ID: 1062709952

View in Genome Browser
Species Human (GRCh38)
Location 9:137969863-137969885
Sequence CAGTAGGGCAGGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1618
Summary {0: 1, 1: 0, 2: 12, 3: 148, 4: 1457}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062709952_1062709964 6 Left 1062709952 9:137969863-137969885 CCTGCCTCCCTCCTGCCCTACTG 0: 1
1: 0
2: 12
3: 148
4: 1457
Right 1062709964 9:137969892-137969914 CTGTGGGGAGTGGTCATCCCTGG No data
1062709952_1062709967 22 Left 1062709952 9:137969863-137969885 CCTGCCTCCCTCCTGCCCTACTG 0: 1
1: 0
2: 12
3: 148
4: 1457
Right 1062709967 9:137969908-137969930 TCCCTGGCCTTCAGCAGGGCTGG No data
1062709952_1062709965 17 Left 1062709952 9:137969863-137969885 CCTGCCTCCCTCCTGCCCTACTG 0: 1
1: 0
2: 12
3: 148
4: 1457
Right 1062709965 9:137969903-137969925 GGTCATCCCTGGCCTTCAGCAGG No data
1062709952_1062709966 18 Left 1062709952 9:137969863-137969885 CCTGCCTCCCTCCTGCCCTACTG 0: 1
1: 0
2: 12
3: 148
4: 1457
Right 1062709966 9:137969904-137969926 GTCATCCCTGGCCTTCAGCAGGG No data
1062709952_1062709962 -4 Left 1062709952 9:137969863-137969885 CCTGCCTCCCTCCTGCCCTACTG 0: 1
1: 0
2: 12
3: 148
4: 1457
Right 1062709962 9:137969882-137969904 ACTGCTGCCTCTGTGGGGAGTGG No data
1062709952_1062709959 -9 Left 1062709952 9:137969863-137969885 CCTGCCTCCCTCCTGCCCTACTG 0: 1
1: 0
2: 12
3: 148
4: 1457
Right 1062709959 9:137969877-137969899 GCCCTACTGCTGCCTCTGTGGGG No data
1062709952_1062709958 -10 Left 1062709952 9:137969863-137969885 CCTGCCTCCCTCCTGCCCTACTG 0: 1
1: 0
2: 12
3: 148
4: 1457
Right 1062709958 9:137969876-137969898 TGCCCTACTGCTGCCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062709952 Original CRISPR CAGTAGGGCAGGAGGGAGGC AGG (reversed) Intronic
900003525 1:29232-29254 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900023245 1:199748-199770 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900242357 1:1623241-1623263 CAGTCTGGCACCAGGGAGGCCGG - Intronic
900386635 1:2413676-2413698 CAGGATTGCAGGAGGAAGGCAGG + Intronic
900391596 1:2436236-2436258 GAGGAGGGGAGGAGGGAGGAAGG - Intronic
900391678 1:2436470-2436492 GAGGAGGGGAGGAGGGAGGAAGG - Intronic
900552727 1:3264680-3264702 CCCCAGGCCAGGAGGGAGGCAGG + Intronic
900762771 1:4483935-4483957 GAGATGGGCGGGAGGGAGGCAGG - Intergenic
900774475 1:4571899-4571921 GAGAAGGGCAGGAGGGAGGAAGG + Intergenic
901357460 1:8663772-8663794 CAGTAGGGGAGAGGTGAGGCTGG - Intronic
901535755 1:9882116-9882138 CAGGAAGGCAGGGGAGAGGCTGG + Intronic
901642174 1:10698151-10698173 CATTATGGCAGGAGAGGGGCTGG + Intronic
901742306 1:11350303-11350325 CAGTGAGGCAGGAGGAGGGCTGG - Intergenic
901794196 1:11671174-11671196 CAGGAGGGCGGGAGGGAGGGTGG - Intronic
901895773 1:12310808-12310830 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
902052786 1:13577352-13577374 TGGGAAGGCAGGAGGGAGGCTGG - Intergenic
902115974 1:14121383-14121405 CAATAGGGCAGTGGGGCGGCGGG + Intergenic
902210523 1:14901367-14901389 GAGTAGGGGTGGTGGGAGGCAGG + Intronic
902241995 1:15095525-15095547 CAGAAAGCCAGGAGAGAGGCAGG - Intronic
902329685 1:15725226-15725248 CGTTAGCCCAGGAGGGAGGCAGG - Intronic
902331294 1:15732323-15732345 CAGCGGGGCAGGGGAGAGGCAGG - Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902554124 1:17236931-17236953 CAGCAGATCAGCAGGGAGGCTGG + Intronic
902775424 1:18671505-18671527 CAGTGGGCCAGGTGGGAGGAGGG + Intronic
902833101 1:19030173-19030195 CAGAAGGGAAGGAGGGAGGGAGG + Intergenic
902885806 1:19403886-19403908 CTGGAGTCCAGGAGGGAGGCAGG - Intronic
902932528 1:19741611-19741633 AAGGAGGGGATGAGGGAGGCAGG - Intronic
902975334 1:20084356-20084378 CAGGAGGGCAGAAGGAAAGCCGG - Intronic
903061509 1:20671921-20671943 CAGTAGGTCAGGAGCTTGGCTGG - Exonic
903171681 1:21558420-21558442 GAGGAAGGCAGGAGGGAGGCTGG + Intronic
903262716 1:22139981-22140003 CTGTTGGGCAGGATGGAGCCTGG - Intronic
903295261 1:22339503-22339525 CAGCAGGGCAGGGCGGGGGCGGG + Intergenic
903331741 1:22600147-22600169 AGGGAGGGAAGGAGGGAGGCAGG + Intronic
903357200 1:22755478-22755500 CAGAAGGGCAGGGAGGAGGCAGG - Intronic
903371808 1:22841381-22841403 TTGTAGGGCAGGAGGGAGTCTGG + Intronic
903537642 1:24077495-24077517 GAGTGAGCCAGGAGGGAGGCGGG - Intronic
903639616 1:24849323-24849345 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
903767009 1:25741505-25741527 CAGGAGGGCAGGAGCCAGGCTGG - Intronic
903770174 1:25758809-25758831 CAGGAGGGCAGTGGGGAGCCCGG + Intronic
903813803 1:26049865-26049887 CAGTATGGGAGGCGGGAGACAGG + Intergenic
904829033 1:33295023-33295045 CTGGTGGGCAGGAGGCAGGCAGG - Intronic
904880772 1:33695183-33695205 CAGCATGGCAGGCTGGAGGCTGG + Intronic
905033921 1:34905018-34905040 CAGGAGTGTAGGAGGCAGGCGGG + Exonic
905172460 1:36117206-36117228 CAGAGTGGCAGGATGGAGGCAGG - Intronic
905199707 1:36307407-36307429 CGGGAGGGAAGGAGGGAGGAAGG + Intronic
905335310 1:37240822-37240844 CACTAGGGCAGGAGGCTGGCAGG - Intergenic
905408541 1:37753354-37753376 CAGTCGGGGAGGAGGGAACCAGG + Intronic
905753666 1:40488584-40488606 CAGCATGGCTGGAGGTAGGCTGG - Intronic
905921536 1:41722537-41722559 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
906226581 1:44127518-44127540 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
906253641 1:44330956-44330978 AAGCAGGGCAGGATGGAGGTAGG + Intronic
906501240 1:46342878-46342900 CAGAGAGGCAGGAGGGAGGTGGG - Intronic
906520146 1:46461967-46461989 GAGGAGACCAGGAGGGAGGCAGG - Intergenic
906521934 1:46472357-46472379 CAGGGGGGCAGGCGGGCGGCTGG - Intergenic
906645142 1:47469316-47469338 CAAGAGGGCAGGAGGGATTCTGG + Intergenic
906764789 1:48418806-48418828 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
907076345 1:51582655-51582677 GTGTAGAGAAGGAGGGAGGCAGG - Intronic
907301679 1:53490797-53490819 GGGGAGGGCAAGAGGGAGGCTGG - Intergenic
