ID: 1062707749

View in Genome Browser
Species Human (GRCh38)
Location 9:137954579-137954601
Sequence GGCCATGCCCTGAGAATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 174}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062707749_1062707759 2 Left 1062707749 9:137954579-137954601 CCTCTCATTCTCAGGGCATGGCC 0: 1
1: 0
2: 0
3: 19
4: 174
Right 1062707759 9:137954604-137954626 AGGGATTGGTCTGGGTGGGGAGG No data
1062707749_1062707758 -1 Left 1062707749 9:137954579-137954601 CCTCTCATTCTCAGGGCATGGCC 0: 1
1: 0
2: 0
3: 19
4: 174
Right 1062707758 9:137954601-137954623 CACAGGGATTGGTCTGGGTGGGG No data
1062707749_1062707754 -6 Left 1062707749 9:137954579-137954601 CCTCTCATTCTCAGGGCATGGCC 0: 1
1: 0
2: 0
3: 19
4: 174
Right 1062707754 9:137954596-137954618 ATGGCCACAGGGATTGGTCTGGG No data
1062707749_1062707753 -7 Left 1062707749 9:137954579-137954601 CCTCTCATTCTCAGGGCATGGCC 0: 1
1: 0
2: 0
3: 19
4: 174
Right 1062707753 9:137954595-137954617 CATGGCCACAGGGATTGGTCTGG No data
1062707749_1062707757 -2 Left 1062707749 9:137954579-137954601 CCTCTCATTCTCAGGGCATGGCC 0: 1
1: 0
2: 0
3: 19
4: 174
Right 1062707757 9:137954600-137954622 CCACAGGGATTGGTCTGGGTGGG No data
1062707749_1062707760 11 Left 1062707749 9:137954579-137954601 CCTCTCATTCTCAGGGCATGGCC 0: 1
1: 0
2: 0
3: 19
4: 174
Right 1062707760 9:137954613-137954635 TCTGGGTGGGGAGGCCACAGTGG No data
1062707749_1062707755 -3 Left 1062707749 9:137954579-137954601 CCTCTCATTCTCAGGGCATGGCC 0: 1
1: 0
2: 0
3: 19
4: 174
Right 1062707755 9:137954599-137954621 GCCACAGGGATTGGTCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062707749 Original CRISPR GGCCATGCCCTGAGAATGAG AGG (reversed) Intronic
900651552 1:3732477-3732499 GGCCCTGCCCTGAGGCTGGGAGG + Intronic
901401457 1:9017759-9017781 GGCCATTGCCTGAGAGCGAGTGG - Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902329180 1:15722544-15722566 TGCCACACCCTGAGGATGAGGGG + Intronic
902515555 1:16987705-16987727 GGCCATGCCCAGAGCAGGGGAGG + Intronic
902765801 1:18614203-18614225 GGCCATGCCCTGGGCCAGAGTGG + Intergenic
903701551 1:25252474-25252496 GTCCATGCACAGAGAAGGAGAGG + Intronic
903929180 1:26852595-26852617 GGCCATTCAATGAGAATGTGGGG - Intronic
904746475 1:32714391-32714413 GGCCCTGCCCTGTGAATGTTTGG + Intergenic
907409544 1:54274648-54274670 GGCCATGGCCCGAGCAGGAGTGG - Intronic
907866227 1:58402051-58402073 ATCCATGCACTGAGAAAGAGTGG + Intronic
910346218 1:86241822-86241844 GGCCATGACCTGAAAATCAAGGG + Intergenic
910527611 1:88198697-88198719 GACCTTCCCCTGAGAATGAGAGG - Intergenic
915678161 1:157551266-157551288 GGCCAGGTCCTGAGCATGAGAGG - Intronic
917651770 1:177084707-177084729 GACCAAGCCGTGAGAAAGAGTGG - Intronic
924571888 1:245244545-245244567 AGCCAGGCCCAGAAAATGAGGGG + Intronic
1066575996 10:36825544-36825566 GGCCATTCTCTGAGAATGGGAGG + Intergenic
1068660013 10:59614082-59614104 GGCCATGTCCCTAGCATGAGGGG - Intergenic
1071125232 10:82327232-82327254 GTCCATGGCCTGAGCATCAGTGG + Intronic
1072673845 10:97451246-97451268 GGCCATGCCCAGAGACACAGTGG + Intronic
