585124 17:81185907-81185929 GTGGGGGGAGGGCTTCGGGGCGG - Intergenic
1152617965 17:81346375-81346397 CTGGCGGGAGGGGCTGCGGGCGG + Intergenic
1152636563 17:81432769-81432791 GGGGAGGGTGGGCCTGGGGATGG - Intronic
1152636588 17:81432818-81432840 GGGGAGGGTGGGCCTGGGGATGG - Intronic
1152746125 17:82040170-82040192 GTGGGGGTAGGGGATGCCGAGGG - Intergenic
1152748689 17:82052598-82052620 GTGGGCCCGGGGCCTGCGGAGGG + Intronic
1152760145 17:82103462-82103484 GTGGGGGGAGGGAGTGGGGATGG - Intronic
1152965696 18:112011-112033 GTGGGGGGTGGGGGTGGGGAGGG + Intergenic
1154092806 18:11380886-11380908 ATGTGGGGAGAGCCTGAGGAAGG + Intergenic
1154294288 18:13135997-13136019 TCGTGGGGAGGGCCTGGGGAAGG + Intergenic
1154382976 18:13869202-13869224 GTGGCGGGCGGGCGGGCGGATGG - Intergenic
1155169848 18:23259330-23259352 GTGGGGGGAGGGACGTCCGATGG + Exonic
1155206030 18:23558864-23558886 GTGGGGTGGGGGCCTGGGGGAGG - Intronic
1155651183 18:28143997-28144019 GTGGGTGGAGGGCAAGGGGAGGG + Intronic
1157312050 18:46560049-46560071 GTGGGGGGTGGGGGTGGGGAGGG - Intronic
1157353999 18:46917142-46917164 GAGGGGAGCGGGCCGGCGGAGGG - Intronic
1157582404 18:48781262-48781284 GCGGGGGCCGGGCCTGCAGAAGG + Intronic
1158437116 18:57441498-57441520 GTCGGGGGAGGGGGTGCAGAGGG - Intronic
1158907804 18:62030870-62030892 GTGGGAGGATGGCTTGAGGATGG + Intergenic
1159300662 18:66562128-66562150 GTGGGGAGTGGGCATGGGGATGG + Intronic
1159343728 18:67170999-67171021 GTGGGGGGATGGGGTGGGGAGGG - Intergenic
1160015837 18:75139747-75139769 GTGGGAGGAGGGCCCGGGGAAGG - Intergenic
1160818396 19:1046745-1046767 GCGGAGGGGGGGTCTGCGGAGGG + Intronic
1161532220 19:4796740-4796762 GTGGGGAGAGGCCCTGCTGTGGG + Exonic
1161588288 19:5117327-5117349 GTGGAGGGAGGGACTGCAGTGGG + Intronic
1161697204 19:5776072-5776094 GTGGGTGCAGGGCCTCCGCAGGG + Intronic
1161956595 19:7499370-7499392 GAGGGGGGAGGGGCGGGGGAGGG + Intronic
1161993488 19:7698552-7698574 GTGGGGTGAGGGGCTCTGGAGGG + Intronic
1162021513 19:7870390-7870412 GAGGGGGTGGGGCCTGTGGAGGG + Exonic
1162070829 19:8151340-8151362 GTGGGGGGGGAGCCTGCTGAGGG - Intronic
1162104827 19:8364052-8364074 CTGGGGGCAGGGCCTGTGGCCGG - Intronic
1162129055 19:8514174-8514196 CTGGGGGCGGGGCCTGCGCAGGG + Intergenic
1162333764 19:10047256-10047278 GTTGGGGGAGGGGCTGGGTAAGG - Intergenic
1162383735 19:10348427-10348449 GTGGGGTAGGGGCCTGCGGGAGG - Intergenic
1162765030 19:12914045-12914067 GTGGGGTGAGGGTCTGGAGATGG - Intronic
1163074048 19:14872560-14872582 GTGGGTGGAGGGCTAGCGGAGGG + Intergenic
1163118553 19:15202097-15202119 GTGGGGGTGGGGGCTGAGGAAGG - Intergenic
1163390484 19:17027195-17027217 GTGAGGGGCGGGCCCGGGGAGGG - Intergenic
1163667704 19:18610929-18610951 GGGGCGGGAGGGCCGGCGGGCGG - Intronic
1163677805 19:18664045-18664067 GAGGGGGGAGTGACTGCTGATGG - Intronic
1163700883 19:18785937-18785959 GCGGGGGCGGGGCCTGCGGTGGG - Intronic
1164539135 19:29109206-29109228 GTCAGGGGAGGGCCTTTGGAGGG + Intergenic
1165027424 19:32971953-32971975 GTGAGGGCTGGGCCTGCGGCGGG - Exonic
1165091758 19:33391573-33391595 GTGGTGGGAGGGCCTGAGGTGGG + Intronic
1165161712 19:33820441-33820463 GGGGAGGGAGGGCTGGCGGAAGG + Intergenic
1165333640 19:35154834-35154856 GTGGGCAGAGGGGCAGCGGATGG - Exonic
1165455313 19:35907445-35907467 CGGGGGCGAGGGGCTGCGGAGGG - Exonic
1165590350 19:36963985-36964007 GTGGGGGGAGGGACGGAGGGAGG + Intronic
1165805887 19:38580316-38580338 GTGGGGGGAGGGCAAGCCCAGGG + Intronic
1165836500 19:38760079-38760101 GTGGGAGGATGGCTTGAGGACGG + Intronic
1165924913 19:39320850-39320872 GTGGGGGGAGGGCCGGGGGAGGG + Intergenic
1166180688 19:41106018-41106040 GTGGGGTGGGGGCCTGGGGAAGG + Intergenic
1166329416 19:42069715-42069737 GGGAGGGGAGGGCCTGCTGGGGG + Intronic
1166632682 19:44421020-44421042 GTGGGTGGAGGGCAAGGGGAGGG - Intronic
1166678354 19:44753370-44753392 GTGTGGGGAGGGCCTGGGGCTGG - Intronic
1166874745 19:45890682-45890704 GTGGGGGGGAGTCGTGCGGAGGG + Exonic
1167120323 19:47512917-47512939 TTGGGAGGAGGGCCTGGGGATGG - Intronic
1167235376 19:48311493-48311515 CTGTGGGGAGGACCTGCGCAGGG + Intronic
1167596682 19:50432013-50432035 GAGGGGGCGGGGCCTGGGGAGGG - Intergenic
1167618104 19:50547280-50547302 GTGGGGCAAGGGCCAGCGAAGGG - Intronic
1167622659 19:50568051-50568073 GCGGGGGGCGGGGCTGCGGCCGG + Intergenic
