ID: 1062708729

View in Genome Browser
Species Human (GRCh38)
Location 9:137960190-137960212
Sequence CTGAGTGAGGGGGAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062708714_1062708729 13 Left 1062708714 9:137960154-137960176 CCTGAGGAACGTGTGTGGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1062708729 9:137960190-137960212 CTGAGTGAGGGGGAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062708729 Original CRISPR CTGAGTGAGGGGGAGGGGGA GGG Intronic
No off target data available for this crispr