ID: 1062703262

View in Genome Browser
Species Human (GRCh38)
Location 9:137919202-137919224
Sequence GGTCCTACTGAAACACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062703262_1062703266 7 Left 1062703262 9:137919202-137919224 CCAGCATGTGTTTCAGTAGGACC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1062703266 9:137919232-137919254 TGCTGGCTCCGCTTACACAGTGG No data
1062703262_1062703268 17 Left 1062703262 9:137919202-137919224 CCAGCATGTGTTTCAGTAGGACC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1062703268 9:137919242-137919264 GCTTACACAGTGGTGAGCAGAGG No data
1062703262_1062703263 -10 Left 1062703262 9:137919202-137919224 CCAGCATGTGTTTCAGTAGGACC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1062703263 9:137919215-137919237 CAGTAGGACCCAGTGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062703262 Original CRISPR GGTCCTACTGAAACACATGC TGG (reversed) Intronic
900801400 1:4739133-4739155 TGTCCCACTCAAACACATGTGGG + Intronic
903258854 1:22120496-22120518 GGCCATCCTGACACACATGCGGG - Exonic
904065513 1:27747122-27747144 GGTCCTACTGAATTAAATTCTGG - Intronic
907985297 1:59524300-59524322 GTTCCTACTGAGGCACCTGCAGG - Intronic
914356040 1:146885524-146885546 GGACCCACTGAAACTCATGATGG + Intergenic
914482999 1:148083074-148083096 GGTCAGACTGAAGCACAAGCTGG + Intergenic
919081807 1:192876141-192876163 GAATCTACTGAAACACATCCAGG - Intergenic
922584460 1:226723101-226723123 GGGCCTACTGGAACCCATGCAGG - Intronic
924796008 1:247292647-247292669 GGTCTTACTGTCACACAGGCTGG + Intergenic
1063100824 10:2948625-2948647 AGTCAAACTGAAACACATACAGG + Intergenic
1064320190 10:14297630-14297652 GGTGCTTATTAAACACATGCAGG - Intronic
1064351317 10:14579990-14580012 AGTCTTGCTGTAACACATGCTGG - Intronic
1071565336 10:86668687-86668709 GGTCACACTGTAAGACATGCTGG - Exonic
1074265539 10:111899374-111899396 GTTCCTTCTTAAACACATTCTGG - Intergenic
1075647030 10:124103411-124103433 AGTCCTACTCAAACCCTTGCAGG - Intergenic
1077709593 11:4522849-4522871 TGACCTACTGAGACACAAGCCGG + Intergenic
1078298433 11:10100359-10100381 GGGGCTACTGAACCACAGGCAGG - Intronic
1079148606 11:17876894-17876916 GGTCCTGCTGCAAAGCATGCAGG + Intronic
1082064198 11:47885636-47885658 GGTCCTACTCACACCCATGCAGG + Intergenic
1084164332 11:67367986-67368008 GGTACAACTGGAACACAGGCAGG - Intronic
1084399469 11:68935283-68935305 GGTCCACCTGAAACACCAGCCGG - Exonic
1086029809 11:82340603-82340625 GGTCTTAGTGAAAATCATGCAGG - Intergenic
1088928212 11:114323301-114323323 GGTCATATAGAAACACATGTAGG + Intergenic
1089307533 11:117536073-117536095 GCTCCTCCTGAAACAAAGGCAGG + Intronic
1089692612 11:120196353-120196375 GGCCCTACTGAAACCCAACCCGG + Intergenic
1089709712 11:120306253-120306275 GGACTTACTGCAACCCATGCTGG + Intronic
1096202011 12:49691011-49691033 GGTCTTACTGTCACACAGGCTGG - Intronic
1097794815 12:63850269-63850291 TGACCTTCTGAAACACATGAGGG + Intronic
1101148706 12:101865509-101865531 GGGGCTACTGAACCACAGGCAGG + Intergenic
1104308488 12:127632574-127632596 GGAACTACTGAGACACATCCAGG - Intergenic
1111427396 13:88104856-88104878 GGTCCTACTGAAAAAGAAGCTGG + Intergenic
1118790889 14:69091736-69091758 TGTCAAACTGAAACACAGGCAGG + Exonic
1120140041 14:80919818-80919840 TGTACTAGTGAAACTCATGCCGG - Intronic
1131512123 15:93055275-93055297 GGTCCCACTGCAACACAAGCAGG + Intronic
1137596555 16:49727781-49727803 GTTCCTACAGAAACATCTGCAGG + Intronic
1138499151 16:57428001-57428023 GGTCCTGCTGAAACTCAAGGGGG + Intergenic
1139977976 16:70829938-70829960 GGACCCACTGAAACTCATGATGG - Intronic
1140330565 16:74052837-74052859 GGTCCTACTGTCACCCAGGCTGG - Intergenic
1145200269 17:20938598-20938620 GGTCCTCCAGGAACACATGGAGG - Intergenic
1148218088 17:45844876-45844898 GTTCCTACTGCAACATCTGCGGG - Exonic
1152520212 17:80851642-80851664 GGTGCTGATGAAACACACGCGGG - Intronic
1153364984 18:4246000-4246022 AGTGGTACTGAAACACTTGCAGG - Intronic
1155984583 18:32216594-32216616 GCTCCAACTCAACCACATGCTGG - Intronic
1157585631 18:48799438-48799460 GGTCCTACTGGATCCCATGTTGG + Intronic