1167641805 19:50686589-50686611 GTCGGGAGAGGGCGGGCGGAGGG + Intronic
1167888677 19:52522671-52522693 GTGGGGGCCGGGCCTGGGGTGGG + Intergenic
1167941138 19:52946618-52946640 GTGGGGGCGGGGCCTGGGGCGGG - Intronic
1168106625 19:54169436-54169458 GAGGGAGGAGGGGCTGGGGACGG - Intronic
1168322291 19:55517709-55517731 GTGGGGTGAGGGCTTGGGGAGGG - Exonic
925180781 2:1815685-1815707 CTGGGGGCAGGGCATGGGGAAGG - Intronic
925307024 2:2855467-2855489 GTGGTGGGAGGGCATGTAGAAGG - Intergenic
925366546 2:3315459-3315481 GTGGTGGTAGGGGCTGTGGATGG - Intronic
925366597 2:3315607-3315629 GTGGTGGTAGGGGCTGTGGATGG - Intronic
925366723 2:3315975-3315997 GTGGTGGTAGGGGCTGTGGATGG - Intronic
925672459 2:6325922-6325944 GTGGGAGGAGGGCCGGCGGAGGG - Intergenic
926115197 2:10208855-10208877 GATGGGTGAGGGGCTGCGGAGGG - Intronic
926165735 2:10521509-10521531 GTGGGAAGAGGAGCTGCGGAGGG + Intergenic
926751771 2:16203946-16203968 GTGGGGGGATGGCCAGAGGCAGG - Intergenic
927093178 2:19727944-19727966 GTGGAGGGAGCCCCTGGGGAAGG - Intergenic
927561407 2:24076693-24076715 GAGGGGGCGGGGCCTGAGGAGGG + Intronic
927596651 2:24403208-24403230 CTGGGGGGAGGGCGGGCGGGGGG - Intergenic
927606350 2:24490788-24490810 GCGGCGAGAGGCCCTGCGGACGG - Intergenic
928904458 2:36355682-36355704 GTGGGGGGAAGGTCTGGGGGAGG + Intergenic
929026188 2:37604815-37604837 ATGGGGGAAGGGCATGCAGAAGG - Intergenic
929425784 2:41843248-41843270 GTGAGGGGTGGGCCTGGGGAAGG - Intergenic
930255535 2:49085963-49085985 GTGGGGGGGGGGAGTGGGGAGGG + Intronic
930700641 2:54456129-54456151 GAGGGCGGAGGGCGTGCGGGAGG + Intergenic
931676610 2:64702662-64702684 CTGGGTGGAGGGCTTGCGGGAGG + Intronic
931715761 2:65027427-65027449 GTGGGGGGAGGTTCTGCTAATGG - Intergenic
931797037 2:65721225-65721247 GTGGGGTGGGGGCGTGGGGATGG + Intergenic
932077246 2:68676498-68676520 GTGGGGTGAGGGAGTGGGGAGGG - Intergenic
932475321 2:72002433-72002455 GTGGGGAGCGGGCCCGGGGAGGG - Intergenic
932495360 2:72143420-72143442 GTGGGGGAAGGGCGGGCGGGGGG - Intronic
932498512 2:72159805-72159827 GTGGTGGCAGGGACTGGGGAGGG + Intergenic
932568440 2:72924099-72924121 GTGCGGGGAGGTGTTGCGGAGGG + Intronic
932658361 2:73629985-73630007 GTGGGGGGGGGGGGTGCGGGGGG - Intergenic
932760800 2:74438050-74438072 GTGGGGGCAGGGCTTGAGGGGGG + Intronic
932970289 2:76532714-76532736 GTGGGGGGATGGCCTGAGCCTGG + Intergenic
933380653 2:81539442-81539464 GTGGGTGGTGGGCGTGGGGATGG + Intergenic
933666805 2:84971093-84971115 GCGGGGGGTGGGCCGGGGGAGGG + Exonic
933882929 2:86688933-86688955 GTGGGAGGATGGCCTGAGGCCGG - Intronic
934502797 2:94872807-94872829 CAGGGGGAAGGGCCTGCAGAAGG - Intronic
934562681 2:95321093-95321115 GGGAGGGGAGGGCCTAGGGAAGG - Intronic
934617622 2:95784457-95784479 GTGGGTGGAGGGCTGGGGGAGGG + Intergenic
934643271 2:96040102-96040124 GTGGGTGGAGGGCTGGGGGAGGG - Intergenic
935095711 2:99942534-99942556 GTGGGGGGAGGGGCGGGGGGGGG + Intronic
935404491 2:102694618-102694640 GAGGGAGGAGGGCCTGAAGAAGG + Intronic
936574575 2:113642378-113642400 CTGGGGGGAGGGGGTGGGGAAGG - Exonic
937086187 2:119173564-119173586 GTGGGGGCAGGGCCTGGCCAAGG - Intergenic
938092792 2:128444310-128444332 GTGAGGGAAGGGCCAGAGGAGGG - Intergenic
938823716 2:134983615-134983637 GTGGAGGGAGGGACTGTGGGGGG + Intronic
940623545 2:156144353-156144375 GTGGGGTGAGGGCGGGGGGAGGG + Intergenic
941188233 2:162344078-162344100 GGGCGGGGCTGGCCTGCGGAAGG + Exonic
941524353 2:166587213-166587235 GTGGGGTGGGGGCCTGGGGGAGG + Intergenic
941772536 2:169360944-169360966 GTGAGGGGAGGGCTTGTGGATGG - Intronic
941936645 2:170986939-170986961 TTGGGGGGTGGGCCTGAGAATGG - Intergenic
942305156 2:174599943-174599965 GTGGGGGCAGGGGGTGGGGATGG + Intronic
942449593 2:176100529-176100551 GTGGGGGGCGGCCCCGGGGAGGG + Exonic
944984094 2:205154893-205154915 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
945166349 2:206950929-206950951 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
946307820 2:218866002-218866024 GTGGGGGTAGGGGCTGGGGGAGG + Intronic
946365089 2:219244029-219244051 GTGGGGGTAGGGGCTGAGGCAGG + Intronic
946372694 2:219290372-219290394 GTGGGGGGAGGGCCCTGGGCAGG + Intronic
946391387 2:219418689-219418711 GTAGGAGGAGGGCGTGCGGGTGG - Exonic
946409922 2:219510772-219510794 GTGGGGGCAGGGCCTGGCGGTGG + Intergenic