907310405 1:53535734-53535756 GGGAAAGGCAGGAGGGAGGCAGG - Intronic
907335311 1:53695642-53695664 CAGGAAGGCAGGAGGGGCGCGGG + Intronic
907437497 1:54458968-54458990 CAGGCGGGAAGGAGGGAGGGAGG + Intergenic
907444534 1:54499422-54499444 CCGCAGGGCAAGAGGGAGGCAGG + Intergenic
907472473 1:54682837-54682859 CAGGAGGGAAGGAGAGAGGAAGG - Intronic
907575545 1:55522671-55522693 CAGATGGACAGGAGGGAGCCAGG + Intergenic
908083750 1:60608609-60608631 CAGTATGGCTAGAGGTAGGCTGG - Intergenic
908269153 1:62406229-62406251 AAGTAGGGAAGGAGGGAGAGGGG + Intergenic
908423620 1:63983581-63983603 CGGTAAGGCAGGAGTGTGGCTGG + Intronic
908806480 1:67937920-67937942 CAGAAGGACAGGAAGGAGCCAGG - Intergenic
909434016 1:75619226-75619248 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
910521265 1:88124733-88124755 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
910734907 1:90442955-90442977 CAGAAGGAAAGGAGGGAGGGAGG + Intergenic
910824421 1:91390467-91390489 AAGGAAGGAAGGAGGGAGGCAGG + Intronic
912114572 1:106389494-106389516 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
912121261 1:106474348-106474370 CACTGGGACAGGAGGGAGGCTGG + Intergenic
912332237 1:108830397-108830419 CTGTAGGGTGCGAGGGAGGCTGG + Intronic
912689189 1:111791425-111791447 CAGTCGGGGAGGAAGAAGGCTGG + Intronic
912865034 1:113249019-113249041 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
913228620 1:116722120-116722142 CAGGAGGCCAGGAGGTAGACAGG + Intergenic
913518642 1:119625172-119625194 GAGGAGGGCAGCAGGGAGTCTGG + Intronic
914197861 1:145459202-145459224 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
914476964 1:148032326-148032348 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
915128479 1:153681355-153681377 GAATAGGGAAGGATGGAGGCTGG - Intronic
915645056 1:157264584-157264606 AAGTTAAGCAGGAGGGAGGCAGG + Intergenic
915830467 1:159124784-159124806 CAGTAGAGCAGGAGGAAAACAGG + Intronic
915938755 1:160104937-160104959 CTGTAGGGCGGGAAGGACGCTGG + Intergenic
916508006 1:165445348-165445370 GTGTAGGTCAGGAGAGAGGCGGG + Intronic
916512120 1:165481816-165481838 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
916558209 1:165910952-165910974 CAGTCGGGCAGCAGGAGGGCCGG + Intronic
916608792 1:166369612-166369634 AAGGAGGGCAGGAGGGAGGGAGG - Intergenic
916785573 1:168084863-168084885 CAGTAGGGAAGTAGGCAGGGTGG + Exonic
917073145 1:171174937-171174959 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
917139073 1:171816556-171816578 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
917168784 1:172145377-172145399 CGGGAGGGAAGGAGGGAGGGAGG - Intronic
917531742 1:175842038-175842060 CAGGTTGGCAGAAGGGAGGCAGG + Intergenic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
918042883 1:180923894-180923916 CAGTGGGGCAGGATGGGAGCTGG - Intronic
918131950 1:181637411-181637433 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
918177998 1:182061863-182061885 GAGGAGGGAAGGAGGAAGGCTGG - Intergenic
918342943 1:183582206-183582228 AAGAAGGGCTAGAGGGAGGCGGG - Intronic
918447721 1:184631614-184631636 CAGAAGAGCAGGAAGAAGGCAGG + Intergenic
918487675 1:185046016-185046038 GAGTAGGGCTGCAGAGAGGCTGG - Intronic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919769379 1:201147567-201147589 CAGGAGGGCAGCGCGGAGGCTGG - Intronic
919770256 1:201154105-201154127 GAGTTGGGCGGGAGGGAAGCAGG - Exonic
919887553 1:201946041-201946063 CTGGAGGGGAGGAGGGAGACAGG - Intronic
919887859 1:201947846-201947868 CTGAAGGGCAGAAGGAAGGCAGG + Intergenic
920180200 1:204127754-204127776 GTGCAGGGGAGGAGGGAGGCTGG + Intergenic
920208753 1:204313084-204313106 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
920418119 1:205812470-205812492 CAGGAACACAGGAGGGAGGCGGG - Intronic
920455381 1:206097238-206097260 AAGGAGGGCTGCAGGGAGGCAGG - Intronic
920808474 1:209257716-209257738 CAGTTGGTCAGCAGGGAGGAAGG - Intergenic
921279259 1:213549542-213549564 AAGTAGGGCAAGAAGGAGGCAGG + Intergenic
921366798 1:214382014-214382036 CAGTTACTCAGGAGGGAGGCAGG - Intronic
921787225 1:219245141-219245163 AGGGAGGGAAGGAGGGAGGCAGG - Intergenic
921799348 1:219384010-219384032 CAGTAGGGAAGGAGAGGGGAAGG - Intergenic
922571272 1:226635884-226635906 CAGTGGGGCCAGAGGAAGGCCGG + Intronic
922615508 1:226958874-226958896 AAGTAGGGTAGGTGGGAGACTGG + Intronic
922646405 1:227291174-227291196 CAGGTGGGGAGGAGGGAGGAAGG - Intronic
922672191 1:227518968-227518990 CAGTGGGGCTAGAGGGAGCCTGG + Intergenic
922752693 1:228078029-228078051 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
922758330 1:228109070-228109092 GAGTCGGGAGGGAGGGAGGCAGG - Intronic
922890366 1:229057508-229057530 CAGCAGGTGAGGACGGAGGCTGG - Intergenic
923105489 1:230850677-230850699 AGGAAGGGCAGGAGGGAGGGAGG + Intronic
923332957 1:232942566-232942588 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
923540479 1:234884967-234884989 CAGTGGGGCATGAAGGAGCCTGG - Intergenic
923570552 1:235109518-235109540 CAGAATGGCAGGTGGGAGGATGG + Exonic
924038928 1:239964152-239964174 CAGCAGGGCAGGGGTGGGGCAGG + Intergenic
924162487 1:241247029-241247051 CATTCAAGCAGGAGGGAGGCTGG + Intronic
924202581 1:241675112-241675134 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
924730671 1:246708820-246708842 AAGCAGGGAAGGAGGGAGGGAGG - Intergenic
1062822980 10:548504-548526 CAGGAGGGAGGGAGGGAGGCAGG + Intronic
1062957421 10:1549439-1549461 CAGGAAGGAAGGAGGGAGACGGG + Intronic
1062976670 10:1688594-1688616 CAGAAGGCCAGGCGGGGGGCGGG - Intronic
1063087166 10:2830434-2830456 TAGTAGGGCAGGAAGGATGGTGG + Intergenic
1063087565 10:2833275-2833297 CAGGAGGACAGGAGAGAAGCAGG - Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063342087 10:5275404-5275426 GAGCAGAGCAGGAGGGAGGTGGG - Intergenic