1159638807 18:70839314-70839336 GGCCCTTCAGAAACACATTCTGG - Intergenic
1160154534 18:76423631-76423653 GGTCCCCCCGAAACACACGCAGG + Intronic
1164786337 19:30934108-30934130 GGTCCTAGTGACAGACCTGCGGG - Intergenic
1167482936 19:49744328-49744350 GGGCCCACTGAAACCCATTCTGG - Exonic
925251334 2:2441394-2441416 GGTCCTCCTGATATACTTGCAGG - Intergenic
926671749 2:15583201-15583223 AGTCCTTCTGAAACTCATCCGGG + Intergenic
931675980 2:64696685-64696707 GGTCCTATTGAAAAAGATGTGGG - Intronic
936753509 2:115675966-115675988 TGTTGTACTGAAGCACATGCAGG + Intronic
944776156 2:202967710-202967732 TTTCCTACTGAAACACTTGTAGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946509154 2:220335444-220335466 GGACCTAATGAAACACCAGCTGG - Intergenic
947751187 2:232533465-232533487 TCTCCTACTGATGCACATGCAGG - Intronic
1168850018 20:970026-970048 GGTCCTGATGAAACACATCCTGG + Intronic
1171062387 20:21978372-21978394 GGTCATTCTCAAACACATGTTGG - Intergenic
1174787605 20:53447185-53447207 GGTCCTACAAAAACACTTGAAGG - Intronic
1177664496 21:24136420-24136442 GGTCCTACTAAGAGACAGGCTGG - Intergenic
1181871326 22:25901512-25901534 AGTCCTACTGAAAGTCATCCAGG - Intronic
1184297810 22:43536807-43536829 GGTCTTACTGTCACACAGGCTGG - Intronic
949999006 3:9641980-9642002 GGGGCTACTGAACCACAGGCAGG + Intergenic
950493921 3:13322443-13322465 GGCCCTGCTGGAAGACATGCAGG - Intronic
951089370 3:18554370-18554392 GGTCCCACTGTTACACATGAGGG + Intergenic
955864065 3:63363195-63363217 TTTTCTACTGAAACATATGCCGG - Intronic
957752948 3:84446649-84446671 GGACATCCTGAAACACATGTGGG + Intergenic
958755448 3:98245673-98245695 AGTCCTACTCAGACACCTGCTGG + Intergenic
959474278 3:106790480-106790502 TGGCCTACTGAGACACAAGCTGG + Intergenic
961765303 3:129205752-129205774 GGTTCTACAGAAACACATGGGGG + Intergenic
961963263 3:130874838-130874860 AGTCCTACTGAATCAAATTCTGG - Intronic
965749493 3:171961171-171961193 GGCCATCCTGAAACTCATGCAGG - Intergenic
965869563 3:173249718-173249740 GGAGCTACTGAACCACAGGCAGG + Intergenic
968583428 4:1405209-1405231 GGCCCTACTGAAGCACAGGGAGG - Intronic
974486163 4:62508855-62508877 GGACCTACTGAAAAATTTGCAGG + Intergenic
984041819 4:174744351-174744373 GGTCCTACTGACACAGGTGCTGG + Intronic
986339998 5:6780717-6780739 GGAGCTACAGAAACAGATGCTGG - Intergenic
993026705 5:82655186-82655208 AGTCCCTCTGAAACACTTGCAGG - Intergenic
994903899 5:105811260-105811282 GATCCTAAGGAAACATATGCTGG + Intergenic
995008245 5:107227306-107227328 GGTCTTTCTGATACACAGGCAGG - Intergenic
1004597221 6:17111473-17111495 AGTCCTACTGAAGGACATGTAGG - Intronic
1006512655 6:34530017-34530039 GGTACTCTAGAAACACATGCTGG + Intronic
1007653569 6:43438446-43438468 GGTCCTAATGAAGCCCATTCTGG - Intronic
1012091384 6:94902448-94902470 TGACCTACTGAAACACCAGCTGG + Intergenic
1013491202 6:110647305-110647327 GGTTCTACTTAAACACATCATGG - Intronic
1031170585 7:118287669-118287691 GGTCCTACTGAGAAATCTGCTGG - Intergenic
1038941604 8:32311749-32311771 GGCCCTACTGAAACAGAGGCAGG - Intronic
1046027707 8:108745499-108745521 GGTCATACAGAAACAGGTGCTGG + Intronic
1047931541 8:129733010-129733032 GGACCTGCTGAGCCACATGCGGG - Intergenic
1052452708 9:28652449-28652471 GGTCCTCCTGAAACTCATAAAGG + Intronic
1053008020 9:34616926-34616948 GGTGAGACTGAACCACATGCAGG + Intronic
1053462738 9:38283022-38283044 GGTCCCACTGAAACAGAAGAGGG + Intergenic
1059817142 9:117929540-117929562 GGTCCTACTGACACATCAGCAGG - Intergenic
1061640151 9:131947341-131947363 GCTTCTACTAAAACACATGCAGG - Intronic
1062703262 9:137919202-137919224 GGTCCTACTGAAACACATGCTGG - Intronic
1191184912 X:57599957-57599979 GCTCCAACTGAGACAGATGCAGG - Intergenic
1193260702 X:79403643-79403665 GGGCATACTAAAACACAAGCTGG + Intergenic
1193984789 X:88227714-88227736 TGACCTACTGAGACACAAGCTGG + Intergenic
1194990585 X:100543131-100543153 GGACCTACTGAGACACCAGCTGG + Intergenic
1196900103 X:120374318-120374340 GGTGCTACTGAACCACGAGCAGG + Intronic
1199314781 X:146363820-146363842 TGACCTACTGAAACACCAGCTGG - Intergenic