ID: 1062689711

View in Genome Browser
Species Human (GRCh38)
Location 9:137834944-137834966
Sequence GGCCGGCGGCGTCTCATAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062689711_1062689729 29 Left 1062689711 9:137834944-137834966 CCCCCTATGAGACGCCGCCGGCC 0: 1
1: 0
2: 1
3: 3
4: 37
Right 1062689729 9:137834996-137835018 GCGTCGCCGATTAGAGGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 12
1062689711_1062689724 0 Left 1062689711 9:137834944-137834966 CCCCCTATGAGACGCCGCCGGCC 0: 1
1: 0
2: 1
3: 3
4: 37
Right 1062689724 9:137834967-137834989 AGCGGGGCGCTCGGGAGCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 176
1062689711_1062689723 -1 Left 1062689711 9:137834944-137834966 CCCCCTATGAGACGCCGCCGGCC 0: 1
1: 0
2: 1
3: 3
4: 37
Right 1062689723 9:137834966-137834988 CAGCGGGGCGCTCGGGAGCCAGG 0: 1
1: 0
2: 2
3: 31
4: 190
1062689711_1062689720 -8 Left 1062689711 9:137834944-137834966 CCCCCTATGAGACGCCGCCGGCC 0: 1
1: 0
2: 1
3: 3
4: 37
Right 1062689720 9:137834959-137834981 CGCCGGCCAGCGGGGCGCTCGGG 0: 1
1: 0
2: 1
3: 16
4: 149
1062689711_1062689726 23 Left 1062689711 9:137834944-137834966 CCCCCTATGAGACGCCGCCGGCC 0: 1
1: 0
2: 1
3: 3
4: 37
Right 1062689726 9:137834990-137835012 ACCGCCGCGTCGCCGATTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 3
1062689711_1062689719 -9 Left 1062689711 9:137834944-137834966 CCCCCTATGAGACGCCGCCGGCC 0: 1
1: 0
2: 1
3: 3
4: 37
Right 1062689719 9:137834958-137834980 CCGCCGGCCAGCGGGGCGCTCGG 0: 1
1: 0
2: 1
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062689711 Original CRISPR GGCCGGCGGCGTCTCATAGG GGG (reversed) Exonic
900100519 1:960302-960324 GGCCGGGGGCTTCCCAGAGGAGG + Intergenic
900318619 1:2071345-2071367 CCCCGGCGGCGTCTGAGAGGAGG + Intronic
904418354 1:30376103-30376125 GGCCATGGGGGTCTCATAGGAGG - Intergenic
905449110 1:38046020-38046042 GGGCGGCGGCGGCTCATCGGTGG - Exonic
918712457 1:187748418-187748440 GGCAGGTGGCATCTCATAGCAGG - Intergenic
1076734730 10:132453511-132453533 GCCCGGAGGAGGCTCATAGGAGG + Intergenic
1077466270 11:2735223-2735245 GGCAAGTGGCGTCTCATAGGGGG - Intronic
1078907843 11:15704157-15704179 GGCTGGAGGACTCTCATAGGAGG - Intergenic
1088452995 11:110001999-110002021 GGCCGGCAGAGTTTCATTGGTGG - Intergenic
1089078761 11:115759728-115759750 GGCCGGCGGCGATGCAGAGGCGG - Intergenic
1100830899 12:98515932-98515954 GGCCGGCAGCGTCACATTGTTGG - Exonic
1104729226 12:131095791-131095813 GGCTGGCGGCTTCTCAAAGACGG - Intronic
1123033446 14:105461862-105461884 GGCCAGCGGCCTCTCCAAGGCGG + Intronic
1127863543 15:63013710-63013732 GGCAGCCGGCGTCCCTTAGGAGG + Intergenic
1132499899 16:280630-280652 GGCGGGCGGCGGCTCCTCGGCGG + Exonic
1133805310 16:9122252-9122274 GGCCTGTGGCATCTCCTAGGAGG - Intergenic
1143393009 17:6571226-6571248 GGCTGCCGGCTTCTCATTGGAGG + Intergenic
1147710320 17:42458837-42458859 GGCCGGCGGCGGCGCAGGGGCGG + Intronic
1156171702 18:34493855-34493877 GGCCGGCGCCGGCGCACAGGTGG - Intronic
1163860602 19:19740790-19740812 GGCCGGCGGCGTCTCAGAGTTGG + Intergenic
1167379422 19:49129878-49129900 GACCGGAGGCATCTCATATGGGG + Intronic
933876189 2:86623576-86623598 GGCGGGCGGCGCCTCTCAGGCGG + Exonic
938780882 2:134583770-134583792 AGCAGGGGGCATCTCATAGGGGG - Intronic
1172770897 20:37382020-37382042 GGCAGGGGGCGTCTCATAGCTGG + Intronic
1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG + Intronic
1175482473 20:59321254-59321276 GGCCAGGGGCTTCTCAAAGGAGG + Intronic
1181309120 22:21934167-21934189 GGCCGGCGACTTCCCAAAGGCGG + Exonic
1183893684 22:40951073-40951095 GGCCGGGGGCTTCCCAGAGGAGG + Intergenic
1183912819 22:41092018-41092040 GGCCGGCGTCGACGCCTAGGGGG + Exonic
951555603 3:23917551-23917573 GGCAGGCGGCGTCCCCAAGGAGG - Intronic
957085029 3:75670214-75670236 GGGCGGCGGCCTCTCTTTGGCGG + Intergenic
966877912 3:184334007-184334029 GGCTGGCAGCATCTCATAGATGG + Intronic
968490351 4:886833-886855 GGCAGGAGGCGTCACAGAGGAGG + Intronic
1000230691 5:159312459-159312481 GGCCAGCAGCCTCTCATAGATGG + Intergenic
1019633823 7:2064827-2064849 GGACAGCGGCTTCTCCTAGGAGG + Intronic
1026941567 7:74290322-74290344 GGCGGGCGGCTTCTCTCAGGGGG + Intronic
1028871140 7:95772714-95772736 AGCCGGCGGCGGCTCCTGGGCGG - Exonic
1059705792 9:116822080-116822102 GGCCGGTGGGGTCTCATGGTGGG - Intronic
1061588407 9:131583203-131583225 GGCTGGCTGAGTCTCCTAGGTGG - Intronic
1062689711 9:137834944-137834966 GGCCGGCGGCGTCTCATAGGGGG - Exonic
1190285319 X:48957502-48957524 GGGCGGCGGCGGCTCGTTGGCGG + Exonic
1201904726 Y:19077026-19077048 GGCCAGCGGCGTCTCTTACTGGG + Intergenic