1063713108 10:8499984-8500006 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1063933285 10:11050908-11050930 CAGGAGGAAAGCAGGGAGGCAGG - Intronic
1064008265 10:11714956-11714978 GAGAAGGGCAGGAGAGGGGCAGG + Intergenic
1064341523 10:14489923-14489945 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1064585556 10:16836567-16836589 CAGAGGGGCAGGAGGAAGGGAGG + Intronic
1064677349 10:17774772-17774794 AGGTAGGGAAGGAGGGAGGGAGG - Intronic
1064741540 10:18439788-18439810 CAGAAGGGAGGGAGGGAGGAAGG - Intronic
1064924557 10:20555815-20555837 CTGCAGGGCAGCAGCGAGGCTGG + Intergenic
1064962122 10:20976773-20976795 GAGGAGGGAGGGAGGGAGGCAGG + Intronic
1064981017 10:21166717-21166739 CAGTAGGCCAGGATGGAGCTAGG + Intronic
1065198143 10:23286579-23286601 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1065218827 10:23475557-23475579 AAGGAGGGAGGGAGGGAGGCGGG - Intergenic
1065274090 10:24067857-24067879 CTGTAAGGCAGCAGTGAGGCTGG - Intronic
1065531625 10:26675885-26675907 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1065856975 10:29838894-29838916 GAGGAGTGCAGGAGGGAGGAGGG + Intergenic
1065930621 10:30475713-30475735 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1066472282 10:35710938-35710960 AAACAGAGCAGGAGGGAGGCAGG - Intergenic
1067061694 10:43081113-43081135 CAGGAGGGGAGGAGGGCAGCAGG - Intronic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067710631 10:48648724-48648746 CATCAGAGCAGCAGGGAGGCCGG + Intronic
1067806233 10:49395320-49395342 CAGCAGGGCTGGTGGGTGGCTGG - Intronic
1067808538 10:49409683-49409705 CAGGAGGGCAGGAAGGAGGAAGG - Intergenic
1067833221 10:49622027-49622049 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069199299 10:65592814-65592836 CTGCAAGGCAGCAGGGAGGCTGG - Intergenic
1069827314 10:71262151-71262173 GAGTGGGGCAGGAGGGAGTCTGG + Intronic
1069875730 10:71561856-71561878 AAGGAGGGGAGGAGGGAAGCAGG + Intronic
1070100440 10:73380972-73380994 CTCTAGGGCAGGAGGGAGGGAGG + Intronic
1070817618 10:79335331-79335353 CAGTCTGGCAGCAGAGAGGCAGG + Intergenic
1071287150 10:84159403-84159425 AACTCGGGCAGGAGGGAGGGAGG - Intergenic
1071573954 10:86712361-86712383 TAGTATTGCTGGAGGGAGGCAGG + Intronic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1071717828 10:88114777-88114799 TAGGAGGGCAGGGGGCAGGCAGG - Intergenic
1071920814 10:90348036-90348058 CAGAATAGCAGGAGGCAGGCAGG + Intergenic
1072200161 10:93150859-93150881 CAGTGGGGAATGAGGCAGGCAGG + Intergenic
1072388784 10:94960340-94960362 CAGCAAGGCAGCAGCGAGGCTGG - Intronic
1072426426 10:95334460-95334482 CAGGAGGGCAGGAGGAAGGGAGG + Intronic
1072521295 10:96232197-96232219 CAGCGGGGCAGGAGGGAGCTGGG - Intronic
1072586772 10:96789892-96789914 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1072683125 10:97521006-97521028 TAGGAGGGCAGGAGGGAGAGAGG + Intronic
1072806987 10:98429930-98429952 CAGAAGGGGTGGAGGGAGCCAGG - Intronic
1073120547 10:101120005-101120027 CAGCAGGGCAAGAAGTAGGCAGG + Intronic
1073144438 10:101271268-101271290 CAGGAGGGCAGGAGGGGATCAGG + Intergenic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073315726 10:102579411-102579433 CAGCAGGGGAGGTGGGAGGCTGG - Intronic
1073352511 10:102830119-102830141 CAGGAGGCCAGGAGGGAGGTTGG - Intergenic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1073625018 10:105088093-105088115 CACTAGGGAAGGAGAGGGGCAGG + Intronic
1073625357 10:105091114-105091136 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1073625431 10:105091363-105091385 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1073625460 10:105091458-105091480 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1073625483 10:105091537-105091559 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1073717196 10:106121149-106121171 CAGTAGAGCAGGAGAGAGAAAGG + Intergenic
1073863258 10:107771133-107771155 CAGTAGGGCATGAGGGGTGGGGG - Intergenic
1074538130 10:114343549-114343571 AAGGAGGGAGGGAGGGAGGCTGG + Intronic
1074897546 10:117790618-117790640 CTAAAGGGCACGAGGGAGGCTGG + Intergenic
1075400477 10:122158006-122158028 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1075407942 10:122207000-122207022 CAGTAGGGGAGCAGGGAGGCTGG + Intronic
1075421972 10:122308603-122308625 AAGCAGGGAAGGAGGGAGGTTGG - Intronic
1075572483 10:123556270-123556292 GAGAATGGCAGGAGGGAGGCTGG + Intergenic
1075700593 10:124467195-124467217 CAGTAGGGCAGGAGGTGGGGGGG + Intronic
1075717531 10:124565786-124565808 CAGGAAGGCAGGGGGAAGGCTGG + Intronic
1075856025 10:125630917-125630939 CAGATGGGCAGGAGGGGGTCAGG + Intronic
1076036408 10:127202025-127202047 AACTAGGGCAGGAAGGAGCCAGG + Intronic
1076187968 10:128463730-128463752 AAGCCAGGCAGGAGGGAGGCTGG + Intergenic
1076550990 10:131278080-131278102 CAGTGGGCCCGGGGGGAGGCAGG - Intronic
1076799861 10:132815866-132815888 CAGTCTGGGAGGAGGTAGGCTGG + Intronic
1076815997 10:132914889-132914911 CACTTGGGCAGAAGGGAGGGCGG - Intronic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1076847328 10:133075682-133075704 CAGCAGGGCTGGCAGGAGGCTGG + Intronic
1076857738 10:133125861-133125883 CAGGAGGAAAGGTGGGAGGCAGG - Intronic
1076948242 10:133665791-133665813 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1076949231 10:133669101-133669123 TAGGAGGGAGGGAGGGAGGCAGG + Intronic
1076950215 10:133672400-133672422 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1076951200 10:133675699-133675721 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1076952190 10:133679009-133679031 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1076953178 10:133682319-133682341 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1076955146 10:133741970-133741992 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1076956136 10:133745280-133745302 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1076957124 10:133748589-133748611 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1076958113 10:133751899-133751921 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1076959097 10:133755198-133755220 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1076960086 10:133758508-133758530 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1076963331 10:133785366-133785388 TGGTATGGCAGGAAGGAGGCTGG + Intergenic
