ID: 1062696195

View in Genome Browser
Species Human (GRCh38)
Location 9:137877609-137877631
Sequence AGCCCCGGGGTGGGAGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 520}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062696176_1062696195 19 Left 1062696176 9:137877567-137877589 CCGTCGAGGACCCACAGGCTCGT 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG 0: 1
1: 0
2: 7
3: 52
4: 520
1062696177_1062696195 9 Left 1062696177 9:137877577-137877599 CCCACAGGCTCGTCCGCTCCTGG 0: 1
1: 0
2: 0
3: 33
4: 119
Right 1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG 0: 1
1: 0
2: 7
3: 52
4: 520
1062696184_1062696195 -9 Left 1062696184 9:137877595-137877617 CCTGGGCCCGGCCCAGCCCCGGG 0: 1
1: 0
2: 13
3: 187
4: 1438
Right 1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG 0: 1
1: 0
2: 7
3: 52
4: 520
1062696182_1062696195 -4 Left 1062696182 9:137877590-137877612 CCGCTCCTGGGCCCGGCCCAGCC 0: 1
1: 0
2: 6
3: 98
4: 745
Right 1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG 0: 1
1: 0
2: 7
3: 52
4: 520
1062696179_1062696195 8 Left 1062696179 9:137877578-137877600 CCACAGGCTCGTCCGCTCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG 0: 1
1: 0
2: 7
3: 52
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062696195 Original CRISPR AGCCCCGGGGTGGGAGGCGC GGG Intergenic
900179918 1:1306543-1306565 AGCCTTGGAGTGGGAGGCTCAGG - Intronic
900227662 1:1540503-1540525 AGGCGCGGGGGGGGGGGCGCCGG + Intergenic
900294543 1:1942461-1942483 AGCCCCTGGGTGCGGGGCCCTGG + Intronic
900349578 1:2228241-2228263 CGCCTCGCGGTGGGAGGAGCGGG + Intergenic
900398516 1:2463204-2463226 AGCCCCGGAGGGGGAGCTGCAGG + Intronic
900619493 1:3580375-3580397 AGCCCCGGGAGGGGAGGCTCCGG + Intronic
901208143 1:7509012-7509034 AGACCCGGGAAGGGAGGCCCAGG - Intronic
901443461 1:9293115-9293137 GGCCCGGGAGGGGGAGGCGCGGG + Intronic
901597827 1:10399207-10399229 ACCCCCAGGGTGGGAGGCGTCGG - Intronic
901783418 1:11609137-11609159 AGCCCCGGTGTGGGACCCACTGG + Intergenic
901793072 1:11664516-11664538 CGGCCAGGGGTGGGGGGCGCGGG + Intronic
902502749 1:16921860-16921882 ACCACCGCGGTGGGAGGAGCAGG - Intronic
902586177 1:17439744-17439766 CGCGGCGGGGCGGGAGGCGCGGG + Intergenic
903353792 1:22734078-22734100 TGGCCCTGGGTGGGAGGCCCAGG - Intronic
903408275 1:23117502-23117524 AGCCCTGGGGGGGGGGGCGGGGG + Intronic
903468529 1:23568719-23568741 AGACCCGGGGAGGGAGACGAGGG - Intergenic
903490882 1:23727410-23727432 AGCCCCAGCGTGGGAGGCCGGGG + Intergenic
903652450 1:24930191-24930213 AGCTTCGGGGCGGGAGGCGGCGG - Intronic
903652608 1:24930683-24930705 AACCCCGGGCTGGGGGCCGCGGG + Intronic
903814065 1:26051774-26051796 AGGCCCAGGGTGGGAGGGGTCGG - Exonic
904289974 1:29478595-29478617 AGCCCCGGGCAGGGCAGCGCGGG - Intergenic
904413814 1:30342757-30342779 AGCCCCGGGCAGGGCAGCGCGGG + Intergenic
904775066 1:32901375-32901397 AGCCCGGGGCTGGGCGGCGCCGG + Intronic
904809051 1:33151446-33151468 AGCCTCGGGGAGGGAGCCCCAGG - Intronic
905028236 1:34865624-34865646 AGCCCCTGGGAGGGTGGGGCGGG + Exonic
905137129 1:35808363-35808385 GGGCCCGGAGCGGGAGGCGCCGG + Exonic
905199031 1:36304040-36304062 TGCCCAGGGGAGAGAGGCGCTGG + Exonic
905214560 1:36397719-36397741 AGCCCCGGGGCGGAATGCGGGGG - Intronic
905311412 1:37051661-37051683 AGCCCCGGGTGGGGAGGTGGTGG - Intergenic
905414673 1:37795567-37795589 AGCTCCGGGGCGCGAGGCTCTGG + Intronic
905775423 1:40664888-40664910 AGCCCTGGGGTGGGAAGAGGGGG - Intronic
905803582 1:40861171-40861193 GGCAGCGGGGTGGGAGGCTCAGG + Exonic
906041890 1:42793919-42793941 AGCCCTGGGCTGGGAGGCAAGGG + Intronic
906079852 1:43078483-43078505 AGCCCTGAGGTGGGAGGTGGGGG + Intergenic
906262834 1:44406689-44406711 AGCCCCGGGTTGGGGGGCGGGGG - Intronic
906416232 1:45622898-45622920 GGCTCCGGGGTGGGAGGGGCGGG - Intronic
906565633 1:46799220-46799242 AGCCAGTGGGTGGGAGGCCCTGG - Exonic
906714045 1:47953834-47953856 AGCACTGGAGTGGGAGGCACTGG - Intronic
907248278 1:53121734-53121756 AACACCGGGGTGGGAGGGGGAGG + Intronic
907527639 1:55063190-55063212 ACCGCCTGGGTGGGAGGTGCGGG + Intronic
908605473 1:65792998-65793020 AGCCCCGGGAAGGGGCGCGCGGG - Intronic
909935705 1:81547758-81547780 AGCCCCTGGGAGGGAGAAGCTGG - Intronic
910388028 1:86705278-86705300 AGCCCCGGGGTGGAGGCCACAGG - Intronic
914717737 1:150266132-150266154 AGTCCTCGGGTGGGATGCGCAGG + Exonic
915213406 1:154325775-154325797 AGCCGCGGGGCTGGAGGGGCCGG + Intronic
915313857 1:155017448-155017470 GGCCCCGGGGAGGGAGCGGCGGG - Exonic
915543160 1:156581603-156581625 AGCCCCCAGGTTGAAGGCGCAGG - Exonic
915552251 1:156642045-156642067 GGCCCCGGGGAGGGCGGGGCAGG + Exonic
915935209 1:160086379-160086401 AGCCCCGGGCAGGGAGGACCAGG + Intronic
916496595 1:165353365-165353387 TTCCCTGGGGTGGGGGGCGCTGG - Intronic
916940139 1:169668432-169668454 AGCCCCGGCGTGGGATCCACTGG + Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
918265477 1:182838566-182838588 AACCCCGGGGTCGGGGGCGGAGG - Intergenic
919781845 1:201226130-201226152 AGCCCCTGAGAGGGAGGAGCAGG + Intronic
920317521 1:205088665-205088687 ACCTCCTGGGTGGGAGGCACAGG + Exonic
921389623 1:214605600-214605622 AGCCCCTGGGGGGCCGGCGCGGG + Intronic
922239933 1:223748900-223748922 AGGCCTGGGGTGGGAGGCTCAGG - Intronic
922505257 1:226122255-226122277 AGGCCGGGGGTGGGAGGCGCGGG - Intergenic
