ID: 1062698015

View in Genome Browser
Species Human (GRCh38)
Location 9:137885227-137885249
Sequence TGTCCCACGGGGCCACATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062697999_1062698015 28 Left 1062697999 9:137885176-137885198 CCCTCCAGGCAGCCTGGGTTGTG 0: 2
1: 0
2: 5
3: 22
4: 279
Right 1062698015 9:137885227-137885249 TGTCCCACGGGGCCACATGCTGG No data
1062698009_1062698015 -2 Left 1062698009 9:137885206-137885228 CCCCGGGTTGGAGGTGATCTGTG 0: 2
1: 0
2: 0
3: 5
4: 107
Right 1062698015 9:137885227-137885249 TGTCCCACGGGGCCACATGCTGG No data
1062698000_1062698015 27 Left 1062698000 9:137885177-137885199 CCTCCAGGCAGCCTGGGTTGTGC 0: 2
1: 0
2: 2
3: 39
4: 264
Right 1062698015 9:137885227-137885249 TGTCCCACGGGGCCACATGCTGG No data
1062698011_1062698015 -4 Left 1062698011 9:137885208-137885230 CCGGGTTGGAGGTGATCTGTGTC 0: 2
1: 0
2: 1
3: 9
4: 146
Right 1062698015 9:137885227-137885249 TGTCCCACGGGGCCACATGCTGG No data
1062698001_1062698015 24 Left 1062698001 9:137885180-137885202 CCAGGCAGCCTGGGTTGTGCAGG 0: 2
1: 1
2: 6
3: 32
4: 295
Right 1062698015 9:137885227-137885249 TGTCCCACGGGGCCACATGCTGG No data
1062698010_1062698015 -3 Left 1062698010 9:137885207-137885229 CCCGGGTTGGAGGTGATCTGTGT 0: 2
1: 0
2: 1
3: 12
4: 154
Right 1062698015 9:137885227-137885249 TGTCCCACGGGGCCACATGCTGG No data
1062698004_1062698015 16 Left 1062698004 9:137885188-137885210 CCTGGGTTGTGCAGGGAACCCCG 0: 2
1: 0
2: 0
3: 8
4: 143
Right 1062698015 9:137885227-137885249 TGTCCCACGGGGCCACATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062698015 Original CRISPR TGTCCCACGGGGCCACATGC TGG Intronic
No off target data available for this crispr