1077077297 11:707442-707464 CAGCAGGGCAGGAGGGTAGAGGG - Intronic
1077088242 11:765399-765421 CAACAGGACAGGAGGGGGGCGGG - Intergenic
1077141320 11:1026171-1026193 CAGTATGGCAGGAGGGCCGCAGG - Intronic
1077232616 11:1464825-1464847 CTGGAGGGCAGGAGGCAGGCAGG - Intergenic
1077265223 11:1645253-1645275 CAGTAGGGAAGGCTGCAGGCAGG + Intergenic
1077334460 11:1997278-1997300 CAGAGGGGCAGGATGGGGGCAGG - Intergenic
1077367639 11:2167527-2167549 GAGAAGGGCAGGAGGGAGGGAGG + Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077466778 11:2737143-2737165 CAGGAGAGGAGGAGGCAGGCAGG + Intronic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077543483 11:3158672-3158694 CAGTGGTGCAGGAGAGAGGGAGG + Intronic
1077553710 11:3215849-3215871 CAGCAGGACAGGAAGGCGGCTGG - Intergenic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077794553 11:5477909-5477931 CTGCAAGGCAGCAGGGAGGCTGG + Intronic
1078066783 11:8083815-8083837 CAGCAGGGCAGGGGGGATCCTGG - Intronic
1078102076 11:8336045-8336067 CAGCAGGACAGCAGGAAGGCCGG - Intergenic
1078319729 11:10323406-10323428 CAGCAAGGGATGAGGGAGGCAGG - Intronic
1078488574 11:11747718-11747740 AGGAAGGGAAGGAGGGAGGCAGG + Intergenic
1078859430 11:15233718-15233740 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1078872082 11:15357232-15357254 AAGGAGGGCAGGAGAGAGTCAGG - Intergenic
1079964396 11:26963205-26963227 AAGGAGGGCAGGAGGGAGAGAGG + Intergenic
1079968414 11:27006622-27006644 CAGATGGACAGGAGGGAGCCAGG + Intergenic
1080005873 11:27405775-27405797 AATTAGGGCAGATGGGAGGCAGG - Intronic
1080117321 11:28635499-28635521 AGGGAGGGCAGGAGGGAGGGAGG + Intergenic
1080117324 11:28635507-28635529 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1080135045 11:28844648-28844670 AAGTAAGGAAGGAGGGAGGGAGG - Intergenic
1080389846 11:31834790-31834812 AAGTAGGGAGGGAGGGAGGGAGG - Intronic
1080711072 11:34748559-34748581 CTGGAGGGCAGGAGGAAGGCTGG + Intergenic
1080846403 11:36030830-36030852 CAGTAGGAGAGGAGAGAGCCAGG + Intronic
1081218912 11:40436538-40436560 AAGCAGGACAGGAGAGAGGCTGG - Intronic
1081237124 11:40659278-40659300 GATGAGGGCAGGAAGGAGGCTGG + Intronic
1081683004 11:45021967-45021989 GGGCAGGGCAGGAGGGAGGTGGG + Intergenic
1082122216 11:48391603-48391625 CTGTAAGGCAGCAGTGAGGCTGG - Intergenic
1082141768 11:48617468-48617490 CTGCAAGGCAGCAGGGAGGCTGG - Intergenic
1082162503 11:48900587-48900609 CAGCGGGACAGGTGGGAGGCCGG + Intergenic
1082174905 11:49048580-49048602 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1082243223 11:49892181-49892203 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1082657723 11:55873006-55873028 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1082881681 11:58044299-58044321 CACCAGGTAAGGAGGGAGGCTGG - Intronic
1083034961 11:59628522-59628544 CGGGTGGGCAGGAGGGAGGGAGG - Intergenic
1083187138 11:61024272-61024294 GGGTAGGGAAGGAGGGAGGGAGG - Intergenic
1083577285 11:63801226-63801248 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1083594080 11:63910823-63910845 CCATAGGGCAGGAGGGGGGAAGG - Exonic
1083737114 11:64687651-64687673 GAGGAGGGAAGGAGGGAGGTGGG + Intronic
1083808775 11:65090672-65090694 CAGTTGGGCAGGAGGCAGTGGGG - Intronic
1083829124 11:65219847-65219869 CAGGACGGAAGCAGGGAGGCCGG + Intergenic
1083855200 11:65389804-65389826 CAGTACCGCAGGAGGGAGGGAGG + Intronic
1084409385 11:68997546-68997568 CTCAAGGGCAGGATGGAGGCCGG + Intergenic
1084424475 11:69077010-69077032 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424552 11:69077259-69077281 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424584 11:69077367-69077389 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084427594 11:69094136-69094158 CAGTGGGGCAGAAGTGGGGCGGG + Intergenic
1084462381 11:69303080-69303102 CTGTGGAGCAGTAGGGAGGCTGG + Intronic
1084569282 11:69949743-69949765 CAGAAGGGCTGGAAGGAGGCAGG + Intergenic
1084717433 11:70882902-70882924 CTGCAGGGCAGGCAGGAGGCAGG + Intronic
1084937445 11:72594700-72594722 GAGCAAGGCAGGAAGGAGGCCGG - Intronic
1084965471 11:72742086-72742108 CAGAAGGGAAAGAGGGAGACAGG + Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085021646 11:73213745-73213767 GAGAAGCGCAGGAGGGAGGTGGG - Intergenic
1085034181 11:73290383-73290405 AAGAAGGGAAGGAGGGAGACTGG + Intronic
1085048659 11:73368126-73368148 CTGGAGGGCAGCAGGAAGGCTGG + Exonic
1085186290 11:74578735-74578757 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1085297913 11:75441311-75441333 CTGTGGGGCAGGGGAGAGGCAGG + Intronic
1085338585 11:75716780-75716802 CAGTGGGGCAGAAGGGAGGTGGG + Intergenic
1085350956 11:75797634-75797656 CAGGAGGTCAGGAAGGAGGGTGG + Intronic
1085391692 11:76185459-76185481 CAGGGAGGCAGGAGGGAGGTCGG - Intergenic
1085445799 11:76599782-76599804 AAGTGAGGCAGGAAGGAGGCAGG + Intergenic
1085510711 11:77086738-77086760 CCAGAGGGCAGGAGGGAGTCAGG - Intronic
1085658982 11:78345031-78345053 CAGGAGGGAGGGAGGGAGGCGGG + Intronic
1085690481 11:78660079-78660101 CTGGAGTGCAGGAGGGAGCCTGG + Intronic
1086307165 11:85493797-85493819 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1086379245 11:86235051-86235073 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1086420699 11:86634348-86634370 CAGGATGTCAGGAGGGAGGTTGG - Intronic