947994719 2:234517405-234517427 GTGGGCGGGAGGACTGCGGAGGG + Intergenic
948196800 2:236102943-236102965 GTGGGGCGGGGGCTTGCGGTGGG - Intronic
948612036 2:239176147-239176169 GTGGGGGCATGGACTCCGGAAGG - Intronic
948623149 2:239249311-239249333 GGGCGGGGAGGGGCTGCGGAAGG + Intronic
949008869 2:241667243-241667265 GTGTGGGCAGGGCCTGGGGATGG + Intronic
1168977458 20:1978290-1978312 GTGGGGAGAGGTGCTGCAGAGGG - Intergenic
1169604106 20:7296125-7296147 GGGGGGTGAGGGCATGGGGAGGG - Intergenic
1170171577 20:13419301-13419323 GAGGGAGGAGGGCATGAGGATGG + Intronic
1171011963 20:21513763-21513785 TTGGGGGGAGGGACTGGGGGAGG + Exonic
1171215494 20:23349635-23349657 GTGGGGGGAGAGGGTGCGGGGGG + Intergenic
1171340745 20:24425687-24425709 GTGGGGGTGGGGCCTGGTGAGGG + Intergenic
1171365124 20:24617933-24617955 GAGTGGGGAGAGCCTGGGGAGGG + Intronic
1171365144 20:24617986-24618008 GAGCGGGGAGAGCCTGGGGAAGG + Intronic
1171365221 20:24618182-24618204 GAAGGGGGAGAGCCTGGGGAGGG + Intronic
1171365290 20:24618353-24618375 GAGGGGGGAGAGCCTGGGGAAGG + Intronic
1171424122 20:25038988-25039010 GTGGGAGGAGGGGCAGGGGAGGG - Intronic
1172176604 20:32976281-32976303 GTTGGAGGAGGGCCCGTGGATGG + Intergenic
1172181184 20:33004492-33004514 GTGGGTGGAGGGGCAGGGGATGG + Intergenic
1172618859 20:36306885-36306907 TTAGGGGGCGGGCCTGAGGAGGG - Intronic
1172656691 20:36542152-36542174 GGGTGGGGAAGGTCTGCGGAGGG + Intronic
1172874246 20:38154735-38154757 TTGGGGGGAGGGCTGGGGGAGGG - Intronic
1173226704 20:41166395-41166417 GTGAGGGAAGGGCCTGGGGGCGG + Intronic
1173821159 20:46021647-46021669 GCGGGGGGCGGGCGGGCGGAGGG + Intergenic
1173836390 20:46128779-46128801 AAGGGGGGAGGGCTTGGGGAAGG + Intronic
1174447042 20:50597421-50597443 GTGCGGGGATGGCATGGGGAAGG + Intronic
1174924510 20:54742779-54742801 GTGGGGGTAGGGGGTGGGGAGGG + Intergenic
1175193583 20:57227378-57227400 GTGGGGGGTGGGGGTGGGGATGG - Intronic
1175237982 20:57526316-57526338 GTGGGAGGAGGGCCCGCAGGAGG + Intergenic
1175238080 20:57526589-57526611 GAGGGAGGAGGGCCTGGAGAGGG + Intergenic
1175238120 20:57526703-57526725 GAGGGAGGAGGGCCTGCAGGGGG + Intergenic
1175836790 20:62001248-62001270 TACGGGGGAGGGCCTGGGGAGGG - Intronic
1175838930 20:62014489-62014511 GTGGGGAGAGGGGCTGGGCAGGG + Intronic
1175892421 20:62321562-62321584 GTGGAGGCAGGGCCTGTGGAGGG + Intronic
1175941358 20:62538967-62538989 GTGGGGGCTGGGCCTGGGCAGGG - Intergenic
1176061351 20:63174243-63174265 GTGGAGGGAGCACCTGCAGATGG + Intergenic
1176156946 20:63626823-63626845 GGGAGGGGAGGGCCGGGGGAGGG - Intronic
1176159541 20:63641409-63641431 GGGGCGGGAGGGCCTGAGGGCGG + Intronic
1176179527 20:63742797-63742819 GTGGGCTGAGGGCCTGCGGCTGG + Intronic
1176307818 21:5133397-5133419 GTGGGTGCAGGGCCTGGGGGTGG - Intronic
1176576577 21:8443331-8443353 GTGGGGGGGGGGGCGGGGGAAGG - Intergenic
1178350931 21:31872952-31872974 GAGAGGGGAGGGCCCGGGGAGGG - Intergenic
1178698591 21:34815354-34815376 GGGAGGGGAGGGACTGGGGAAGG + Intronic
1178914479 21:36699036-36699058 GAGGGGGGAGGGACCGCGGCGGG - Intergenic
1179213795 21:39349252-39349274 GGGGGGGGGGGGCCCCCGGAAGG - Intronic
1179633931 21:42695486-42695508 GAGGGGAGAGGGCCAGAGGACGG + Intronic
1179767038 21:43582016-43582038 GGGGGATGAGGGCCTGCTGAGGG + Intronic
1179767105 21:43582229-43582251 GGGGGATGAGGGCCTGCTGAGGG + Intronic
1179849243 21:44128633-44128655 GTGGGTGCAGGGCCTGGGGGTGG + Intronic
1180082081 21:45491528-45491550 GAGAGGGGAGGGCCTGCACAGGG + Intronic
1180618035 22:17141313-17141335 ATGGGTGGAGGGCTTGTGGATGG - Intronic
1180696473 22:17754324-17754346 TTGGAGGGGAGGCCTGCGGAGGG - Intronic
1180854115 22:19035694-19035716 CTGGGGGGACGTCCTGCGGCCGG - Intergenic
1180960561 22:19760630-19760652 GAGGGGCGAGGGCCGGGGGAGGG + Intronic
1181166071 22:20983721-20983743 TTGGGGGGCGGGCTTGAGGATGG + Intronic
1181539476 22:23565807-23565829 GTGGGGGCGGTGCCTGCGGAAGG - Intergenic
1181636713 22:24177956-24177978 GTGGGAGGGGGGCCTGGGGCAGG + Intronic
1181930413 22:26396254-26396276 GTGGGGTGAGGGACCCCGGAGGG + Intergenic
1182715077 22:32351736-32351758 GTGGGGGGAGGGCGGGGGGGGGG + Intergenic
1183102151 22:35590794-35590816 GAGGGTGAAGGGCCTGGGGAGGG + Intergenic
1183346589 22:37311589-37311611 GTGGGGAGAGGGCCTGAGGCTGG + Intronic