1073442406 10:103560235-103560257 GGCCAGGCCTGGAGAATGAGGGG - Intronic
1074472922 10:113743899-113743921 GGCCCTGCCAAGAGAAAGAGAGG + Intergenic
1075425575 10:122339381-122339403 GGCCATGTCCAGTCAATGAGAGG + Intergenic
1075792938 10:125098494-125098516 GGCCAGGACCTGGGGATGAGCGG + Intronic
1080182679 11:29443482-29443504 GGCCATACCCTGGGGATGTGTGG - Intergenic
1081736715 11:45409525-45409547 GGACAGGCCCTGAGCAGGAGAGG - Intergenic
1082079004 11:47997337-47997359 GCCAATCCCATGAGAATGAGAGG - Intronic
1083831496 11:65236598-65236620 GGCCACGCCCTGAGTGTCAGAGG - Intergenic
1085272395 11:75278104-75278126 AGCCATGCCCCGAGAGAGAGGGG + Intronic
1085979401 11:81705357-81705379 GGGAATTCCCTGAGACTGAGGGG + Intergenic
1088857713 11:113771352-113771374 GGCCATGCACATAAAATGAGGGG + Intronic
1090405808 11:126475300-126475322 GGCGATCCCCTGAGAAGGGGAGG - Intronic
1090922900 11:131222417-131222439 GGGCCTGCCCTGGGAAGGAGAGG - Intergenic
1091148441 11:133302203-133302225 GGTCCTGCCCTGGAAATGAGGGG - Intronic
1091554737 12:1564242-1564264 GTCCATTTCCTGAGAATGAGAGG - Intronic
1094373148 12:29760178-29760200 GGACATGTTCTGAGAATGAGTGG - Intronic
1096596788 12:52701017-52701039 GGCCATGCCCTTCGAAGGACAGG + Intronic
1097224569 12:57469739-57469761 GGACCTGCCCTGAGGTTGAGAGG + Intronic
1097983035 12:65753809-65753831 GGTGATGCCTTGAGAATGAGAGG - Intergenic
1098369825 12:69746092-69746114 GGTCATGCACTGGGAATGAGGGG - Intronic
1103469881 12:121171690-121171712 GGCTATGCCCTGAGAAACATCGG - Intronic
1103859424 12:124000275-124000297 GGCCATCTGCTGAGAAGGAGAGG - Intronic
1105403352 13:20114437-20114459 GGGAATGCACTGAGACTGAGTGG + Intergenic
1106186254 13:27412525-27412547 GGCCAGGCACTGAGATGGAGAGG + Intergenic
1107829709 13:44363530-44363552 GACCATGGCCAGAGAAAGAGAGG + Intergenic
1111537751 13:89626344-89626366 GGCAATGACATGAGAATCAGAGG + Intergenic
1111960574 13:94805460-94805482 GGCCATGCCCTGTGGATAAGTGG - Intergenic
1113452721 13:110423043-110423065 TGTCTTGCCCTGAGATTGAGGGG - Intronic
1113670489 13:112172340-112172362 GGCCATGTCCTTAGAAAAAGGGG - Intergenic
1116938786 14:50770012-50770034 GACCATCTGCTGAGAATGAGGGG + Intronic
1117724524 14:58659924-58659946 AGATATGCCCTGAGAATGGGTGG - Intergenic
1118614033 14:67562962-67562984 AGCCATGCACTGAGCAGGAGAGG + Intronic
1119854746 14:77891141-77891163 GACCATCTGCTGAGAATGAGGGG + Intronic
1122211628 14:100177831-100177853 GGCAATGCGCTGGGAATGGGTGG - Intergenic
1122288803 14:100668515-100668537 GGCCATGCCCTGAGAGGAATGGG + Intergenic
1122822094 14:104352829-104352851 GGCCATGCCGTGAGAAGCCGTGG - Intergenic
1123124698 14:105937980-105938002 GGCCCTCCCCTGAGCAGGAGAGG + Intergenic
1125336437 15:38630970-38630992 GGCCATCTGCTGAGAATGTGAGG - Intergenic
1125549819 15:40537043-40537065 GGCCTGGCCCAGAGCATGAGTGG + Intronic
1128530726 15:68445389-68445411 GGCTTTGCCCTAAGAGTGAGAGG - Intergenic
1129030602 15:72615110-72615132 GGGCCTGCCCTGAGACAGAGGGG - Intergenic
1129209626 15:74060202-74060224 GGACCTGCCCTGAGACAGAGGGG + Intergenic
1129232454 15:74204293-74204315 GGCCAGGCGCTGAGCATCAGGGG - Intronic