1086605969 11:88696463-88696485 CAGAAGGGAGGCAGGGAGGCAGG - Intronic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1086690869 11:89787506-89787528 CAGCGGGGCAGGTGGGAGGCCGG - Intergenic
1086697651 11:89864004-89864026 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1086708508 11:89980484-89980506 CAGCGGGGCAGGTGGGAGGCCGG - Intergenic
1086714931 11:90052149-90052171 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1087237176 11:95733052-95733074 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1087405377 11:97723046-97723068 CAGTAGGACAGGAATGAGGCTGG + Intergenic
1087812253 11:102621080-102621102 CAGGCGGGTAGGAGGGAGCCAGG - Intronic
1087919135 11:103846328-103846350 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1088394878 11:109355873-109355895 AAGAAGGGAAGGAGGGAGGGTGG - Intergenic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1089500313 11:118928164-118928186 CAGGAGGAAAGGAGAGAGGCAGG + Intronic
1089637918 11:119828153-119828175 CAGCTGGGAAAGAGGGAGGCTGG + Intergenic
1089643628 11:119863986-119864008 GATGAGGGCAGGAGGAAGGCAGG - Intergenic
1089644889 11:119872402-119872424 CTGGAGGGCAGGAAGGAGCCAGG - Intergenic
1089648005 11:119892764-119892786 CAGCAGAGCAGGGGGGTGGCCGG - Intergenic
1090089428 11:123681764-123681786 CAGGAAGGCAGGAAGGAGGGAGG + Intergenic
1090239322 11:125170959-125170981 CAGTGGGGGAGGGGGGAGGCTGG + Intronic
1090343265 11:126044740-126044762 CAGAAGGGCAGCAGGGAGGTGGG + Intronic
1090357069 11:126147232-126147254 CAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1090407723 11:126487220-126487242 CAGCAGGGCAGGCAGGAGGAGGG + Intronic
1090561273 11:127935451-127935473 CTGGCAGGCAGGAGGGAGGCTGG - Intergenic
1090589119 11:128246490-128246512 CAGTGGGGGAGGAGGGAGCGGGG - Intergenic
1090617226 11:128526144-128526166 CAGGAGGGAAGAAGGGAGGGTGG + Intronic
1091224851 11:133951116-133951138 GAGGAAGGCAGGAGGAAGGCGGG + Intronic
1091229061 11:133976072-133976094 CATTAGGGCAGGAAGAAGTCAGG - Intergenic
1202817443 11_KI270721v1_random:52460-52482 CAGAGGGGCAGGATGGGGGCAGG - Intergenic
1091376944 12:31286-31308 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1091388334 12:109398-109420 CAGTAAGGCTGCAGAGAGGCCGG - Intronic
1091583123 12:1800601-1800623 CTGCAGGGCAGGTGGGAGGTGGG - Intronic
1091750084 12:3016928-3016950 CCTTAGGGCAGGACTGAGGCAGG + Intronic
1091755875 12:3051190-3051212 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1091918141 12:4283714-4283736 CATTTTGCCAGGAGGGAGGCGGG + Intronic
1092246562 12:6867411-6867433 CAGGAGGGCGGGCGGGGGGCAGG + Exonic
1092291178 12:7160248-7160270 CGGGAGGACAGGTGGGAGGCAGG - Intergenic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1092753198 12:11738225-11738247 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1092917495 12:13201981-13202003 AACTAGGACAGGAGGGAGGGAGG + Intronic
1093527483 12:20118719-20118741 CAGTAGGATATGGGGGAGGCAGG + Intergenic
1094578621 12:31712061-31712083 AGGTAGGGAAGGAGGGAGGGAGG - Intronic
1095277197 12:40300601-40300623 CAGGAGGGTAGGAGGAAGGGAGG - Intronic
1095424777 12:42063390-42063412 CTGTAAGGCAGCAGCGAGGCTGG + Intergenic
1095654109 12:44649213-44649235 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1095946426 12:47756353-47756375 CAAGAGGGAAGGAGGGAGGGAGG + Intronic
1096025578 12:48358272-48358294 CAGAAGGGTAGGAGGGTGGGAGG - Intergenic
1096398002 12:51281308-51281330 CGGGAGGGATGGAGGGAGGCAGG - Exonic
1096514066 12:52146748-52146770 CAGGAGGGCAGGCAGCAGGCAGG - Intergenic
1096703822 12:53405700-53405722 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1096787551 12:54026179-54026201 CCTTAGGGCAGAAAGGAGGCTGG + Intronic
1096943190 12:55372469-55372491 AAGGAGGGAAGGAGGGAAGCAGG + Intergenic
1096944187 12:55385995-55386017 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1097906988 12:64930867-64930889 CACTGGGACAGGAGTGAGGCTGG - Intergenic
1098065264 12:66608012-66608034 CAGCAGGTGGGGAGGGAGGCAGG + Intronic
1098567931 12:71956500-71956522 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1098740531 12:74168479-74168501 GGGTAGGGCAGGAGGGGAGCAGG + Intergenic
1099095813 12:78372870-78372892 CAGTGGGGCAGGGGCAAGGCAGG - Intergenic
1099438157 12:82668309-82668331 AAGGAGGGGAGGAGGGAGGGAGG - Intergenic
1099669268 12:85669569-85669591 TAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1099935237 12:89117572-89117594 CAGCAGGGCAGCAGGGCAGCAGG - Intergenic
1100106698 12:91183812-91183834 GAGGAGGGAAGGAAGGAGGCTGG - Intergenic
1100274308 12:93058023-93058045 GTCAAGGGCAGGAGGGAGGCTGG + Intergenic
1100742878 12:97614736-97614758 AAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1100761466 12:97811830-97811852 GGGAAGGGAAGGAGGGAGGCAGG + Intergenic
1100787100 12:98089971-98089993 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1100877214 12:98975071-98975093 AAGTAGGGAAGGAGGGAGAGAGG - Intronic
1100992531 12:100266784-100266806 TGGTAGGGCAGGAAGGGGGCGGG + Intronic
1101387111 12:104267819-104267841 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1101824438 12:108209666-108209688 CAGTGGGGCAGCGTGGAGGCAGG - Intronic
1101948377 12:109155129-109155151 CGGGAGGGGAGGAAGGAGGCTGG + Intronic
1102008375 12:109603093-109603115 CCCTAGGTCTGGAGGGAGGCAGG - Intergenic
1102013495 12:109633066-109633088 CAGGCAGGCAGGAGGGAGGGAGG + Intergenic
1102145999 12:110655550-110655572 GAGCAGGCCAGGAGGGTGGCGGG - Intronic
1102150762 12:110688090-110688112 CAGAGGGGCAGGACGGAGGGTGG + Exonic
1102309575 12:111834881-111834903 CTGCAAGGCAGCAGGGAGGCTGG - Intergenic
1102406358 12:112677398-112677420 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1102451451 12:113044926-113044948 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1102451472 12:113044999-113045021 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1102480576 12:113220795-113220817 TAGAAGGGCAGAATGGAGGCCGG + Intronic