1183351711 22:37338233-37338255 GTGGGGCCAGGACCTGCGCAGGG - Intergenic
1183456556 22:37926088-37926110 GTGGGGCCCGGGCCTGGGGAGGG + Intronic
1183780953 22:39998518-39998540 GAGGGGGGAGGGGCTGAGGATGG + Intronic
1184309951 22:43634667-43634689 GTGGGGGGCGGGCCTGGGGGTGG + Intronic
1184334912 22:43847491-43847513 GTGGGTGGAGGGGCTGTGCAGGG - Intronic
1184381012 22:44144995-44145017 CTTGGGGGAGGGCCTGGAGAGGG - Intronic
1184454069 22:44599216-44599238 GGGTGGGGAGGCCCTGGGGAGGG + Intergenic
1184486119 22:44780707-44780729 GTGAGGGCAGGGCCTGAGGATGG - Intronic
1185068015 22:48641631-48641653 GTGAGGGGAGGGTGTGCGGGGGG - Intronic
1185192256 22:49446390-49446412 GGAGAGGGAGGGCCTGCTGAGGG - Intronic
1185385734 22:50530652-50530674 GAGTGGGGAGGGCCTGAGGTCGG - Intronic
949864960 3:8539964-8539986 GTGGGGTGGGGGCCTGGGGGAGG - Intronic
950677681 3:14564452-14564474 GGGAGGGGACGGCCTGCCGAGGG + Intergenic
950762415 3:15243789-15243811 GTGGGGGGAGGGTGGGAGGAGGG + Intronic
951005684 3:17613027-17613049 GTGGGGTGAGGGGTTGGGGAAGG - Intronic
951471061 3:23056797-23056819 GTGGGGTGGGGGCCTGGGGGAGG - Intergenic
951497516 3:23347552-23347574 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
952271325 3:31834773-31834795 GTGGGTACAGGGCCTGTGGATGG - Intronic
952389245 3:32865782-32865804 GGGGGGGGGGGGCCGGCGGGCGG - Intronic
953881904 3:46695061-46695083 GGGGGTGGAGGGCATGGGGAGGG - Intergenic
954109487 3:48426215-48426237 GTCTGGGGAGGTCCTGGGGATGG - Intronic
954139055 3:48595627-48595649 GTGGGGGGTGGGGCTGCAGTTGG + Intergenic
954374144 3:50185366-50185388 GTGGGGGAAGGGGCTGAGGCTGG + Intronic
954388532 3:50257102-50257124 GTGGGGATAGGGCCTCCAGAGGG + Intronic
954681791 3:52349960-52349982 GTGGGAGGAGGCGCTGGGGAGGG - Intronic
955866588 3:63390728-63390750 GTGGGGGAAGGCCCCGAGGAGGG - Intronic
956130901 3:66053077-66053099 GTGGGTGGAGGGACTGTAGAGGG - Intergenic
956918726 3:73903528-73903550 GTGGGTGGAGGGCAAGGGGAGGG - Intergenic
957442123 3:80262810-80262832 GTGGGGTGAGGGCAGGCGGGAGG - Intergenic
958141900 3:89571946-89571968 GTGGGGGGAGGGCAGGCAGCAGG + Intergenic
959325335 3:104929838-104929860 GTGGGGGGCGGGGCTGAGGCAGG - Intergenic
959596815 3:108137406-108137428 GTGGGGGGGGGGCGGGGGGAGGG + Intergenic
959703027 3:109316188-109316210 GTGGGGGGAGGGGCGGGGGTGGG - Intronic
959737025 3:109670786-109670808 GTGGGGTGAGGGGATGCGGGAGG + Intergenic
960991092 3:123311835-123311857 GTGGGGGAGGGGCCGGTGGATGG - Intronic
961013386 3:123449778-123449800 GCGGGAGGAGGGGATGCGGAGGG - Intergenic
961357031 3:126345793-126345815 GTGGCAGGAGGGCCTGCAGGAGG + Intronic
961365764 3:126398296-126398318 GTCAGGAGAGGGCCTGCGGCTGG + Intronic
961394428 3:126577439-126577461 GTGGGAGGAGGGCCTGTGTCTGG - Intronic
963084171 3:141421682-141421704 GTGGGGTGAGGGGCTGAGGACGG - Intronic
963191179 3:142475240-142475262 GTGGGGTGAGGGGCTGGGGGAGG - Intronic
963196017 3:142531397-142531419 GTGGGGTGAGGGGCTGGGGGAGG - Intronic
963259136 3:143176276-143176298 GCGGGGGGAGGGGCTGAGCAGGG + Intergenic
963790505 3:149577994-149578016 GTGGGGGGAGGGAAGGAGGAAGG - Intronic
965119605 3:164536691-164536713 GTGGGTGGAGGGCTAGGGGAGGG - Intergenic
965292652 3:166903881-166903903 GCGGGTGGAGGGCTTGGGGAGGG - Intergenic
966441541 3:179950363-179950385 GTGAGGGGAGGGGGTGGGGAGGG + Intronic
966862223 3:184236854-184236876 GTGGGGAGAAGGCCTGGTGAGGG - Intronic
966885724 3:184377173-184377195 GTGGGGAGTGGGGCTGGGGAGGG + Intronic
967055320 3:185825064-185825086 GTGGGTGGCGGGCGGGCGGAGGG - Intergenic
967546105 3:190730636-190730658 GTGGGGAGAGGGGTTGCAGATGG - Intergenic
967757453 3:193185724-193185746 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
968287864 3:197518783-197518805 GGGGGGGGTCGGCCTGAGGAGGG - Intronic
968287880 3:197518837-197518859 GAGGGGGGTCGGCCTGAGGAGGG - Intronic
968748342 4:2372634-2372656 GATGAGGGAGGGCCTGCGGCTGG + Intronic
968753306 4:2401535-2401557 GGAGGGGGAGGGCCTGGGGTGGG - Intronic
968916766 4:3500052-3500074 GTGTGGGGGGGGCCTCAGGATGG + Intronic
969077878 4:4594662-4594684 GTGGGAGGAGAGCCTGGGCAGGG - Intergenic
969265518 4:6061794-6061816 GTGGGAGAAGGGCCAGTGGATGG + Intronic
969390780 4:6890064-6890086 GTGGGTGGTGGGGCTGGGGAAGG - Intergenic
970399444 4:15703376-15703398 CGGTGGGGAGGGCCTGGGGAGGG + Intronic