1129772025 15:78208549-78208571 AGCCATGCCCAGAAACTGAGTGG + Intronic
1129943767 15:79521359-79521381 AGCCATGCCCTGAGAAAGGCAGG - Intergenic
1130877168 15:88024519-88024541 GGCAATGTCATGAGAGTGAGGGG + Intronic
1132797521 16:1732595-1732617 GGACTTGCCCTGAGAACGGGCGG + Intronic
1133008590 16:2897905-2897927 TGCCGTGCCCTGAGAAGAAGAGG + Intronic
1133149623 16:3817939-3817961 TGCCCTTCCCTGAAAATGAGGGG - Intronic
1133241519 16:4416769-4416791 GGCCACGCCCTGATACCGAGGGG + Intronic
1133747888 16:8701428-8701450 GGCCCTGCCCTTAGAAGGAGAGG + Intronic
1135376428 16:21951356-21951378 GGTCATAACCTAAGAATGAGAGG + Intergenic
1136068760 16:27775788-27775810 GTCCATGCCATGGGACTGAGTGG + Intronic
1137274987 16:46927493-46927515 GGGTATGCCCTGGGCATGAGTGG - Intronic
1137550552 16:49434613-49434635 GGCCATGACCTCAGCATGATGGG - Intergenic
1138194290 16:55040959-55040981 GGCAGGGCCCTGGGAATGAGAGG - Intergenic
1138600660 16:58052054-58052076 GTCCATGCACTGAGAAGGAGGGG - Intergenic
1142401108 16:89859206-89859228 GGTCATGCTCTGAGAAGGAGCGG - Exonic
1144365329 17:14538856-14538878 GGCCATGCCCTCTCACTGAGTGG + Intergenic
1148444226 17:47727840-47727862 GGCCATGCCCTCTGAAGGACTGG + Intergenic
1150874451 17:68953546-68953568 GGCCATGCAATGAGGCTGAGGGG + Intronic
1151571046 17:74925464-74925486 GGACAGGCCCTGAGGATGGGAGG - Intronic
1152366159 17:79857772-79857794 GACCTGGCCCTGAGAATGTGGGG + Intergenic
1156361429 18:36387748-36387770 GGCCAAGCCCTGCCAATGCGGGG - Intronic
1156390798 18:36648776-36648798 GGCCATTCATTGAGAATAAGGGG + Intronic
1157310230 18:46547118-46547140 AGTCATGGGCTGAGAATGAGAGG + Intronic
1160395245 18:78566159-78566181 GACCCTGGCCTGAGAATGAATGG + Intergenic
1160496252 18:79377543-79377565 GTCCCTGCACTGAGAAGGAGAGG - Exonic
1161171375 19:2813972-2813994 GGCCTTCCCCTGTGGATGAGAGG - Exonic
1161231462 19:3176960-3176982 GGCCCTGTCCTGAGTCTGAGGGG - Intronic
1166636033 19:44452591-44452613 GGTGATGCCCTGAGCATGAGAGG + Intergenic
1167574153 19:50309744-50309766 GGCCATCCCCGGAGCCTGAGGGG + Exonic
1168071292 19:53953511-53953533 GGCAAAGACCTGAGAGTGAGTGG - Intergenic
1168436859 19:56325030-56325052 GTCCATGCACAGAAAATGAGAGG - Intronic
926777961 2:16440695-16440717 GGCCAGGCCCCGGGAAAGAGGGG + Intergenic
927722022 2:25389303-25389325 GGGCATGCTCTGAGCATGTGCGG + Intronic
928628164 2:33162397-33162419 CCCCATGCCCAGAGATTGAGAGG - Intronic
929264898 2:39907188-39907210 GGCCATGTCCTGAGCAGAAGGGG - Intergenic
930417786 2:51110835-51110857 AGCCATGGCCTGAGAATAATTGG - Intergenic
931516006 2:63051060-63051082 GGCAATGTCCTGAGAACGTGTGG + Intronic
932830001 2:74980193-74980215 GGTCATTCCTAGAGAATGAGGGG - Intergenic
932921458 2:75919770-75919792 GGCCATGCCATGTGGGTGAGAGG + Intergenic
934603067 2:95672989-95673011 GGCAATGGCCTGAGAATGCCAGG - Intergenic
936451424 2:112636504-112636526 GGCCATTCCCAGAGAATGCCTGG - Intergenic
936458668 2:112694617-112694639 GGCCATGGGCTGAGCGTGAGCGG + Intergenic
936536451 2:113315186-113315208 GGCAATGGCCTGAGAATGCCAGG - Intergenic
936827493 2:116600086-116600108 AGCCATGGCCTGAGAAAGTGTGG - Intergenic