1102573065 12:113839276-113839298 CAGGAGGGCAGGAGGCCAGCAGG + Intronic
1103444351 12:120984480-120984502 GAGAAGGGAAGGAGGGAGGAAGG + Intronic
1103521134 12:121537550-121537572 CAGCCGGGGAGGAGGGCGGCAGG + Intronic
1103861755 12:124020942-124020964 GAGAAGGAAAGGAGGGAGGCTGG + Intronic
1103993787 12:124816163-124816185 CCGGAGTGCAGGAGGGAGGGTGG - Intronic
1104110612 12:125700763-125700785 CAGAAGAGGAGGAGGGAGTCGGG + Intergenic
1104191078 12:126482445-126482467 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
1104245610 12:127038295-127038317 GAGTGGGGCAGAAGGGAGGGTGG - Intergenic
1104299311 12:127549789-127549811 CAGGAGGGAAGAAGGGAGGGAGG - Intergenic
1104451679 12:128874040-128874062 AAGGAGGGAGGGAGGGAGGCAGG - Intronic
1104657200 12:130582119-130582141 CAGCAGAGGAGGAGGGAGGGAGG - Intronic
1104661475 12:130613939-130613961 CAGCAGAGAGGGAGGGAGGCAGG + Intronic
1104806119 12:131590543-131590565 CTGTAGGTCTGGAGGGGGGCTGG + Intergenic
1104831881 12:131758015-131758037 CAGAGGGGCAGGCAGGAGGCTGG + Intronic
1104847787 12:131855469-131855491 AAGGAGGCCAGGAGGGTGGCAGG - Intergenic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104990288 12:132620662-132620684 CAGCTGGTCAGGAGGGAGGAGGG - Intronic
1104990952 12:132623566-132623588 AAGCAGGGGAGGAGGGAGGCTGG - Intergenic
1105617979 13:22038132-22038154 CAGGGGGGCAGGATGGAGACAGG - Intergenic
1105772668 13:23627629-23627651 GCGAAGGGCAGGAGGGAGGACGG + Intronic
1106131526 13:26943570-26943592 TACTAGGGTAGGAAGGAGGCAGG + Intergenic
1106281387 13:28275748-28275770 CAGAATGGCAGGAGGGAAGCTGG - Intronic
1106335315 13:28778165-28778187 CAGTAGGGCAGGCGGCAGGCTGG + Intergenic
1106346698 13:28886313-28886335 CAGCAGGGGAGCAGGGAGGCAGG + Intronic
1106770109 13:32953558-32953580 ATGTTGGACAGGAGGGAGGCCGG - Intergenic
1106827593 13:33541395-33541417 AAATAGGGCAAGAAGGAGGCAGG - Intergenic
1106999602 13:35527505-35527527 CAGGAGCTCAGGAGGGAGGCTGG - Intronic
1107336551 13:39361917-39361939 GAAAAGGGCAGGAGGGAGGTAGG + Intronic
1107917648 13:45168919-45168941 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1108035041 13:46281874-46281896 GAGGAGGGCAGGAGGGAGGCTGG - Intergenic
1108046422 13:46388231-46388253 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1109339228 13:61033399-61033421 CAGAAGGGAGGGAGGGTGGCAGG + Intergenic
1109671316 13:65612212-65612234 CAGAAGGGAGGGAGGGAGGGAGG + Intergenic
1109683568 13:65784293-65784315 AAGGAGCGCCGGAGGGAGGCCGG - Intergenic
1111084161 13:83351892-83351914 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1111243691 13:85508114-85508136 AATAAGTGCAGGAGGGAGGCTGG + Intergenic
1111395930 13:87671118-87671140 CTGAATGGCAGGAGGAAGGCAGG + Intergenic
1111446172 13:88348038-88348060 AAAAAGGGAAGGAGGGAGGCAGG + Intergenic
1111766581 13:92538330-92538352 GAGTAGGACAGGAAGGAGGGAGG - Intronic
1112025989 13:95411672-95411694 CAGAAGGGCGGGTGGGAGCCAGG - Intergenic
1112107723 13:96260278-96260300 AAGTAGGGAGGGAGGGAGGGAGG - Intronic
1112246585 13:97740654-97740676 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1112422493 13:99265324-99265346 GAGAAGGGAAGGAAGGAGGCAGG + Intronic
1112506831 13:99980755-99980777 CTGGAGGGAGGGAGGGAGGCCGG + Intergenic
1112508748 13:99990748-99990770 TCGTGGGGCAGGAGGGATGCTGG - Intergenic
1112549809 13:100409085-100409107 CAGCAGTGGAGGAGGGAGGTAGG + Intronic
1113069523 13:106406927-106406949 GAGCAGGACAGGAGGGAGGGAGG - Intergenic
1113425744 13:110207098-110207120 CTGGGGGGCAGGAGGGGGGCAGG - Intronic
1113608282 13:111625748-111625770 CTGCAGGGCAGGGGGCAGGCTGG - Intronic
1113665272 13:112136762-112136784 AAGGAGGGAGGGAGGGAGGCGGG - Intergenic
1113686860 13:112287652-112287674 CAGTACTGCAGGATGGAGCCAGG + Intergenic
1113899611 13:113788889-113788911 GAGTGGGGCAGGAGGGAGGGAGG - Intronic
1113938225 13:114006141-114006163 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938260 13:114006251-114006273 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938321 13:114006437-114006459 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938381 13:114006623-114006645 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938429 13:114006771-114006793 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938464 13:114006881-114006903 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938499 13:114006991-114007013 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938534 13:114007103-114007125 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938630 13:114007380-114007402 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938653 13:114007452-114007474 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1114045451 14:18871647-18871669 GAGGAGGGAAGGAGGGAGGGTGG + Intergenic
1114118761 14:19647821-19647843 GAGGAGGGAAGGAGGGAGGGTGG - Intergenic
1114180692 14:20365228-20365250 AGGGAGGGCGGGAGGGAGGCAGG - Intergenic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1114658513 14:24330340-24330362 CAGAAGGGTAGGAGGGAGTTGGG + Intronic
1115054675 14:29108838-29108860 AAGTAGGAAAGGAGGGAGGGAGG + Intergenic
1115084264 14:29494470-29494492 AAGAAGGGGAGGAGGGAGGGAGG + Intergenic
1115253351 14:31372907-31372929 CGGGAGGGAAGGAGGGAGGGAGG - Intronic
1115351911 14:32404920-32404942 CAGGAGGGAGGGAGGGAGGGTGG + Intronic
1115356579 14:32454696-32454718 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1115356602 14:32454756-32454778 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1115356625 14:32454808-32454830 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1115412196 14:33088464-33088486 CTGCAAGGCAGGAGTGAGGCTGG + Intronic