970451236 4:16168433-16168455 GGGGGAGGAGGGCCCGGGGACGG - Intronic
970826176 4:20278817-20278839 GTGGGGGGAGGGCGTGTGGAGGG + Intronic
972660988 4:41116314-41116336 GTGGGTGGGGGGCCAGGGGAGGG + Intronic
972671150 4:41214747-41214769 GAGGCGGCAGGGCCTGCGGGAGG + Intronic
976146236 4:82044570-82044592 GGCGGGGGAGGGTCTGTGGATGG + Intergenic
977694452 4:99950461-99950483 GTGGGGGGAGAGGCGGGGGAAGG + Intergenic
978465085 4:108999965-108999987 GTGGGGTGGGGGCCTGGGGGAGG + Intronic
979088030 4:116440005-116440027 GTGGGTGGAGGGCTAGGGGAGGG + Intergenic
980145133 4:128973423-128973445 GTGGGGGGAGGGAGAGGGGAGGG + Intronic
981088743 4:140710733-140710755 GTGGGGGGGTGGTCTGAGGAAGG + Intronic
981140722 4:141265640-141265662 GTGGGGGGATGGAGTACGGATGG + Intergenic
981528662 4:145732628-145732650 GTGGGGGGAGGGTGTTGGGAGGG - Exonic
982107067 4:152020413-152020435 GTGGGGGCAGGGCATGGTGAAGG - Intergenic
983732524 4:171012965-171012987 TTGGAGGTAGGGCCTGAGGAGGG + Intergenic
985190291 4:187365491-187365513 GTGGGGAGAGGGGCTGGAGATGG - Intergenic
985452568 4:190069558-190069580 GTGGGGGGTGGGGGTGGGGATGG - Intergenic
985453554 4:190072855-190072877 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985454544 4:190076148-190076170 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985455532 4:190079441-190079463 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985456516 4:190082735-190082757 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985457504 4:190086035-190086057 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985458491 4:190089328-190089350 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985459480 4:190092628-190092650 GTGGGGGGTGGGGGTGGGGAGGG - Intergenic
985463731 4:190175397-190175419 GTGGGGGGTGGGGGTGGGGAGGG - Intronic
985513615 5:325630-325652 GTGGGTGGAGGTGGTGCGGAGGG - Intronic
985648813 5:1098122-1098144 GTGGGGGCTGGGCTTGCAGAGGG - Intronic
985672329 5:1213227-1213249 TGGGGGGCGGGGCCTGCGGAGGG - Intronic
985720443 5:1486024-1486046 GTGGGGTGTGGGCATGTGGAGGG + Intronic
985723706 5:1504486-1504508 GTGGGAGGATCGCCTGCGGTCGG + Intronic
985732465 5:1556788-1556810 GTGGGGGGGGGGCGTGGGGGGGG + Intergenic
989011425 5:36876820-36876842 GGGGGGGGAGGGCGGGGGGAAGG - Exonic
989789410 5:45378764-45378786 GTGGGGTGAGGGGCTGGGGGAGG - Intronic
990228512 5:53685204-53685226 GTGGGGGGAGGGGCGAGGGATGG - Intergenic
990446241 5:55896697-55896719 GGGAGGGGAGGGACTGGGGAGGG - Intronic
990711134 5:58582102-58582124 CCTGGGGGAGGGCCTGGGGAGGG + Intergenic
991363742 5:65847029-65847051 GTGGGGCGGGGGCCTGGGGGAGG - Intronic
991645454 5:68796402-68796424 GTGGGGGGACAGCCTGCAGAGGG - Intergenic
991927293 5:71718358-71718380 GTGGGGGGAGGTTCTGGGGATGG + Intergenic
992249755 5:74865805-74865827 GTGGGGAGAGGGCGAGGGGAGGG + Intronic
992430173 5:76703005-76703027 GTGGGGGGAGGGGGTGGGGGTGG + Intronic
992430207 5:76703146-76703168 GTGGGGGGAGGGGGTGGGGGGGG + Intronic
992605524 5:78452325-78452347 GTGGGGGGAGGGAGGGGGGAGGG - Intronic
993094997 5:83471511-83471533 GAGGTGGGAGTGCCTGGGGAGGG + Exonic
993502467 5:88678734-88678756 GTGGAGAGAGGGTCTGCTGAGGG + Intergenic
994100303 5:95884084-95884106 GTGGGAGAAGGGACTGGGGAGGG + Intergenic
994308246 5:98234836-98234858 GTGGGGTGGGGGCCTGGGGGAGG - Intergenic
995106225 5:108380988-108381010 GGCGGGGGAGGGCCTGCGGGGGG - Exonic
995650132 5:114361240-114361262 GTGGGGGCGGGGCCGGAGGAGGG - Intronic
995837378 5:116412107-116412129 GTGGGGAGGGGGCCAGAGGAGGG - Intronic
997554935 5:134787907-134787929 GTGGGGGGAGGGGCTGAGATGGG + Intronic
997564231 5:134874714-134874736 GTGGGCTGAGGGCCGGTGGACGG + Intronic
997583219 5:135030183-135030205 GTGGGCAGAGGGCATGCGGTAGG - Intronic
997641714 5:135452738-135452760 GAGAGGGCAGGGCCTGGGGACGG + Intergenic
997820027 5:137056851-137056873 GTGGGGGGAGGGTCTCAAGAAGG - Intronic
998153115 5:139768492-139768514 GTGGGTGGATCGCCTGAGGAAGG + Intergenic
998915678 5:147008657-147008679 GTGGGGGGTGGGGTTGAGGAAGG - Intronic
999710090 5:154310348-154310370 GGGAGGGGAGGGCCTGTAGATGG + Intronic
1000381027 5:160629419-160629441 GTGGGGTGATGGCCTGCTTATGG + Intronic
1000502418 5:162068147-162068169 GTGGGGGGAAGGTGTGGGGAGGG + Intronic
1000502481 5:162068533-162068555 CTGGGGGGAGGGGCGGCGGGCGG + Intronic
