ID: 1062699996

View in Genome Browser
Species Human (GRCh38)
Location 9:137894269-137894291
Sequence CCACAGCCTCGCCGGCACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062699985_1062699996 16 Left 1062699985 9:137894230-137894252 CCGTTTCACATTTCCAGCAGCAC 0: 1
1: 4
2: 30
3: 339
4: 1921
Right 1062699996 9:137894269-137894291 CCACAGCCTCGCCGGCACGGGGG No data
1062699987_1062699996 3 Left 1062699987 9:137894243-137894265 CCAGCAGCACAGGAGCCGTCCCT 0: 1
1: 0
2: 1
3: 13
4: 191
Right 1062699996 9:137894269-137894291 CCACAGCCTCGCCGGCACGGGGG No data
1062699984_1062699996 17 Left 1062699984 9:137894229-137894251 CCCGTTTCACATTTCCAGCAGCA 0: 1
1: 0
2: 0
3: 43
4: 340
Right 1062699996 9:137894269-137894291 CCACAGCCTCGCCGGCACGGGGG No data
1062699983_1062699996 30 Left 1062699983 9:137894216-137894238 CCAGAGTGGATGTCCCGTTTCAC 0: 1
1: 0
2: 2
3: 13
4: 238
Right 1062699996 9:137894269-137894291 CCACAGCCTCGCCGGCACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062699996 Original CRISPR CCACAGCCTCGCCGGCACGG GGG Intronic
No off target data available for this crispr