922894190 1:229088073-229088095 GACCCCGGCGTGGGAGGGGCTGG - Intergenic
923539098 1:234875624-234875646 AGGCCCCGGGTGGGAGGGGTTGG + Intergenic
923908182 1:238409320-238409342 AGCCTCCGGGTGGGAGCCACAGG - Intergenic
924343914 1:243056805-243056827 AGCCACTGGGTGGCAGGAGCTGG + Intergenic
1063387133 10:5623111-5623133 AGCCACGGGCTGGGTGGAGCTGG - Intergenic
1064001109 10:11664428-11664450 AGCCCTTGGGTTGGAGGCGTGGG - Intergenic
1064460996 10:15534973-15534995 AGGCACGGGGGGAGAGGCGCAGG + Intronic
1065099888 10:22321849-22321871 AGGCGCGGGGCGGGCGGCGCGGG - Intronic
1065802682 10:29366600-29366622 AGCCCTGGTGTGGGATCCGCTGG + Intergenic
1065844753 10:29735648-29735670 TGCTCCGGGGCGGGAGGCGCGGG - Intronic
1066235379 10:33480407-33480429 AGCCCCGGTGTGGGATCCACCGG - Intergenic
1068560801 10:58512834-58512856 AGCCCTGCGGATGGAGGCGCGGG + Intergenic
1068560842 10:58512960-58512982 CGCCCGGGGCTGGGATGCGCCGG + Intergenic
1069740144 10:70682147-70682169 GGCCCCTGGGTTGGAGGGGCAGG + Intronic
1070148106 10:73789221-73789243 AGCCAGGGGATGGGAGGAGCAGG - Intronic
1070865218 10:79704507-79704529 AGCCCCTGGGTGGGCGAGGCTGG + Intronic
1070879009 10:79842638-79842660 AGCCCCTGGGTGGGCGAGGCTGG + Intronic
1071632116 10:87226728-87226750 AGCCCCTGGGTGGGCGAGGCTGG + Intronic
1071645569 10:87358947-87358969 AGCCCCTGGGTGGGCGAGGCTGG + Intronic
1071900932 10:90119769-90119791 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1072757516 10:98030699-98030721 GGGCCCGGGGTGGGGGGCGCCGG + Exonic
1072845465 10:98825599-98825621 AGCCCCGGGGTTGGGGGGGCGGG + Intronic
1073048775 10:100654922-100654944 AACCCCGGGGTGAGGGGCGATGG - Intergenic
1073051166 10:100668236-100668258 AGCCCTGTGGGGGGAGGGGCGGG - Intergenic
1073068772 10:100780373-100780395 AGGCCCGGGGTTTGAGGGGCTGG + Intronic
1073111899 10:101067454-101067476 AGCCTCGGCTTGGGAGGAGCTGG - Intronic
1074188456 10:111116254-111116276 AGCCTCGGGGTGGGTAGAGCTGG - Intergenic
1075712474 10:124538031-124538053 GGGCCTGGGGTGGGAGGCTCAGG - Intronic
1076118718 10:127919446-127919468 AGCCCACGGGTGGCAGGAGCAGG - Intronic
1076491366 10:130863868-130863890 AGCGGCAGGGTGGGAGGCCCAGG + Intergenic
1077008393 11:369595-369617 GGGCCCGGGGTGGGCGGCGGGGG - Intergenic
1077017955 11:405236-405258 AGGCCCAGGGTGGGCGGCGGAGG - Intergenic
1077377298 11:2211042-2211064 AGCCAAGGGGTGGGGGGAGCAGG + Intergenic
1077549238 11:3192702-3192724 AGCCTCGGGGTGGGAAGTGGGGG + Intergenic
1077556414 11:3228157-3228179 AGCCCCGGGGTGGGGGCCGCTGG + Exonic
1077764671 11:5144817-5144839 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1078359108 11:10654612-10654634 AGCCCAGTGGTAGGAGACGCTGG + Intronic
1080283773 11:30586013-30586035 CGCCCCGGGAAGGGAGGCGGAGG - Intronic
1080406899 11:31987569-31987591 AGCCCCGGGGTGGCGGGCGCGGG + Intronic
1080418602 11:32091467-32091489 GGCCCCGTGGGGGGCGGCGCAGG + Intronic
1081671515 11:44945233-44945255 AGCCCCGGGGTAGGTGGCCCTGG - Intronic
1081671522 11:44945245-44945267 ACCCCGGGGCTGGGAGGAGCGGG + Intronic
1081831528 11:46120012-46120034 GGCCCCGGGGTGAGGGGTGCAGG + Intronic
1081851492 11:46277939-46277961 CGGCCCCGGGTGGGGGGCGCGGG - Exonic
1081899795 11:46617929-46617951 CGCCCCCGGGTGGGAGGCTGTGG + Intronic
1082675393 11:56094023-56094045 AGCCATGAGGTGGGATGCGCAGG - Exonic
1083171089 11:60924490-60924512 AGCCGCGGGGCGGGCGGCGGCGG + Exonic
1083268378 11:61557788-61557810 AGCCCAGGAGAGGGAGGGGCAGG - Intronic
1083553879 11:63610517-63610539 AGCCACGGGCTGAGAGGGGCTGG - Intronic
1083849414 11:65356247-65356269 AGCCCCGGGGGAGGTGGCTCAGG - Exonic
1083901743 11:65646707-65646729 CCTCCCTGGGTGGGAGGCGCCGG + Exonic
1083953116 11:65967597-65967619 GGCCAGGGGGTGGGAGGGGCAGG + Intronic
1084265639 11:68003917-68003939 GGACCCGGAGTGCGAGGCGCGGG - Intronic
1084448410 11:69217867-69217889 AACCTCGGGGTTGGAGGCGTGGG + Intergenic
1085387961 11:76167988-76168010 AGCCCTGGGGTGGGAGGGGAGGG - Intergenic
1088481743 11:110301263-110301285 AGGCCCGGAGGGAGAGGCGCGGG - Intergenic
1089244748 11:117110711-117110733 CTGCCCGGGGCGGGAGGCGCCGG + Intergenic
1089395803 11:118135876-118135898 AACCCCAGGGTGGGAGGGGGTGG + Exonic
1089744798 11:120609195-120609217 ATCCCCGAGGTGGGAGGGGCTGG - Intronic
1090370332 11:126246569-126246591 AACCCTGGGGCGGGAGGCGGTGG + Intronic
1091312732 11:134586081-134586103 TGTCCCTGGGTGGGAGGCCCTGG - Intergenic
1091550370 12:1531198-1531220 GGCTCCGGGGTCGGCGGCGCAGG + Intronic
1091744525 12:2982614-2982636 AGCCCCGGGATGTGGGCCGCGGG + Intronic
1091799162 12:3313880-3313902 AGCCACGGGGGTGGAGGAGCAGG - Intergenic
1092230297 12:6772439-6772461 AGCCCTGGGGTGCGGGGGGCGGG + Intergenic
1092538106 12:9405049-9405071 AGCCCCGGGGGGAAAGGCGCTGG - Intergenic
1092538481 12:9406007-9406029 AGCCCGGGGGGGAAAGGCGCTGG - Intergenic
1092572345 12:9739509-9739531 AGCCCCGGTGTGGGATCCACCGG - Intergenic
1092617071 12:10225552-10225574 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1094218546 12:27970468-27970490 AGCTCCGGGGTCGGCAGCGCGGG - Intronic
1095098322 12:38159501-38159523 AGCCCCGGGGGGGGAAGAACAGG + Intergenic
1096715382 12:53487998-53488020 AGTACCTGGGTGGGAGGCCCGGG - Intronic
1097178958 12:57160019-57160041 GGCCTTGGGGTGGGAGGAGCTGG + Intronic
1098320542 12:69239515-69239537 GGCCCGAGGGAGGGAGGCGCGGG - Exonic