1001199144 5:169699945-169699967 GTGGCGGGAGGGCCGACTGAGGG + Intronic
1001605156 5:172954467-172954489 GTGGGGGCAGGGGCGGCGGGGGG + Intergenic
1002028924 5:176414131-176414153 TTGTGGGGAGGTCCTGCTGAGGG - Intronic
1002316903 5:178349526-178349548 GTGGGGGGTGGCCCTGCCTAGGG - Intronic
1002524374 5:179807049-179807071 GTGGGGTGGGGGCCGGCGGCCGG + Intronic
1002740547 5:181432299-181432321 GTGGGGGGAGGGCGTGTGTGTGG + Intergenic
1002910963 6:1490789-1490811 GTGGGTGGAGGGGGTGCGGGAGG - Intergenic
1004424242 6:15496898-15496920 CTTGGCGGAGGGCCTGAGGACGG - Exonic
1006133883 6:31884247-31884269 GTGGGGAGGGGGCCTGTGGGTGG + Intronic
1006319935 6:33314283-33314305 GGCGGGGGAGGGCCTGGGGTTGG - Intronic
1006341318 6:33448725-33448747 GTGGGGGGATGGCAGGCGGGGGG - Intronic
1006410536 6:33870958-33870980 GTGAGGGGAGGGGCTGGAGAGGG - Intergenic
1006672544 6:35738285-35738307 GTGGGGGGGGGGTGTGCGGAGGG + Intronic
1006780888 6:36631597-36631619 GTGTGGTGCGGGCCTGTGGAGGG + Intergenic
1006798002 6:36743181-36743203 GTGGGGGAAGTGCTTGCGGAGGG + Intronic
1007167933 6:39841410-39841432 GGTGGGGGAGGGCCTCCAGAGGG + Intronic
1007260449 6:40559531-40559553 ATGGGGGTAGGGGCAGCGGAGGG + Intronic
1007400277 6:41599177-41599199 ATGTGGGGAGGGTCTGAGGAGGG - Exonic
1007502453 6:42308784-42308806 GAGGGGGGAGGGCAGGAGGAGGG + Intronic
1007599191 6:43071377-43071399 GAGTGGTGAGGGCCTGGGGAAGG + Intronic
1007682736 6:43645473-43645495 CTGGGGGGCGGGCCTGGGGACGG + Intronic
1007951436 6:45876061-45876083 GTGGAGGGTGGGGCTGCAGAGGG + Intergenic
1008342947 6:50389559-50389581 GTTGGGGGAGGGACTTCGGTGGG + Intergenic
1008574092 6:52842893-52842915 GTGGGGTGGGGGCCTAGGGAAGG - Intronic
1010467489 6:76186255-76186277 GTGGGGTGGGGGGCTGGGGAGGG - Intergenic
1010921445 6:81686582-81686604 GAGGGGGCAGGGCCGGCGGGGGG + Intronic
1013418956 6:109949076-109949098 GGAGTGTGAGGGCCTGCGGAAGG + Intergenic
1013488555 6:110621286-110621308 GTGGTGGGGGCGCCTGTGGAGGG + Exonic
1014448962 6:121561589-121561611 GTGGGTGGAGGGCTGGGGGAGGG - Intergenic
1015225833 6:130855873-130855895 GTGGGGGGAGGGGGTGCAGGGGG + Intronic
1015903577 6:138092877-138092899 GTGGAGGGAGGGCAGGGGGAAGG + Intronic
1016497157 6:144676667-144676689 GTGGGGTGAGGGGCTAGGGAAGG - Intronic
1016575148 6:145561899-145561921 GTGGGTGGAGGGCAAGAGGAGGG + Intronic
1017026622 6:150186675-150186697 GTGGGGTCAGGGCCTGAGGCGGG + Intronic
1018067317 6:160133261-160133283 GTGGGTGGAGGGGCTGCGGGTGG - Intronic
1018650122 6:165986251-165986273 GAGGGGGGAGGGCCAGGGGGTGG - Intronic
1019140311 6:169938461-169938483 GGGGAGGGAGAGCCTGGGGAGGG + Intergenic
1019245656 6:170707896-170707918 GTGGGGGGAGGGCGTGTGTGTGG + Intergenic
1019305685 7:333202-333224 GCGGGGGGGGACCCTGCGGAGGG + Intergenic
1019367850 7:644510-644532 GTGGAGGGTGGGCCCTCGGAGGG - Intronic
1019478663 7:1256099-1256121 GTGGGGGCAGGGCCGGCCGGGGG - Intergenic
1019499039 7:1355300-1355322 CGGGAGGGAAGGCCTGCGGATGG + Intergenic
1019614142 7:1951281-1951303 GTGGATGAAGGGCCTGAGGAAGG + Intronic
1019638357 7:2088908-2088930 GTGGGGGTTGTGCCTGCAGAAGG + Intronic
1019652851 7:2169951-2169973 CTGGGTGGAGGGGTTGCGGAAGG + Intronic
1019747393 7:2708563-2708585 GCGGGGAGAGGGCCAGAGGATGG - Intronic
1020558782 7:9702491-9702513 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
1021654790 7:22864389-22864411 GTGGAGTGAGGGGCTGTGGATGG - Intergenic
1021709826 7:23404756-23404778 GTGGGGGGTGGGGGTGGGGATGG + Intronic
1021798767 7:24284193-24284215 GAGGGGTGAGAGCCAGCGGATGG - Exonic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022739087 7:33104304-33104326 GAGGGTGGAGGGCAGGCGGAGGG + Intronic
1023842240 7:44104236-44104258 GTGGACGGAGGGGCTGCGGGGGG - Intergenic
1023875813 7:44285780-44285802 GTGGGGGGAGACCCAGCGGTGGG + Intronic
1023985105 7:45089395-45089417 GAGGGTGCAGGGCCTGGGGAGGG + Intergenic
1023990667 7:45126434-45126456 GTGGGAGGAGGGCCTCGGGGCGG + Intergenic
1024084396 7:45881496-45881518 GTTGGTGTAGGGCCTGGGGATGG + Intergenic
1024610495 7:51059990-51060012 ATGAAGGGAGGGCCTGTGGAGGG - Intronic
1025138824 7:56445552-56445574 GTGGGCGGATGGCCTGAGGTTGG + Intergenic
1026354988 7:69549763-69549785 GTGAGGAGAGAGGCTGCGGACGG - Intergenic
1026866013 7:73824454-73824476 GTGGGGGAATGGCCTGTGAAGGG + Intronic