937151386 2:119688762-119688784 GGCCATGCCCCAAGAATGCAGGG - Intergenic
937866184 2:126753230-126753252 GCCCATGCACTGAGCATGGGTGG - Intergenic
945636188 2:212354369-212354391 GGCCAAAGCCTGAGCATGAGGGG + Intronic
946905764 2:224414583-224414605 GGGCATGCACTGGGAATGTGGGG - Intergenic
948670210 2:239563745-239563767 GGCCGTGCCTGGAGATTGAGAGG - Intergenic
1168917157 20:1499698-1499720 GGACATGCCCAGAGCCTGAGGGG - Intergenic
1171320947 20:24243736-24243758 GGAAATGCCCAGAGAATGTGGGG + Intergenic
1172182688 20:33013234-33013256 TGCCTTGCCCTGGGAAAGAGAGG - Intronic
1175570103 20:60011947-60011969 AGCCATGGCCTGAGCATGAATGG + Intronic
1177642020 21:23855712-23855734 GCCCATGCCCTGATGATGACAGG - Intergenic
1178439009 21:32583691-32583713 AGCCTTGCTCTGAGAATAAGTGG + Intronic
1178760797 21:35400954-35400976 GGCCATGTACGGAGAATGAGAGG - Intronic
1179101368 21:38357912-38357934 GGCCAGGCACTGAGAGTGTGAGG - Intergenic
1179912733 21:44459041-44459063 GGCCAGGCCCAGTGTATGAGTGG + Exonic
1180187023 21:46145172-46145194 TGCCATGGCCTGTGAATGTGGGG + Intronic
1181056274 22:20261893-20261915 GCCCAGGCCCTGAGAACGAAGGG + Intronic
1183951689 22:41356210-41356232 GGCCAGGCCCTGAGGCTGAGCGG + Intronic
1184649576 22:45913432-45913454 GGCCATGCCAGGTGAACGAGGGG + Intergenic
1184941045 22:47765562-47765584 GGCCATGCCTTGACAAAGTGGGG + Intergenic
1185065343 22:48629215-48629237 GGCCAGGCCCTGAGGGTGGGAGG - Intronic
1185345686 22:50309573-50309595 GGACAGGCCCTGAGGAAGAGGGG + Exonic
949349375 3:3109958-3109980 GGCCATGCGATGAGAAGCAGCGG + Exonic
950424406 3:12917005-12917027 GGCTATGCCCTGAGCAGGTGGGG + Intronic
953283712 3:41583654-41583676 GGCCATGGCCTGAGGAGGTGAGG - Intronic
953877036 3:46672256-46672278 GGCCCGGCCCTGGGAAGGAGGGG - Intronic
954692315 3:52402154-52402176 GTCCAGGCCCTGGGAATGGGAGG - Exonic
956654419 3:71535342-71535364 GGTCATGGCCTGAGAAGCAGAGG + Intronic
956843162 3:73158335-73158357 GGCCATACCCTGAGGAGGGGAGG + Intergenic
961456111 3:127024743-127024765 GGACATGGCCTGAGGCTGAGAGG + Intronic
961918382 3:130400561-130400583 GGCCAAGCCCTGAGAACATGAGG - Intronic
968625869 4:1626476-1626498 GGCCATGCCCTGAGCCCGGGGGG + Intronic
968625919 4:1626650-1626672 GGCCATGCCCTGAGCCCGGGGGG + Intronic
968655954 4:1778524-1778546 GGCTGGGCCCTGAGAATGCGTGG + Intergenic
968658580 4:1789395-1789417 GGCCCTGCCATGAGGCTGAGTGG - Intergenic
969615821 4:8252115-8252137 GGCCATGCCCTCGGAAGGTGGGG + Intergenic
970342612 4:15122226-15122248 GCCCAAGCTGTGAGAATGAGGGG - Intergenic
972911623 4:43823635-43823657 GTCCATGCCCTCAGGATGTGTGG - Intergenic
974431267 4:61799492-61799514 GGCCATGGCCTGAGTATGTGTGG - Intronic
983870906 4:172824083-172824105 GACTATGCCCTTAGAATGGGAGG + Intronic
987477465 5:18408996-18409018 GGTCCTGCCCTCAGAATGTGTGG + Intergenic
989405084 5:41051347-41051369 GGCAAAGGCCTGAGAAAGAGAGG - Intronic
991677717 5:69105378-69105400 TGCCTTGCCGTGAGAATGAGAGG + Intronic
994144827 5:96383343-96383365 TGCTATACCCTGAGACTGAGTGG + Intergenic
994145315 5:96388174-96388196 GCACATGCCATGAGAATGATGGG + Intergenic