1098320654 12:69239956-69239978 AGCGCCGGCGAGGGAGGAGCCGG - Intronic
1098973457 12:76878878-76878900 AACCCCGGGGCGGGAGTTGCAGG - Intronic
1099202467 12:79691336-79691358 CGCCCCGGAGTCGGAGGCGCCGG - Intergenic
1100329693 12:93571714-93571736 AGCCCCGCGCTCGGAGGCGGCGG - Exonic
1100395967 12:94186684-94186706 AGTCTCGGGGCGGGAGGGGCAGG + Intronic
1101308819 12:103557606-103557628 AGCCCAGGGTTGGGAGGCTAGGG - Intergenic
1102058499 12:109914637-109914659 AGCCCAAGGGCGGGAGGCACCGG + Intronic
1102453018 12:113055742-113055764 TGCCCCGGGGAGGCAGGCGTGGG + Intergenic
1103563219 12:121803479-121803501 AGCTCCGGGGAGGGGGTCGCGGG + Intergenic
1103853364 12:123947382-123947404 AGCCCCGGTGTGGGATCCACTGG + Intronic
1103932303 12:124457281-124457303 AGCACGGGGGAGGGAGGCCCGGG + Intronic
1104894062 12:132153298-132153320 TCCCCCGCTGTGGGAGGCGCTGG + Intergenic
1105322786 13:19344743-19344765 AGCCCCGGGAAGGTGGGCGCGGG - Intergenic
1105745592 13:23375035-23375057 GGGCCCGGGGTGGGCGACGCAGG - Intronic
1105828231 13:24141659-24141681 ACCCCCTGCGTGGCAGGCGCTGG - Intronic
1105874827 13:24541972-24541994 AGCCCCGGGAAGGTGGGCGCGGG + Intergenic
1106187840 13:27424711-27424733 GGCCCTGGGCTTGGAGGCGCCGG + Exonic
1106255745 13:28020625-28020647 AGGCCGGGGGTGGGTGGCTCAGG - Intronic
1106555162 13:30803118-30803140 CGCCCTGGGGTGGCAGGCACCGG + Intergenic
1106602561 13:31200226-31200248 CGGCGCGGGGAGGGAGGCGCAGG + Intronic
1107037976 13:35920721-35920743 GGAACCGGGGTGGGAGGTGCCGG + Intronic
1107307376 13:39037683-39037705 GGCGGCGGGGAGGGAGGCGCCGG + Exonic
1108046270 13:46387304-46387326 GGCCCCCGTGTGGGAGGCGGGGG - Exonic
1108221084 13:48233553-48233575 CGCCCCGAGGTGGCGGGCGCGGG + Intronic
1108373342 13:49792280-49792302 GGCCCCGGGCTGGGCGGAGCGGG - Intronic
1110775676 13:79405874-79405896 TGGGCCGCGGTGGGAGGCGCCGG + Exonic
1112041510 13:95552679-95552701 AGCCCCGGGGTTGGGAGTGCGGG + Intronic
1113565570 13:111317764-111317786 AGCCCTGGGGTGGGAGGGGCAGG - Intronic
1113696088 13:112346467-112346489 AGCCCCGAGGCGGGAGCTGCCGG + Intergenic
1113760460 13:112842886-112842908 ACCCACGGAGTGGGAGGCTCAGG - Intronic
1114533333 14:23408670-23408692 AGCCCATGGTTGGGAGGCGGAGG - Intergenic
1115651292 14:35404343-35404365 GGCCTGGGGGTGGGAGGCGCCGG - Intronic
1117297637 14:54393861-54393883 AGCCCCGGTGCGGGATCCGCTGG + Intergenic
1117302592 14:54443473-54443495 AGCCCCGGTGTGGGATATGCTGG + Intergenic
1119038920 14:71254718-71254740 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1119259349 14:73228305-73228327 TGCCCCGGGCTGGGAGGGGCTGG + Intergenic
1120439031 14:84512847-84512869 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1120813090 14:88824888-88824910 AGCCCCGGGTTGGGAGGCCGGGG + Intronic
1121958344 14:98235709-98235731 AGCTCCAGGGAGGGAGGCGAGGG + Intergenic
1122064195 14:99160197-99160219 AGCCCCGGAGAGTGAGGGGCAGG + Intergenic
1122842499 14:104473269-104473291 AGGCTTGGGGTGGGAGGGGCTGG - Intergenic
1123031952 14:105456121-105456143 AGCCCCAGGCTGGGAGACCCTGG - Intronic
1123033806 14:105463673-105463695 AGCCCCCGGGAGGGCGGCCCAGG + Intronic
1123493178 15:20799213-20799235 AGCCCCGGGAGGGGAGAGGCGGG - Intergenic
1123549684 15:21368315-21368337 AGCCCCGGGAGGGGAGAGGCGGG - Intergenic
1123707075 15:22958561-22958583 AGCCCCAAGGTGGGGGGCGGAGG - Intronic
1123988060 15:25662386-25662408 AGCATTGGGGTGGGAGGGGCAGG + Intergenic
1124135273 15:27029763-27029785 AGCCCCGAGCTGGCAGGCTCTGG + Intronic
1124628716 15:31325736-31325758 CAGCCCGGGCTGGGAGGCGCGGG + Intergenic
1124983173 15:34582933-34582955 TGCCCCGGGGCTGCAGGCGCCGG - Intronic
1125506661 15:40271401-40271423 AGCCCCCGGGAGGGAGGAGAAGG - Intronic
1128113892 15:65093623-65093645 AGCCCTGGGGTCGGAGGGGAAGG - Intronic
1128119198 15:65133435-65133457 GGCCCCGGGCCGGGAGGCGGTGG + Exonic
1128547773 15:68579312-68579334 AGCCCGGGGGATGCAGGCGCCGG - Intronic
1128709829 15:69863529-69863551 AGCCCCAGGCTGGGAGCTGCTGG - Intergenic
1129426570 15:75467767-75467789 ATCCCAGGGATGGGAGGCGGAGG - Exonic
1131414800 15:92245369-92245391 AGCCCGGGAGTGGGAGCAGCTGG - Intergenic
1202958015 15_KI270727v1_random:95533-95555 AGCCCCGGGAGGGGAGAGGCGGG - Intergenic
1132568162 16:632529-632551 AGCCCCGGGGCGGGGGGCATTGG + Intronic
1132629499 16:910338-910360 AGCCCCGGGGTGGGGGTGGCGGG - Intronic
1132642823 16:985393-985415 AGCCGCGGGGAGGGACTCGCAGG + Exonic
1132724830 16:1334096-1334118 TCCCCCGGGGAGGGAGGCGCGGG - Intronic
1132976904 16:2715571-2715593 AGCATCTGGGTGGGAGGGGCTGG + Intronic
1132977130 16:2716465-2716487 GGCCCTGGGGTGGGAGGGACAGG - Intronic
1133062304 16:3182945-3182967 AGCCCAGGGCTGAGAGGCGGAGG - Intergenic
1133136684 16:3717332-3717354 TGCTCCGGGGAGCGAGGCGCCGG - Intronic
1136245826 16:28975209-28975231 AACCCCGGGGTGCCAGGCACTGG - Exonic
1136341746 16:29648519-29648541 GGCCCCCGGGTCAGAGGCGCCGG + Intergenic
1138390922 16:56669471-56669493 GGCCCCGGGGTGTGGGGCGCAGG + Intronic
1138490398 16:57372977-57372999 GGCACTGGGGTGGGAGGCCCTGG + Intronic
1138554091 16:57762112-57762134 AGCCCCAGGGTGTGCGGAGCAGG - Intronic
1138693527 16:58790708-58790730 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1139403047 16:66696951-66696973 AGAGCCGGGGCGGGAGCCGCTGG + Intergenic
1140065926 16:71611162-71611184 AGGCTCAGGCTGGGAGGCGCGGG - Intergenic