1026887971 7:73965652-73965674 GTGGGCGGATCGCCTGCGGTCGG - Intergenic
1026909531 7:74084064-74084086 GTGGGGCGAGGGCCTGGAGGGGG + Intronic
1027742771 7:82033065-82033087 GTGAGGGGAAGGCCTGGTGAAGG - Intronic
1028622181 7:92836628-92836650 GAGGGCGGAGGGACGGCGGAGGG + Intergenic
1028689431 7:93635189-93635211 GTGGGTGGAGGGCAAGGGGAGGG - Intronic
1029675199 7:102063939-102063961 GTGGTGGGAGGGGCCGCGGCTGG + Intronic
1030820504 7:114086479-114086501 GTGGGGGGCGCGCCCGGGGAGGG - Intronic
1031407658 7:121405675-121405697 GTGGGGGGCGGGAGTGGGGAGGG + Intergenic
1031587690 7:123552486-123552508 GTGGGTGGGGGGCCAGGGGAGGG + Intronic
1033165605 7:139036128-139036150 GCGAGGGGTGGGCCTGCGGGAGG + Intergenic
1034255056 7:149720340-149720362 GTGGGTGGGGGGCCTGAGGCAGG - Intronic
1034342954 7:150369578-150369600 GTGGGGGGAGGGGTTGTGGCTGG + Intronic
1034421330 7:150992600-150992622 GTGGGGGGCCGGCAGGCGGAAGG - Intronic
1034542095 7:151764776-151764798 GTGGGGGCAGGGCCAGCAGGTGG + Intronic
1034644792 7:152635929-152635951 GTGGGTGCAGGGGCTGGGGATGG - Intergenic
1034875658 7:154722682-154722704 GTGGGGTGAGGCCTTGGGGATGG + Intronic
1034904081 7:154928780-154928802 GTGATGGGAGAGCCTGGGGAGGG + Intronic
1035502467 8:100302-100324 GTGGGGGGAGGGCGTGTGTGTGG - Intergenic
1035714577 8:1744219-1744241 GAGAGGGGAGAGCCAGCGGAAGG + Intergenic
1036130717 8:6107219-6107241 GTGGGTGGAGGGAGTGGGGAGGG + Intergenic
1037062544 8:14532710-14532732 GTGGGGGGAGGGCGGGGGGGAGG + Intronic
1037612383 8:20487052-20487074 GTGGGGGGGGGGCAAGGGGAGGG + Intergenic
1038055790 8:23856297-23856319 GGGGGGGGGGGGGCGGCGGACGG + Intergenic
1038610453 8:29055873-29055895 GTGGGGGGATGTCCTGGGGCAGG + Intronic
1039616263 8:38957081-38957103 GTGGGAGAGGGGCCTGGGGAGGG + Intronic
1040436776 8:47398820-47398842 GTGGAGGGAGAGACTGCTGAGGG + Intronic
1040519538 8:48163524-48163546 GTGGGTGGAGGGCTAGGGGAGGG - Intergenic
1041162694 8:55061207-55061229 GTGAGGGGAGGTTGTGCGGAAGG - Intergenic
1041491280 8:58436589-58436611 GTTGGGGGTGGGCCTGTGGGAGG + Intronic
1045043270 8:98247699-98247721 ATGAGAGGAGGGCCTGCGTAGGG + Intronic
1046022192 8:108678884-108678906 GTGGGGGGAGGGGGGGAGGATGG - Intronic
1046131727 8:109974799-109974821 GTGGGTGGAGGGGTTGGGGAAGG + Exonic
1046997552 8:120541291-120541313 GTGGAGAGAGGGCCAGAGGAGGG - Intronic
1047198105 8:122740103-122740125 GGGGAGGGAGGGCATGTGGACGG - Intergenic
1047401503 8:124552380-124552402 TTGGGGGGAGGGCCATGGGAGGG - Intronic
1047457142 8:125025340-125025362 GTGGGTGGAGGGCAAGGGGAGGG + Intronic
1047754587 8:127908773-127908795 GCGGGAGGAAGGGCTGCGGAAGG + Intergenic
1047892853 8:129331590-129331612 GTGGGTGGGGGGCTAGCGGAGGG + Intergenic
1048295855 8:133212854-133212876 CTGGAGAGAGGGCCTGCGGGGGG - Exonic
1048561915 8:135548411-135548433 GTGTGGGCAGTGGCTGCGGAGGG + Intronic
1049439361 8:142602173-142602195 GGGTGGGGAAGCCCTGCGGATGG - Intergenic
1049444976 8:142625794-142625816 GTGGTGGAAGGGGCTGCGGTGGG - Intergenic
1049615109 8:143572578-143572600 TTGGGCTGAGGGCCTGCGGAAGG + Exonic
1049665570 8:143841190-143841212 GAGGGGACAGGGCCTGGGGAGGG - Intergenic
1049684154 8:143932608-143932630 GTGGGGGCAGGGCCAGCCGGGGG - Intronic
1049804631 8:144533362-144533384 GTGGCGGGGGGTCCTGAGGATGG - Intronic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051238924 9:15031190-15031212 GTGGGGTGGGGGGCTGGGGAGGG + Intergenic
1051774915 9:20622549-20622571 GCGGAGGGAGGGCTTGCGGGCGG + Intergenic
1052348785 9:27436994-27437016 GTGGGGGGAAGACCTGGGGGTGG + Intronic
1053593138 9:39533747-39533769 GTCTGGGGAGGGGCTGCGCAGGG - Intergenic
1053850874 9:42288455-42288477 GTCTGGGGAGGGGCTGCGCAGGG - Intergenic
1054573169 9:66831530-66831552 GTCTGGGGAGGGGCTGCGCAGGG + Intergenic
1055053377 9:72001283-72001305 GTGGGGGAAGGGGATGCAGAAGG + Intergenic
1055547172 9:77390626-77390648 GTGGGGGGAGGGGTGGCGGGCGG - Intronic
1055863679 9:80786313-80786335 GGGGTGGGAGGGCTTGGGGAGGG + Intergenic
1057220819 9:93256974-93256996 GTGGGGCCAGGACCTGCGGCAGG - Exonic
1057489669 9:95511207-95511229 GGGCGGGGAGAGCCGGCGGACGG - Intronic
1057700901 9:97362468-97362490 GTGGGGGGATGGACTGGGAAGGG - Intronic
1057887391 9:98840248-98840270 GTGGGGGGTGGGCAGGCGGGTGG - Intronic
1059434708 9:114269124-114269146 GTGGGAGGAGGAGCTGGGGAAGG - Intronic