999144279 5:149382146-149382168 GGCCCGGGACTGAGAATGAGGGG + Intronic
999643779 5:153698287-153698309 GGGAATGCCCTGAAAATGAGAGG + Intronic
999999069 5:157120332-157120354 GGCCCTCCCCTGAGCAAGAGAGG + Intronic
1002402193 5:178996942-178996964 GGGCATTCCCTGAGAATATGAGG + Intergenic
1002786323 6:403149-403171 GGTTCTGCCCTTAGAATGAGAGG - Intronic
1005735952 6:28746288-28746310 GTCCATGCACAGAGAAGGAGAGG + Intergenic
1006402668 6:33826859-33826881 GGCCATGCCCTGAGAGATAAAGG + Intergenic
1007193372 6:40038779-40038801 GGCTATGCCCCAAGAGTGAGTGG + Intergenic
1013599481 6:111691132-111691154 GGCCAGGCCCTGAGCCTGTGAGG - Intronic
1015351346 6:132224027-132224049 GGCCATGCCAGGAGAATGCCTGG + Intergenic
1016863366 6:148743820-148743842 GGTCATCCCCTGAGACTGAAGGG + Intergenic
1018794144 6:167172717-167172739 AGCCTTGCTCTGAGAATAAGCGG - Intronic
1018822178 6:167382301-167382323 AGCCTTGCTCTGAGAATAAGTGG + Intronic
1020458414 7:8400591-8400613 GTCCATGCCAGGAGACTGAGAGG - Intergenic
1024617297 7:51126626-51126648 TGCCATGGACTGTGAATGAGAGG - Intronic
1025205953 7:56993575-56993597 GGTGATGCACAGAGAATGAGTGG + Intergenic
1025665987 7:63583364-63583386 GGTGATGCACAGAGAATGAGTGG - Intergenic
1026258884 7:68736931-68736953 GGCCAAGCCTTGAGAAATAGGGG - Intergenic
1030006654 7:105126823-105126845 GCCCATTCACTGAGACTGAGGGG + Intronic
1031458029 7:122008631-122008653 GGCCATCTGCTGAGAATGGGAGG + Intronic
1032114241 7:129103421-129103443 GGCCAAGCCCTGAGACTGGCTGG + Intergenic
1032451377 7:132034826-132034848 GGCCATGCCTTGTCAATGATGGG + Intergenic
1033964731 7:146960994-146961016 TGCAAAGCCCAGAGAATGAGCGG - Intronic
1040341398 8:46442936-46442958 GGCCAGGCACTGGGACTGAGGGG - Intergenic
1042467864 8:69148962-69148984 GGCCATGCCAAGAGTATGATGGG + Intergenic
1047552730 8:125894148-125894170 GGACATACCCTGAGATTGGGAGG + Intergenic
1047933182 8:129750454-129750476 GGCCATGCTCAGAGACAGAGGGG - Exonic
1048725761 8:137381983-137382005 GGAGATGCCCAGAGAATGACTGG - Intergenic
1049438187 8:142597302-142597324 GGCCTAACCCTGAGAAAGAGCGG + Intergenic
1049553919 8:143273026-143273048 GGCCATGCCCTGGCACTGACAGG - Intronic
1053026627 9:34734732-34734754 GGCCCTGTCCTGAGATTCAGGGG + Intergenic
1057442012 9:95090059-95090081 GGCTATGCCCTGAGGCTGCGTGG + Intergenic
1060820634 9:126659488-126659510 GCCCCTGGCCTGAGAATGTGTGG - Intronic
1062707749 9:137954579-137954601 GGCCATGCCCTGAGAATGAGAGG - Intronic
1187344033 X:18446782-18446804 GGTCATGTGCTGAGTATGAGTGG - Intronic
1187588462 X:20689874-20689896 GGACCTGCCCTGGGAAAGAGGGG - Intergenic
1187606119 X:20884792-20884814 GGGCATGCCCAGAGACTCAGTGG + Intergenic
1188715643 X:33456586-33456608 GGACCTGCCCTGAGACAGAGGGG + Intergenic
1192439355 X:71163419-71163441 GGACCTGCCCTGAAAATGAGGGG + Intronic
1194157848 X:90415476-90415498 GGACATGCTCTGGGAAAGAGGGG - Intergenic
1198419020 X:136450249-136450271 GGTCATCAGCTGAGAATGAGGGG + Intergenic
1200504177 Y:3992445-3992467 GGACATGCTCTGGGAAAGAGGGG - Intergenic
1200555403 Y:4631184-4631206 GGACCTGCCCTGAGACAGAGAGG - Intergenic