1115630163 14:35236982-35237004 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1115702841 14:35972230-35972252 AAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1116133307 14:40889200-40889222 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1116305438 14:43248042-43248064 AAGTAGGGAAGGAGGGAGAAAGG - Intergenic
1116808816 14:49519896-49519918 AAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1117202651 14:53408365-53408387 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1117202673 14:53408422-53408444 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1118038311 14:61892052-61892074 AGGAAGGGAAGGAGGGAGGCAGG - Intergenic
1118312532 14:64704436-64704458 CGGGAGGGCAGGAGGGAGCGAGG - Exonic
1119080579 14:71689837-71689859 CTGTAAGGAAGGAGGGAGGGAGG - Intronic
1119089274 14:71765724-71765746 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1119095165 14:71823352-71823374 AAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1119264315 14:73255026-73255048 CAGGAGGGCAGGGAGGAGTCCGG + Intronic
1119322815 14:73741690-73741712 CAGGCGGGCAGGAGGCAGGCAGG - Intronic
1119420042 14:74503059-74503081 AAGTAGGGCAGGGGAGAGGTGGG - Intronic
1119464417 14:74843740-74843762 CAGTAGGGTATGGTGGAGGCTGG + Intronic
1119730387 14:76947471-76947493 CAGAAGGGCAGGGTGGGGGCAGG - Intergenic
1119847420 14:77840853-77840875 AAGAAGGGCAGCAGGGAGGGAGG + Intronic
1120903138 14:89593124-89593146 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1121013638 14:90535522-90535544 CAGCAGGGCAGGCGTGAGGAAGG - Exonic
1121042310 14:90759114-90759136 CAGAAGAGCAGGAAGGAAGCTGG - Intronic
1121292848 14:92791703-92791725 CATTAGGGCAGGGAGGAGGTGGG + Intergenic
1121361909 14:93269329-93269351 CAGCAAGGCAGAAGGGATGCTGG + Intronic
1121614273 14:95302348-95302370 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1121623004 14:95363164-95363186 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1121769112 14:96516389-96516411 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1121882612 14:97514422-97514444 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1121935432 14:98014081-98014103 AAGGAGGGAGGGAGGGAGGCAGG - Intergenic
1122193390 14:100066101-100066123 TTGTAGGGCAGGGGAGAGGCAGG - Intronic
1122277696 14:100603703-100603725 CAGCAGGGCTGGACGAAGGCTGG - Intergenic
1122428538 14:101625521-101625543 GAGCAGGGCAGGAGAAAGGCAGG + Intergenic
1122603456 14:102932525-102932547 CAGGAGGGCAGTGGGGTGGCAGG + Exonic
1122816611 14:104317111-104317133 CAGGATGGCGGGAGGGAAGCAGG - Intergenic
1122853073 14:104547148-104547170 CCCTTGGGCTGGAGGGAGGCTGG + Intronic
1122898333 14:104771542-104771564 GGGCAGGGCAGGAGGGTGGCAGG + Intronic
1122912874 14:104841964-104841986 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1122922317 14:104885130-104885152 CAGCTGGGCAGGAGGGAGCCTGG + Intronic
1123067952 14:105627717-105627739 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123071972 14:105646442-105646464 GAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123072128 14:105647048-105647070 AACAAGGGCAGGTGGGAGGCAGG - Intergenic
1123091633 14:105744718-105744740 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123097683 14:105774167-105774189 GCGCAGGGCAGGTGGGAGGCAGG - Intergenic
1123509275 15:20979829-20979851 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123566499 15:21553576-21553598 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123602760 15:21990862-21990884 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123835679 15:24189439-24189461 CAGCAGGGCAGAAGGGAGCCAGG - Intergenic
1123841108 15:24247972-24247994 CAGCAGGGCAGGAGGCAGCCAGG - Intergenic
1123850451 15:24350795-24350817 CAGCAGGGCAGTAGGCAGCCAGG - Intergenic
1124102888 15:26712390-26712412 CAGAAGAGCAGCAAGGAGGCTGG + Intronic
1124172402 15:27387909-27387931 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1124374654 15:29122466-29122488 CAGTTCTGCAGGAGAGAGGCCGG - Exonic
1124400462 15:29343489-29343511 CTGTAGGGCAGCAGGGAGGCTGG - Intronic
1124409793 15:29427631-29427653 CATAAGGGAAAGAGGGAGGCAGG - Intronic
1124902968 15:33841819-33841841 CAGCAGGGCAGACGGGAGGGCGG - Intronic
1126102811 15:45129899-45129921 CAGTGGGGCGGGATGGAGTCTGG - Intronic
1126775155 15:52094155-52094177 AAATAGGTCAGGAGGGAGGCTGG + Intergenic
1127020626 15:54744039-54744061 CAGCAAGGAAGGAGGGAGGGAGG + Intergenic
1127130640 15:55858694-55858716 AGGAAGGGCAGGAGGCAGGCAGG + Intronic
1127229493 15:56973166-56973188 CAGATGGGAGGGAGGGAGGCGGG - Intronic
1127924955 15:63530266-63530288 AAGGAGGGAGGGAGGGAGGCAGG - Intronic
1128185508 15:65640589-65640611 CAGTTGGGCAGGAGGGCTGAGGG + Intronic
1128249645 15:66155347-66155369 GAGTGGGGCAGGAAAGAGGCCGG + Intronic
1128259286 15:66221296-66221318 CAGGAGTGTGGGAGGGAGGCAGG - Intronic
1128380312 15:67107465-67107487 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1128408589 15:67369527-67369549 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1128458003 15:67843724-67843746 CCGGAGGGAAGGAGGGAGGAAGG + Intergenic
1128647495 15:69388128-69388150 CAGGGAGGGAGGAGGGAGGCAGG - Intronic
1128793529 15:70449555-70449577 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1128796823 15:70472441-70472463 CAGTAGAGGAGGTGGGGGGCGGG - Intergenic
1128805947 15:70531392-70531414 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1129246403 15:74281647-74281669 CAGGAGGGTGGGAGGGAGGTGGG - Intronic
1129300206 15:74621061-74621083 AAGGCCGGCAGGAGGGAGGCAGG - Intronic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129600361 15:76995030-76995052 CAGGATGGCAGGTGGCAGGCGGG + Intronic
1129716950 15:77857741-77857763 TCGGGGGGCAGGAGGGAGGCAGG + Intergenic
1129831305 15:78672705-78672727 CAGATGGACAGGAGGGAGTCAGG + Intronic