1060727273 9:126014952-126014974 GGTGGGGGAGGGGCTGGGGATGG - Intergenic
1060734570 9:126058888-126058910 GGGGCCGGAGAGCCTGCGGAGGG - Intergenic
1061043584 9:128152881-128152903 GTGGGAGAAAGGCCTGGGGAGGG - Intronic
1061237660 9:129351937-129351959 GAGGGGGAAGGGACTGCAGAAGG - Intergenic
1061306579 9:129736142-129736164 GTAGGGGGAGGGAGTGGGGATGG - Intergenic
1061802544 9:133120418-133120440 GTGGGGGGGGGGTCGGGGGATGG - Intronic
1062041072 9:134404583-134404605 CTGGTGGGAGGGCCTGCCCAGGG + Intronic
1062353257 9:136149285-136149307 GTGGGAGGAGGGCCGGGGGCTGG - Intergenic
1062363745 9:136199246-136199268 GTGGAGGGGGCGCCGGCGGAGGG + Intronic
1062386493 9:136313804-136313826 GTGGGAGTGGGGCCTGCTGAGGG - Intergenic
1062473687 9:136717552-136717574 GTGGGGGAAGGGGCTGCGTGAGG - Intronic
1062484840 9:136769649-136769671 GTGGCGGGAGGGCCAGTGCATGG - Intergenic
1062546264 9:137064967-137064989 ACGGGGGCAGGGCCTGCGGGAGG + Exonic
1062600283 9:137316184-137316206 GTGGGAGGAGGGGCGGCGGAGGG + Intronic
1062689149 9:137832517-137832539 GTGGGGGGAGGGCCTGCGGAGGG - Intronic
1203775299 EBV:69590-69612 GTGGGGCGATGGCCTCCGGGGGG + Intergenic
1203738876 Un_GL000216v2:161748-161770 GTGGGGGATGGGGCTGGGGAGGG + Intergenic
1203740803 Un_GL000216v2:175583-175605 GTGGGGGGATGGCGTGGTGATGG - Intergenic
1203471028 Un_GL000220v1:115533-115555 GTGGGGGGGGGGGCGGGGGAAGG - Intergenic
1203478849 Un_GL000220v1:159505-159527 GTGGGGGGGGGGGCGGGGGAAGG - Intergenic
1203364392 Un_KI270442v1:244052-244074 GGGGGGGGAGGAACTGCGGGAGG + Intergenic
1203605856 Un_KI270748v1:57107-57129 GTGGGGGGAGGGCGTGTGTGTGG + Intergenic
1185432690 X:18845-18867 GCGGGGGGAGGGTCTGGAGATGG - Intergenic
1185442041 X:231667-231689 GCGGGGGGAGGGTCTGGAGATGG - Intergenic
1185517746 X:713645-713667 ATGGGGGGAGGGGCAGCAGATGG + Intergenic
1185675635 X:1846997-1847019 GTGGGGTGAGGGGCTAGGGAGGG - Intergenic
1187281637 X:17861527-17861549 TTGGGGGGAGCGCCGGGGGAGGG + Intergenic
1187824908 X:23325097-23325119 GTGGGGGGAGGGGATAAGGATGG + Intergenic
1188242637 X:27809473-27809495 GCGGGGGGGGGGCCGGCGGGGGG - Intronic
1188596591 X:31908567-31908589 GTGGGGTGGGGGGCTGGGGAGGG + Intronic
1188923770 X:36012664-36012686 GTGGTTGGAGGGCATGGGGAGGG + Intergenic
1190011822 X:46791634-46791656 GTGGGGGGAGGGGCTGAGGCAGG + Intergenic
1190032989 X:46992286-46992308 GTGGGGGCAGGGCCGGGGCAGGG - Intronic
1190440643 X:50471309-50471331 GTGGGGGGGGGGGGTGCGGGGGG + Intergenic
1190745883 X:53321424-53321446 GCGGGGGGCGGGCCGGCGGCCGG - Intergenic
1192596411 X:72413247-72413269 GTGGGGGGAGGGACAGCGTTAGG - Intronic
1192921772 X:75714378-75714400 ATGGGTGGAGGGCCAGGGGAGGG - Intergenic
1192962522 X:76145385-76145407 GCGGGGGGAGGGCCGGGGGAAGG + Intergenic
1192963011 X:76149702-76149724 GCGGGGGGAGGGCCGGGGGAAGG - Intergenic
1193777806 X:85665050-85665072 GTGGGGGGAGGGGGAGGGGAGGG + Intergenic
1194041952 X:88952235-88952257 CTGTGGGGAGTGCCTGGGGAAGG - Intergenic
1194496547 X:94622926-94622948 GTTGGGGGAGGGCATGAGGTGGG + Intergenic
1194732758 X:97474966-97474988 GTGGGGGGAGGTCCTGGCAAAGG - Intronic
1195636121 X:107118194-107118216 GTGGGGGGAGGGGAGGTGGAAGG - Intronic
1196938544 X:120753198-120753220 GTGGGGCGGGGGGCTGCGGGAGG + Intergenic
1197421221 X:126238316-126238338 GAGGGGGTAGGGCCTGAGCATGG - Intergenic
1199017056 X:142830449-142830471 GTGGGGGGCGGGGGGGCGGAGGG - Intergenic
1199099760 X:143785197-143785219 GTGGGTGGAGGGCAAGGGGAGGG + Intergenic
1199403202 X:147424761-147424783 GTGGGTGGAGGGCAAGGGGAGGG + Intergenic
1199834241 X:151573029-151573051 GTGGGGGAAGGGCATGCTGGGGG + Intronic
1200065395 X:153502199-153502221 CTGTGGGGAGGGGCTGGGGAAGG - Intronic
1200090386 X:153633197-153633219 GTAGGGGGAGGACCTGGGTAGGG + Intergenic
1200090394 X:153633214-153633236 GTAGGGGGAGGACCTGGGCAGGG + Intergenic
1200121649 X:153794011-153794033 GTGGCGGGGGGCCCTCCGGACGG - Exonic
1201175510 Y:11306638-11306660 GTGGGGGGTGGGCGTGGTGATGG - Intergenic
1201282586 Y:12354175-12354197 TTGGGGTGAGGGCCTGGGGAGGG + Intergenic
1201893092 Y:18963806-18963828 GTGGGTGGAGGGGCTGGGGAGGG + Intergenic
1202374122 Y:24218048-24218070 GTGAGGGCAGGGCCTGGGGCTGG + Intergenic
1202496659 Y:25452072-25452094 GTGAGGGCAGGGCCTGGGGCTGG - Intergenic