1140478841 16:75251792-75251814 AGCCTCGGGGTTGGAGGTGGGGG - Intronic
1141840015 16:86568197-86568219 AGCCCGGGGGCCGGACGCGCGGG + Exonic
1141925267 16:87164312-87164334 AGCCCCTGGGTGGGGTGCGATGG + Intronic
1142226102 16:88878345-88878367 AGCCCCGGGGTGGGAGGAGATGG - Intronic
1142251092 16:88992444-88992466 ACCCCGGGGGTGGGATGCGGAGG - Intergenic
1142259720 16:89037023-89037045 TGCACCGGGGTGTGAGGTGCAGG + Intergenic
1142307691 16:89294776-89294798 AGGCCTGGGGTAGGAGGGGCAGG - Intronic
1142358740 16:89616310-89616332 AGCCCCGGAGTGGGTGACCCAGG - Intronic
1143030463 17:3964471-3964493 CGCCCCGGGGAGGGAGTCCCGGG - Intergenic
1143321234 17:6070466-6070488 AGCCCCGGGGAGCCAGGCGGCGG + Intronic
1143483356 17:7239302-7239324 GGCTCCGGGGAGGGGGGCGCCGG - Exonic
1143664201 17:8347057-8347079 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1144816731 17:18040023-18040045 AGGTCCCGGGTGGGAAGCGCCGG - Intronic
1144836825 17:18160941-18160963 GGCCCAGGGCTGGGAGGAGCAGG - Intronic
1144956989 17:19023640-19023662 AGCCGCGGGGTGGGGGGTGGGGG - Intronic
1145191535 17:20844314-20844336 AGCCCCTGGGGGGCCGGCGCGGG - Intronic
1145193360 17:20866998-20867020 AGCCCTTGGGTGGGGAGCGCTGG - Intronic
1145217102 17:21060866-21060888 GGCCCCAGGGTGGAAGGCGACGG - Intergenic
1146197373 17:30824827-30824849 AGCCGCGGGGCGGGCGGCGCTGG - Intergenic
1147050360 17:37789885-37789907 AGCCCTGGGGTGACAGGTGCAGG + Intergenic
1147183633 17:38702289-38702311 AGCTCCGGGCCGGGAGGTGCGGG + Intergenic
1147754935 17:42761668-42761690 AGTGCCGGGGAGGGAGGGGCTGG - Intronic
1147864971 17:43546061-43546083 AGGGCGGGGGTGGGAGGTGCTGG - Intronic
1148081601 17:44970117-44970139 AGCCCAGGGGTAGGGGGCTCAGG + Intergenic
1148209295 17:45798657-45798679 TGCCCTGGGGTGGGAGAGGCAGG + Intronic
1148781327 17:50123691-50123713 TGCCCAGGGCTGGGAGGAGCAGG - Intronic
1150311037 17:64129827-64129849 AGCCCAGCCGTGGGAGGCTCGGG - Intronic
1150587406 17:66531401-66531423 ATCTCCGGGGTGGGAGCCGGTGG + Intronic
1150692528 17:67378115-67378137 ACCCCCGGGGCGGGAAGCGGGGG - Intronic
1150904999 17:69327412-69327434 AACCCAGGCGTGGGAGGCCCTGG - Intergenic
1151667500 17:75553696-75553718 TCCCCCGGGGTGGGAGGCGGGGG + Intronic
1151883059 17:76906246-76906268 AGCCCCTGGGAGGGAGGGGTGGG - Intronic
1152268339 17:79309336-79309358 AGCCACGGGGTGGGAGAGGAAGG - Intronic
1152319593 17:79601043-79601065 GGCCCCGGGGCGGGAGCAGCGGG - Intergenic
1152619012 17:81352119-81352141 AGCCCACGGGTGGGGGGCGCGGG + Intergenic
1152736755 17:82000995-82001017 ACCCCCGAGGCGGGAGGGGCAGG - Intronic
1152749032 17:82054130-82054152 AGCACAGGGGTGGGAGATGCAGG - Intronic
1152764116 17:82126649-82126671 AGCCTCTGGGTGGGTGGCGGAGG + Intronic
1152772617 17:82179558-82179580 AGCCACGGGGTGGGCAGGGCTGG + Intronic
1154012674 18:10589205-10589227 GGCCCCGGGCCGGGAGGCGATGG + Intergenic
1154078945 18:11235017-11235039 AGCCCTGGGAGGGGAGGAGCAGG - Intergenic
1154297517 18:13163298-13163320 AGCCCTGGGAGGGGAGGCGTGGG - Intergenic
1154450725 18:14473750-14473772 AGCCCCGGGAGGGGAGAGGCAGG - Intergenic
1157481970 18:48060817-48060839 AGCTCTGGGGTGTGAGGTGCTGG + Intronic
1159455985 18:68660731-68660753 AGACCTGGGCTGGGAGACGCGGG + Intergenic
1160231922 18:77055213-77055235 AGCCTCTGTGTGGGAGGAGCAGG + Intronic
1160255975 18:77249609-77249631 CGCGCCGGGGTGGGAGGCGGAGG - Intergenic
1160344747 18:78123776-78123798 AGCCCTGGGCGGGGAGGAGCAGG - Intergenic
1160583645 18:79901223-79901245 AGCCCAGGGTGGGGAGGGGCAGG - Intergenic
1160703149 19:517841-517863 AGGCCCGGGCTGGGCGGTGCTGG + Intronic
1160703248 19:518095-518117 AGCCCCGGGCTGGGGGGTGCTGG + Intronic
1160745322 19:708768-708790 TGCCCCGGGGCGGGGCGCGCGGG + Intergenic
1160766029 19:808468-808490 GGCCCCGGGGTGGAGGGGGCAGG + Intronic
1160790353 19:920152-920174 GGCACCGTGGTGGGAGGCGCCGG + Intronic
1161110917 19:2469540-2469562 AGGCCTGGGGTGGGAGGAGGTGG - Intergenic
1161175809 19:2841672-2841694 GGCCCCGGCGAGGGCGGCGCAGG + Intronic
1161235594 19:3196551-3196573 GGCCCTGGGGTGGGAGGCAGCGG - Intronic
1161304086 19:3557416-3557438 AGCCCGGGGGTGGGGGGCGCGGG - Exonic
1161370961 19:3910738-3910760 AGCCCTGGGGAGGGAGGAGCTGG - Intronic
1161378079 19:3950353-3950375 GGCCCTGGGGTGGGGGGCGGGGG - Intergenic
1161407838 19:4100344-4100366 TGCTCCCGGGTGGGAGGCGGAGG + Intronic
1162029853 19:7912607-7912629 GACCCCGGGGTGGGAAGGGCGGG - Exonic
1162459637 19:10806889-10806911 AGCCCCTAGGTGAGAGCCGCTGG + Intronic
1162908508 19:13837084-13837106 GGCCACGGGGGGGGAGGCCCTGG - Intergenic
1162939057 19:13997203-13997225 ATCCCGGGGGAGGGAGGCACAGG - Intronic
1162954454 19:14090515-14090537 CCCCCCGGGGGGGGAGGCGGAGG - Exonic
1163015572 19:14451938-14451960 GGCCCCGGGCTGGGCGGCTCAGG - Exonic
1163020656 19:14479432-14479454 GGCCCCGGGATCGGAGCCGCAGG + Exonic
1163314199 19:16531381-16531403 TGCCCAGCGGGGGGAGGCGCCGG + Intronic
1164624105 19:29715217-29715239 AGCCCCGCGGAGGGTCGCGCAGG + Intronic
1164758285 19:30707385-30707407 GGCCCTGGGTTGGGAGGCGAAGG - Intronic
1165796814 19:38524433-38524455 AGCCCTGGGGTGGGGGCTGCTGG - Intronic
1165907161 19:39201101-39201123 AGCCCTGGGCTGGGTGGTGCTGG - Exonic
1166344476 19:42156737-42156759 TGCCCTGGGATGGGAGGCGCAGG - Intronic
1166759494 19:45215814-45215836 AGCCCAGGGCAGGGGGGCGCAGG - Intronic
1166800088 19:45451232-45451254 AGCCACAGCGCGGGAGGCGCTGG - Intronic
1167114405 19:47480346-47480368 AGCCCAGAGCTGAGAGGCGCCGG + Exonic
1167139196 19:47638024-47638046 AGCCCCGGGCAGAGAGGGGCTGG - Intronic
1167152894 19:47719759-47719781 GGCCCTGGGGTGGGAGCCCCAGG - Intronic
1167425778 19:49429010-49429032 AGCCCTGGGGTGGGAGGGGCTGG + Intergenic
1168106518 19:54168729-54168751 AGTCCAGGGGTAGGAGGGGCTGG - Intronic
1168241048 19:55089041-55089063 AGCCCCGTGGTCGGAGAAGCTGG - Intergenic
1168258268 19:55179013-55179035 GGCCCCGGGGTTGGGGGCTCCGG + Exonic
1168315193 19:55481989-55482011 GGCGGCGGGGCGGGAGGCGCGGG - Exonic
1168335212 19:55593402-55593424 GGCCCCGAGGGGGCAGGCGCGGG - Exonic
1168349780 19:55669209-55669231 ACCCTGGGGGTGGGAGGGGCTGG + Intronic
925416022 2:3670687-3670709 AGACCCTGGGTGGCAGGCCCTGG - Intronic
927811873 2:26184995-26185017 AGCCCGGGGGCGCGCGGCGCGGG - Exonic
927900621 2:26815766-26815788 GGCCGCCGGGTGGGGGGCGCCGG + Intergenic
928178222 2:29049578-29049600 AGCCCCAGGGTGGGAGATGAGGG - Intronic
928336680 2:30404421-30404443 AGCCCTGATGTGGGAGGAGCTGG - Intergenic
929188757 2:39120881-39120903 AGCCCCGGGCGGGGCGGAGCTGG + Intronic
929461191 2:42102831-42102853 CTCCCCGCGGTGGGAGGAGCGGG + Intergenic
930033902 2:47073933-47073955 AGCCGCAGGGAGGGAGGGGCTGG + Exonic
930700832 2:54456687-54456709 AGCCCGGGCGGGGGCGGCGCGGG + Intronic
933678435 2:85078131-85078153 GGCCCAGGGGTGGGAGGCTTTGG + Intergenic
933983731 2:87573996-87574018 GGCCCCTGGCTGGGAAGCGCTGG + Intergenic
934647173 2:96065734-96065756 TGCCCCAGGGTGGGATGAGCAGG + Intergenic
935866460 2:107392545-107392567 AGCCGCGGGGTGGGGGACTCAGG - Intergenic
936122061 2:109755577-109755599 AACCTGGGGGTGGGAGGAGCAGG - Intergenic
936222633 2:110615897-110615919 AACCTGGGGGTGGGAGGAGCAGG + Intergenic
936310120 2:111376798-111376820 GGCCCCTGGCTGGGAAGCGCTGG - Intergenic
936516730 2:113185788-113185810 AGCCCCAGGGAGGGAGCCTCTGG + Intronic
937281022 2:120717196-120717218 AGCTCTGGGATGGGAGGCCCTGG + Intergenic
938054979 2:128208139-128208161 AGCCCCGGGCTCGGAGACCCTGG + Intergenic
938075010 2:128327344-128327366 AGGCCAAGGCTGGGAGGCGCAGG - Intergenic
938406370 2:131035280-131035302 CGCGCCGGGGTGAGTGGCGCGGG + Intronic
939677295 2:145088315-145088337 AGCCCAGGGGTGGGAGTGCCTGG + Intergenic
940420993 2:153478846-153478868 AGCCCGGCCGTGGGAGGTGCGGG + Intergenic
941089663 2:161160302-161160324 AGCCCTGGGCTGGGTGGGGCAGG + Exonic
941951304 2:171160198-171160220 AGCCCCGGGGCGGGGGGGGCGGG + Intronic
946146367 2:217734174-217734196 AGCAATGGGGTGGGAGGGGCAGG + Intronic
947669442 2:231926966-231926988 AGGACTGGGGTGGGAGGCGCAGG + Intergenic
947743252 2:232494585-232494607 AGCCCCAGGGTGGGTGGCAGTGG - Intergenic
948047168 2:234952914-234952936 GGCCCCGGGCTAGGAGCCGCGGG - Intronic
948449639 2:238061069-238061091 GGCGCCGGGGAGGGATGCGCCGG + Exonic
948515837 2:238503471-238503493 AGCCCCTGGGCGGGAGGGTCAGG - Intergenic
948808520 2:240463253-240463275 AGCCCCAGGGTAGGGGGCTCTGG - Intronic
1169143556 20:3238931-3238953 AGCCGCGGGGAGGAGGGCGCGGG - Intronic
1169214740 20:3786525-3786547 CGCCCCGGGGCGGGGGGCCCGGG + Exonic
1170359987 20:15535714-15535736 AACCCAGAGGTGGGAGACGCGGG - Intronic
1170567354 20:17614667-17614689 AGCCCCGGGGAGGCAGGACCGGG - Intronic
1170800490 20:19586181-19586203 AGCCACTGCGTGGGAGGCTCTGG + Intronic
1171205016 20:23272412-23272434 AGCTCCTGGGTGGGAGGTGTGGG - Intergenic
1171439427 20:25148489-25148511 CGCCCCGGGGTGGGGGGAGGCGG - Intergenic
1171996502 20:31735810-31735832 AGGCCGGGGGTGGGGGGCGGGGG - Intergenic
1172100337 20:32481481-32481503 AGCCCCAGGGTAGGGGCCGCAGG + Intronic
1172539364 20:35699203-35699225 AGCCCCCGAGTGGGCGCCGCGGG + Exonic
1172873822 20:38152262-38152284 AGCCCAGGGGTCTGAGGGGCCGG - Intronic
1172887437 20:38240719-38240741 AGCCCAGGAGTGGGGGGCTCAGG + Exonic
1174119499 20:48251996-48252018 AGCCCTGGGACTGGAGGCGCTGG - Intergenic
1174169094 20:48605132-48605154 AGGCCTGGGGAGGGAGGCACGGG + Intergenic
1174548130 20:51341858-51341880 ATCCCCGGGGTGGGAGCAGGGGG - Intergenic
1174607041 20:51768465-51768487 CGCCCCGGGGGAGGAGGCGGCGG + Exonic
1174812080 20:53654671-53654693 AGCCGCGGGGTGGGATGAGGTGG + Intergenic
1175025103 20:55893712-55893734 AGCCCAGGGGTGAGAGGTGCTGG - Intergenic
1175250996 20:57610193-57610215 AGCCCAGGGGTGGCTGGCCCAGG - Exonic
1175279229 20:57792110-57792132 AGCGCCTGGCTGGGAGGCTCTGG + Intergenic
1175929564 20:62487349-62487371 AGCCGCGGGGAGGGAGGAGTGGG + Intergenic
1176025835 20:62985172-62985194 AGGCCCTGGGAGGGAGGCCCAGG + Intergenic
1176445508 21:6816824-6816846 AGCCCCGGGAGGGGAGAGGCGGG + Intergenic
1176823676 21:13681857-13681879 AGCCCCGGGAGGGGAGAGGCGGG + Intergenic
1177188111 21:17819669-17819691 TGCCCCGGGGCGGGGGCCGCAGG + Intergenic
1177565757 21:22818797-22818819 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1178404863 21:32315855-32315877 GGCCCAGGGGAGGGAGGGGCTGG - Intronic
1178536052 21:33411319-33411341 GGCTCCGGGGTGGGTGGCGAGGG - Intronic
1178585574 21:33868256-33868278 AGCCCCGGTGTGGGATCCACTGG - Intronic
1178983281 21:37283124-37283146 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1179571070 21:42279249-42279271 AGCTCTGGAGAGGGAGGCGCTGG + Intronic
1180010986 21:45051290-45051312 ATGCCCGGGGTGGGGGACGCTGG - Intergenic
1180843817 22:18970942-18970964 AGGTCCGGGGTGGGGGCCGCGGG + Intergenic
1180855259 22:19041357-19041379 AGCCTGGGGGTGGGGGGCTCAGG - Intronic
1181026895 22:20131912-20131934 GGCCCCGGGGAGGGATGCGGCGG + Intronic
1181120759 22:20667742-20667764 AGCCCCTGGGGGGCCGGCGCGGG + Intergenic
1181134968 22:20758803-20758825 AGGCCAGGGATGGGAGGTGCAGG - Intronic
1181174895 22:21029806-21029828 AACCCCAGTGTGGGAGGTGCAGG + Exonic
1181333724 22:22114769-22114791 AGCCCCTGGGGGGCCGGCGCGGG + Intergenic
1181572011 22:23772858-23772880 AGCCCCGGGGCGGATGGCTCCGG + Exonic
1181585239 22:23849469-23849491 CGCACCGGGGCGGGTGGCGCAGG + Intergenic
1182283521 22:29231439-29231461 AGCCCTGGGGTGGGGGGGGTAGG - Intronic
1182364135 22:29766631-29766653 AGCCCAGGGGTGAGAGGAACAGG + Intronic
1183228069 22:36563696-36563718 AGCCCCTGGGTGGGTGCCCCAGG - Intergenic
1183363627 22:37395818-37395840 AGGCCCAGGGTGGGAGGGGCAGG + Intronic
1183368237 22:37418387-37418409 AGCCCCTGGGCAGGAGGAGCAGG + Intronic
1183586571 22:38756172-38756194 AGTCCGCGCGTGGGAGGCGCTGG + Intronic
1183587524 22:38761395-38761417 GGCCCCGGGCTGGCAGCCGCAGG - Intronic
1183818354 22:40322965-40322987 AGCTGCGGGGTGGCAGTCGCTGG + Exonic
1183942026 22:41301449-41301471 GCGCCCGGGGTGGGCGGCGCGGG - Intergenic
1184412089 22:44331464-44331486 AGCCCCGGGGCGGGCAGGGCGGG - Intergenic
1184569077 22:45310565-45310587 AGCCTCAGGGTGGGCGGCACGGG - Intronic
1184580359 22:45413047-45413069 ACCCCCAGGGTGGGGGGCGAGGG + Intronic
1184676291 22:46045083-46045105 TGTCCCGGGGTGGCGGGCGCCGG + Intergenic
1184679419 22:46062079-46062101 GGCCCCGGGGCGGGAGGTGCGGG - Intronic
1184680799 22:46071351-46071373 CGTCCCGGGGTGGGGGGCGGTGG + Intronic
1184798052 22:46743161-46743183 AGCCAGGGGGTGGGAGGTGGAGG + Intergenic
1185148540 22:49151875-49151897 GGCCCTGGGGTGGGTGGCCCTGG - Intergenic
1185246921 22:49777641-49777663 AGCTGCGTGGTGGGAAGCGCAGG + Intronic
949559372 3:5187959-5187981 GGCCCCGAGGTGGGCGACGCGGG - Exonic
950144056 3:10635302-10635324 AGCCCCGGGTTTGGAGTCTCTGG + Intronic
952233554 3:31455918-31455940 TGCCCCGGGGAGAGAGGTGCTGG + Intergenic
953326246 3:42014147-42014169 AGCCCCTGGGCCCGAGGCGCAGG - Intronic
953351414 3:42219197-42219219 AGTCTGGGGGTGGGAGGCGAGGG - Intronic
953614450 3:44477646-44477668 AGCCGCCGGGAGGTAGGCGCGGG - Intronic
955688151 3:61564558-61564580 AGGACAGTGGTGGGAGGCGCAGG + Intronic
955818803 3:62874875-62874897 AGCGCCGGGCTGGGGGGCGGCGG - Exonic
956825952 3:72996993-72997015 AGACCCGCGGAGGGAGGCGGAGG + Exonic
957009110 3:74985064-74985086 AGCCCCGGTGTGGGATCCACTGG - Intergenic
961359197 3:126356857-126356879 AGCCCGGGGTTGGGGGGCGGAGG - Intronic
961809365 3:129513071-129513093 GGACCCTGGGTGGGAGGGGCCGG + Intronic
963603124 3:147393835-147393857 TGCCTCGGGGAGGGAGGCGCGGG - Intronic
963872116 3:150428329-150428351 AGGCCCAGGGTAGGAGGGGCAGG + Intronic
965520373 3:169663797-169663819 AGCCGCGGGGAGGGCGGCGGGGG + Intergenic
965773085 3:172201257-172201279 AGCCCCAGTGGGGGAAGCGCAGG + Intronic
965875288 3:173310331-173310353 AGGCCAGGGGTGGGAGTTGCGGG - Intergenic
966751970 3:183330971-183330993 AGCCCTGGGGTGGGGGTGGCGGG - Intronic
967925313 3:194641062-194641084 AGCCCCCTGGTGGGAGGCGATGG - Exonic
968050490 3:195651661-195651683 AGACCCGCGGAGGGAGGCGGAGG - Intergenic
968093053 3:195909780-195909802 CGCCCCGGGGTGGGGGGTGGGGG + Intronic
968096832 3:195937198-195937220 AGACCCGCGGAGGGAGGCGGAGG + Intergenic
968105335 3:195996693-195996715 AGACCCGCGGAGGGAGGCGGAGG + Intergenic
968492245 4:896184-896206 AGCCCAGGGGCGGGAGGCTGCGG + Intronic
968545108 4:1194366-1194388 AGCCCCAGGGTGGGAGGCCTGGG + Intronic
968562308 4:1290369-1290391 AGCCCAGGGCTGGGAGGTGCCGG + Intronic
968730175 4:2265795-2265817 AGGCCCAAGGTGGGAGGGGCAGG - Intergenic
968789184 4:2647680-2647702 AGGCCAGGGGTGGGAAGCGGGGG - Intronic
968805284 4:2767985-2768007 AGCCCCGGAGTGGGAGGGCCTGG + Intergenic
968922955 4:3532117-3532139 GGCCCAGGGGTCGGAGGCGGAGG - Intronic
968953196 4:3705329-3705351 AGCCCCAGGTTGGGAGGTGCAGG + Intergenic
972396669 4:38664139-38664161 GGACCCGGGGTGGGAGGGTCAGG - Intergenic
974716023 4:65669707-65669729 GGCCCCGGGGTGCGGGACGCCGG - Exonic
975755941 4:77571085-77571107 AGCCCCGGTGTGGGATCCACTGG + Intronic
980027529 4:127783304-127783326 AGCCTCGGGATGGGAGTCACTGG + Intronic
980715744 4:136626318-136626340 AGCCATGGGGTGGGGGGTGCAGG - Intergenic
981782705 4:148444994-148445016 TGACCCGGGGAGGGGGGCGCAGG - Intergenic
981796970 4:148606302-148606324 AGCCCAGGGGTGGGATGCTATGG + Intergenic
982217348 4:153094003-153094025 AGCCGTGGGGAGGGAGGCGCAGG - Intergenic
982370445 4:154627428-154627450 AGCCCAGGGGAGGGAGACGGAGG - Intronic
983290640 4:165799488-165799510 GGCGCCGGGGTGGGAGGCTCAGG + Intergenic
984727558 4:183036181-183036203 TGTCCCTGGGTGGGAGGGGCTGG + Intergenic
985515824 5:344098-344120 AGCTCCGGCGCGGGCGGCGCAGG + Intronic
985654778 5:1124649-1124671 AGCACAGGGGAGGGAGGCCCTGG + Intergenic
985664812 5:1176584-1176606 AGCTGCGGGGTCGGGGGCGCAGG + Intergenic
985995743 5:3596043-3596065 AGGCGCGGGGAGGGAGGCGGAGG - Exonic
986165649 5:5269574-5269596 AGCAGCGGGGTTGGAGGCACAGG - Intronic
986721735 5:10564901-10564923 AGCCAGGAGCTGGGAGGCGCGGG - Intronic
986737461 5:10678705-10678727 AGCCCCGGCTTGGGAGTGGCTGG - Intergenic
987146175 5:14993742-14993764 AGCCCCGGTGTGGGATCCACTGG - Intergenic
988796373 5:34656549-34656571 AGCTCGGGCGCGGGAGGCGCTGG + Intronic
989003278 5:36783003-36783025 AGCCCCGGTGTGGGATCCACTGG + Intergenic
989956924 5:50369860-50369882 AGCCCCGGTGTGGGATCCACAGG + Intergenic
997984598 5:138492335-138492357 TGGCCCGGCGCGGGAGGCGCGGG + Intergenic
999449087 5:151665156-151665178 AGCCCTGGGATGGGAGGAGGAGG + Intronic
1000248236 5:159468243-159468265 AGTCCGGGGGTGGGGGGTGCAGG - Intergenic
1000319071 5:160119327-160119349 TCCCCCGGGGAGGGGGGCGCCGG - Exonic
1001191546 5:169637199-169637221 AGCCCCGGCGAGGGAGGAGAGGG + Intergenic
1002029023 5:176414680-176414702 AGCCCAGAGTTGGGAGGCGTGGG + Intronic
1002093490 5:176817840-176817862 AGGCCGGGGGTGGGTGCCGCGGG + Intronic
1002308151 5:178296483-178296505 AGCCCCTGCGTGGGATCCGCGGG - Intronic
1002368457 5:178730674-178730696 CGCCGCGGGGTGAGCGGCGCCGG - Exonic
1002446958 5:179295757-179295779 AGAGTCGGGGTGGGAGGAGCTGG + Intronic
1003498729 6:6686994-6687016 AGCCCCGGAGGAGGAGGCCCAGG - Intergenic
1003512620 6:6793956-6793978 GGCCCAGCGGTGGGAGGGGCAGG - Intergenic
1003578247 6:7316761-7316783 AGCCCCGGTGTGGGATCCACTGG - Intronic
1003717778 6:8666391-8666413 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1003979831 6:11379134-11379156 AGGCCCTGGGTGGAAGGCACTGG + Intronic
1004342030 6:14816360-14816382 AGCCTGGGGGTGGGGGGAGCTGG + Intergenic
1004504920 6:16239551-16239573 TGCCCCGGGGTGGTGTGCGCTGG + Intronic
1005751274 6:28885219-28885241 AGCCCACGGGTGGGAGGGTCGGG + Intergenic
1005763528 6:28988883-28988905 CGCCCCGGGGTGGGGGGGGGGGG + Intergenic
1006163241 6:32049959-32049981 AGCCCCAGGGTGGGAGCTGTGGG - Intronic
1006164492 6:32056547-32056569 AGCCCCAGGGTGGGAGCCGTGGG - Intronic
1006165496 6:32062118-32062140 AGCCCCAGGGTGGGAGCCATGGG - Intronic
1006166448 6:32068351-32068373 AGCCCCAGGGTGGGAGCCATGGG - Intronic
1006446317 6:34081706-34081728 AGGCCTGAGGTGGGAAGCGCTGG + Intronic
1006694592 6:35920701-35920723 AGCGCCCGGGCGGGATGCGCCGG + Intronic
1008027430 6:46653444-46653466 AGGCCCGCGGTGGGAGGAGGAGG + Intronic
1008254143 6:49275866-49275888 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1008567900 6:52786907-52786929 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1009808716 6:68635019-68635041 AGCCGCGGGGTGGGAGAGGAGGG - Intergenic
1014798330 6:125749682-125749704 AGGCCCGGGGAGGGAGGAGGCGG + Exonic
1015402069 6:132798444-132798466 CGCACCGGGGATGGAGGCGCTGG - Exonic
1015492122 6:133838100-133838122 AGCCCCCGGGGAGCAGGCGCGGG - Intergenic
1015514346 6:134069725-134069747 AGCCCAGCGGTGAGAGGAGCTGG + Intergenic
1015799273 6:137044475-137044497 AGCCCCGGGGCTGGAAGCTCCGG + Intronic
1017140303 6:151183984-151184006 AGCCCTGGGGTGGTAAGGGCAGG - Intergenic
1018064160 6:160114454-160114476 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1018137085 6:160789172-160789194 AGCCCTGGGGAGGGGGGCGGGGG + Intergenic
1018368900 6:163149610-163149632 AGCCCGGGGGAGGGAGGAGAAGG - Intronic
1018600378 6:165532159-165532181 AGCCCCGAGACGGGAGGAGCTGG - Intronic
1018828465 6:167424247-167424269 AGGGCCGGGGTGGGAGACCCCGG - Intergenic
1018964761 6:168475797-168475819 AGCCAGTGGGTGGGAGCCGCAGG + Intronic
1019301428 7:306017-306039 AGGCCCGGGCTGGAGGGCGCAGG - Intergenic
1019354613 7:572089-572111 AGCCTCGGGGTGAGGGGAGCTGG - Intronic
1019396697 7:823812-823834 CGCCCTGGGGAGGGAGGAGCAGG + Intronic
1019461361 7:1160537-1160559 GTGCCCGGGGCGGGAGGCGCCGG - Intronic
1019475389 7:1241712-1241734 AACCCCGAGCTGGGAGGAGCGGG + Intergenic
1019485270 7:1286299-1286321 GGCCCTGAGGTGGGAGGGGCCGG + Intergenic
1019487623 7:1296533-1296555 AGCCCCAGGATGGGAGCCCCCGG - Intergenic
1019534735 7:1523131-1523153 AGCCCCGGAGAGGGAGGAGGTGG - Intergenic
1019631657 7:2052847-2052869 AGCATGGGGGAGGGAGGCGCTGG + Intronic
1019805148 7:3118084-3118106 AACCACTGGGTGGGAGGCGATGG - Intergenic
1020046704 7:5046056-5046078 AGCCCCGGAGCCGGCGGCGCTGG + Exonic
1020111732 7:5451544-5451566 AGCCCCCGGGTGGGAACCGCAGG - Intronic
1020407737 7:7855631-7855653 AGGCCTGTGGTGGGAGGAGCTGG + Intronic
1022207793 7:28180316-28180338 AGCCCCGAGGTGGGGGTGGCGGG - Intronic
1022410459 7:30135449-30135471 AGCCCCGGGCCGGGCGGTGCGGG + Intronic
1022449832 7:30504533-30504555 GGCCCCGGCGTGGGTAGCGCGGG + Intronic
1023791677 7:43758328-43758350 GGCCCCGGCGTGGGGGGGGCAGG - Intergenic
1024228487 7:47346319-47346341 AGCCCCTGGGCGGGAGACTCAGG - Exonic
1024526029 7:50350088-50350110 AGCCCCGGGGTGGGCCTTGCAGG + Intronic
1024864990 7:53895696-53895718 AACCCCGGGATGGGAGGCTTGGG - Intergenic
1026516643 7:71078410-71078432 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1027121897 7:75527903-75527925 AGCCCCGGAGTCGGCGGCGCTGG - Intergenic
1028852442 7:95552403-95552425 AGCCCCGGTGTGGGATCCACTGG - Intergenic
1029425125 7:100489918-100489940 AGCCCCGGGAAGGGAGGGGCAGG - Intronic
1029438945 7:100576969-100576991 AGCCCCTGCTTGGGAGGCACTGG + Exonic
1029567581 7:101348998-101349020 AGCCCCGGTGTGGGATTCACTGG + Intergenic
1029575204 7:101398940-101398962 AGCCCCTGGGTGGGCTGCACAGG + Intronic
1032174515 7:129612176-129612198 AGCTCGGGAGCGGGAGGCGCGGG + Intronic
1033214334 7:139483011-139483033 AGCCCCGCGGAAGGAAGCGCCGG - Exonic
1033601357 7:142891283-142891305 ATCCCTGGGGTGGGAGGTGTAGG - Intergenic
1034441417 7:151087617-151087639 AGCGACCGCGTGGGAGGCGCCGG + Intronic
1035029866 7:155849911-155849933 GGCCCAGGGGTGGGAGGTGGAGG + Intergenic
1035350752 7:158244922-158244944 TGCCCCGGGGTGGGGGCCGTGGG + Intronic
1035424334 7:158757645-158757667 AGCCGCGGGGTGCCTGGCGCGGG - Intronic
1035585556 8:770324-770346 CTCCCCAGGGTGGGAGGCGGAGG - Intergenic
1036165220 8:6426349-6426371 TGCCCTGGGGTGGGAGGAGGGGG - Intronic
1037591149 8:20313172-20313194 AGCCCAGTGCTGGGAGGGGCAGG + Intergenic
1037855274 8:22367193-22367215 AGCCCCGGGGCGAGCGGGGCGGG + Intergenic
1039404822 8:37303492-37303514 AATCCAGGGGTGGGAGGTGCCGG + Intergenic
1041686944 8:60652612-60652634 AGCCGGGGGCGGGGAGGCGCCGG + Intergenic
1042687989 8:71462579-71462601 ACCCCCAGGGTGGCAGGCTCCGG + Intronic
1043472593 8:80578043-80578065 GGCCCCCGGAGGGGAGGCGCCGG - Intergenic
1043954321 8:86343020-86343042 AGCCCGGGGGCGGACGGCGCCGG - Intronic
1044823730 8:96177336-96177358 AGGGCTGGGGTGGGAGGTGCTGG - Intergenic
1045023566 8:98064740-98064762 AGCCCGGGCGCGGGCGGCGCCGG - Intronic
1045459068 8:102411700-102411722 GGCCCCGGGGTGGGCTGGGCTGG - Intronic
1047274574 8:123396093-123396115 GGCCTGGGGGTGGGCGGCGCCGG - Intronic
1047498861 8:125427465-125427487 GGCCCCTGGGTGGGCGGAGCTGG + Intergenic
1048165183 8:132055898-132055920 GGGGACGGGGTGGGAGGCGCAGG + Intronic
1048351595 8:133620958-133620980 AGACCCAGGGTGGGAGGACCTGG - Intergenic
1049060621 8:140273561-140273583 AGGCCTGGGGTGGGAGGGGAAGG - Intronic
1049217184 8:141413567-141413589 AGCTCTGGGGTGGGAGGCTGGGG + Intronic
1049580449 8:143408346-143408368 TGCTGCGGGGTGGGAGGAGCAGG - Intergenic
1049609991 8:143550405-143550427 ACCCCCGGGGTGGGTGTGGCTGG - Intergenic
1049675647 8:143887709-143887731 AGCCCCTGGGAGGAAGGGGCTGG + Intergenic
1049689397 8:143952075-143952097 GATCCCGAGGTGGGAGGCGCTGG + Intronic
1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG + Intronic
1049697149 8:143990002-143990024 AGCTTCGGGGTGGGAGGGGCAGG - Intronic
1049759712 8:144326506-144326528 GGCCCCGACGTGGGAGCCGCGGG - Exonic
1055049436 9:71963960-71963982 AGCCCCGGAGTGGGATCCACGGG + Intronic
1055315343 9:75028547-75028569 GGCCCCTTGGTGGGAGGCGGAGG + Intergenic
1056740539 9:89250690-89250712 ATCCCCGGGGGGGGAGGGGGTGG + Intergenic
1057026410 9:91737069-91737091 AGGCCCGGGGCAGGAGGCCCTGG + Intronic
1057266551 9:93621473-93621495 GGCCCAGGGGTGGGTGGTGCTGG + Intronic
1057371793 9:94480224-94480246 GGCCACTGGGTGGGAGGGGCTGG - Intergenic
1059395017 9:114028737-114028759 TGCCCCCGGGTGGGAGCCACCGG + Intronic
1059810687 9:117852407-117852429 AGCCCCGGTGTGGGATCCACTGG + Intergenic
1060417861 9:123445348-123445370 AGCCCAGGGGTGGAATGCCCTGG - Intronic
1061020254 9:128009731-128009753 AGCCCTGAGATGGGAGGAGCGGG - Intergenic
1061222463 9:129260138-129260160 AGCACAGGGGTGTGAGGCGGAGG - Intergenic
1061290928 9:129649874-129649896 AGCTCTGGGGTGGGGGCCGCTGG + Intergenic
1061782625 9:133004808-133004830 AGCCCAGAGGAGGGAGGAGCTGG + Intergenic
1061941794 9:133887795-133887817 AGCCCCTGGGTGGGGGGCGGGGG - Intronic
1062008162 9:134252159-134252181 AGGCCCGGGGTGGGAAGGGCGGG - Intergenic
1062363198 9:136197263-136197285 TGCCCCTGGGTGGGCGGCTCGGG - Exonic
1062460654 9:136661333-136661355 AGCCCCTGGGTGGGAGAGCCAGG + Intronic
1062500128 9:136848673-136848695 GGCCCTGGGGTAGGGGGCGCGGG - Exonic
1062520166 9:136954460-136954482 AGACCCGGGGTGGGAGGAGGTGG - Intronic
1062520219 9:136954571-136954593 AGACCCGGGGTGGGAGGAGGTGG - Intronic
1062565088 9:137160809-137160831 AGCCCCGGGGGGGTGGGGGCTGG - Intronic
1062574608 9:137200368-137200390 GCCCCCGGGGCGGGCGGCGCGGG + Exonic
1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG + Intergenic
1203523687 Un_GL000213v1:67701-67723 AGCCCCGGGAGGGGAGAGGCGGG - Intergenic
1186107929 X:6226772-6226794 AGCCGCGGAGTGGAGGGCGCAGG + Intronic
1186898606 X:14030035-14030057 AGCGCCGGGGCGGCAGGCGTGGG + Intergenic
1188168531 X:26892576-26892598 AGCCCCTGGGTGGCATGCTCAGG - Intergenic
1189491589 X:41474795-41474817 TCCCGTGGGGTGGGAGGCGCGGG + Exonic
1189767953 X:44391441-44391463 AGCCTAGGGGTGGGAGTTGCAGG - Intergenic
1190296498 X:49030546-49030568 AGCCCTGGAGTGGGAGGTACTGG + Exonic
1190330128 X:49230620-49230642 AGCACCGGGCAGGGAGGCGGAGG + Intronic
1190726937 X:53195885-53195907 AGGCCTGGGGTGGGAGTGGCAGG + Intronic
1190881491 X:54495476-54495498 AGCTCCTGGGGCGGAGGCGCGGG + Exonic
1192203781 X:69082995-69083017 AGCCCTGGGGGGAGAGGGGCCGG - Intergenic
1192451897 X:71249955-71249977 AGCCCCAGGATGGGAGGGGCAGG + Intronic
1195140971 X:101959393-101959415 AGCCTCTGGGTGGGAGCCACAGG + Intergenic
1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG + Intronic
1197526868 X:127575170-127575192 AGTTCCGAGGTGGGAGGGGCAGG + Intergenic
1197749970 X:129957501-129957523 AGCCCCGGGGTCAGAGCGGCCGG + Intergenic
1200083479 X:153591245-153591267 AGCCCCGAGCTGGGAGGCAAAGG + Intronic
1200117980 X:153777438-153777460 AGCCAGGGTGTGGGAGGGGCAGG + Intronic
1200146629 X:153929736-153929758 GGCCCCGGGGAAGGAGGCCCTGG - Exonic
1200989219 Y:9334282-9334304 AGCCCAGGGCTGGGAAGCGCTGG - Intergenic
1201291046 Y:12421107-12421129 AGGCTTGGGGAGGGAGGCGCAGG - Intergenic