1130000502 15:80042292-80042314 CAGGAAGGAAGGAGGGAGGGAGG - Intergenic
1130092766 15:80835177-80835199 AAGGAGGGCAGGAGGCGGGCTGG - Intronic
1130151202 15:81313070-81313092 GAGTGGGGCAGGAGGCAGGAAGG + Exonic
1130252752 15:82311306-82311328 GAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1130258772 15:82338326-82338348 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130269912 15:82440777-82440799 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130462248 15:84168078-84168100 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130473868 15:84247000-84247022 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130481282 15:84361064-84361086 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130490426 15:84426695-84426717 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130502016 15:84505465-84505487 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130512447 15:84600906-84600928 CCGGGCGGCAGGAGGGAGGCTGG - Intergenic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130552280 15:84897779-84897801 CTGAAGGGGAGGAGGGAGGCGGG - Intronic
1130563848 15:84979013-84979035 CACAGGGGTAGGAGGGAGGCTGG + Intergenic
1130596151 15:85251615-85251637 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130685138 15:86030692-86030714 AAGTTGGGCAGGGGGTAGGCGGG - Intergenic
1130847162 15:87758185-87758207 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1130939626 15:88496945-88496967 CAGTTGGGAAGGAGAGATGCCGG - Intergenic
1131096657 15:89659502-89659524 AAGGAAGGAAGGAGGGAGGCAGG + Intergenic
1131223766 15:90607353-90607375 AAGGAGGGGAGGAGAGAGGCTGG - Intronic
1131234045 15:90681209-90681231 CTCTGGGGCAGCAGGGAGGCTGG + Intergenic
1131288276 15:91081231-91081253 AAGTAGGGAAGGAGGGAGGGAGG - Intergenic
1131513468 15:93062684-93062706 GAGAAGGGAAGGTGGGAGGCAGG + Intronic
1131683199 15:94745355-94745377 CATTTTGGTAGGAGGGAGGCAGG - Intergenic
1131688866 15:94804862-94804884 CAGAAGGCCAAGAGGGAGACAGG + Intergenic
1131995680 15:98130810-98130832 CAGTAGGACAGGTGCCAGGCTGG + Intergenic
1132010445 15:98270999-98271021 CAGAATAGCAGGAGGGAGGCAGG + Intergenic
1132255355 15:100372310-100372332 GACTAGGGAGGGAGGGAGGCAGG + Intergenic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1132449976 15:101961708-101961730 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
1202974863 15_KI270727v1_random:280664-280686 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1132612159 16:822578-822600 CAGGACGGCAGGAGCCAGGCTGG - Intergenic
1132868584 16:2105505-2105527 CAGCAGCGCAGGAGGCCGGCAGG + Intronic
1133251114 16:4481883-4481905 GAGGAGGGCAGGAGGGAGAAGGG + Intronic
1133601146 16:7341743-7341765 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1133605158 16:7379805-7379827 GAGGAGGGAGGGAGGGAGGCAGG - Intronic
1133859628 16:9582110-9582132 CAGTAGAGAAGGAGTGTGGCTGG - Intergenic
1133862630 16:9610507-9610529 CAGAAGGGCAGTAGGGTGGAGGG - Intergenic
1134242004 16:12513217-12513239 AAGCAGGGCAGGAGAAAGGCAGG - Intronic
1134315167 16:13112363-13112385 AAGAAGGGAAAGAGGGAGGCAGG + Intronic
1134444632 16:14321549-14321571 CAGAAGGCCCTGAGGGAGGCAGG + Intergenic
1134523003 16:14927154-14927176 CAGCAGGGCAGGAGGCCGGCAGG - Intronic
1134549623 16:15132904-15132926 CAGCAGGGCAGGAGACCGGCAGG + Intronic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134710670 16:16325805-16325827 CAGCAGGGCAGGAGGCCGGCAGG - Intergenic
1134718305 16:16367778-16367800 CAGTAGATGAGCAGGGAGGCTGG - Intergenic
1134718841 16:16370093-16370115 CAGCAGGGCAGGAGGCCGGCAGG - Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134948931 16:18342840-18342862 CAGCAGGGCAGGAGGCCGGCAGG + Intergenic
1134955915 16:18382066-18382088 CAGCAGGGCAGGAGGCCGGCAGG + Intergenic
1134956447 16:18384381-18384403 CAGTAGATGAGCAGGGAGGCTGG + Intergenic
1135477747 16:22792428-22792450 GAGTGGGGCAGGAGAGAGGTGGG + Intergenic
1135592113 16:23712202-23712224 CAGCATGGCAGGAGGGAGAACGG + Intronic
1135975968 16:27109256-27109278 AAAAAGGGCAGGAGGGAGGGAGG + Intergenic
1136096310 16:27959569-27959591 CAGAAGGGCAAAAGGGAGGACGG + Intronic
1136138863 16:28276054-28276076 AAGTGGAGGAGGAGGGAGGCTGG + Intergenic
1136667436 16:31824554-31824576 AAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137561460 16:49504991-49505013 TGGCAGGGCAGGTGGGAGGCAGG + Intronic
1137594249 16:49713464-49713486 CAGCAGGGCAGGGCAGAGGCTGG - Intronic
1137773965 16:51040676-51040698 CAGGCAGGGAGGAGGGAGGCAGG + Intergenic
1137774044 16:51040979-51041001 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1137774052 16:51040998-51041020 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1137907066 16:52333819-52333841 CTGTAAGGCAGCAGCGAGGCTGG + Intergenic
1137994578 16:53196317-53196339 CATTAGGGTAGGAGAGAGGTAGG - Intronic
1138026025 16:53523147-53523169 CAGAAGATCAGGAGAGAGGCTGG - Intergenic
1138249144 16:55489130-55489152 GAGGAGGGCAGGAAGGAGACAGG - Intronic
1138347551 16:56329329-56329351 CAGGAGGGCAGGAGGACGGAAGG + Intronic
1138451238 16:57094295-57094317 CAGTAGGGCGGCTGGGAGGCTGG + Intronic
1138481096 16:57303936-57303958 CAGGAGGGCAGCAGGCAGGGCGG - Intergenic
1138900693 16:61265511-61265533 ATGAAGGGAAGGAGGGAGGCGGG - Intergenic
1138972057 16:62157309-62157331 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1139016260 16:62692459-62692481 CGGGAGGGAAGGAGGGAGGGAGG + Intergenic
1139173652 16:64662286-64662308 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1139313934 16:66051366-66051388 CATTTGGGCTGGAGGGAGGGAGG + Intergenic
1139398241 16:66658250-66658272 AAGGAGAGAAGGAGGGAGGCAGG + Intronic
1139435132 16:66932508-66932530 CAGCAGCGCAGGAGGCAGCCAGG - Intronic
1139495496 16:67314165-67314187 AAGAAGGGGAGGAGGGAGGGAGG - Intronic
1139672119 16:68499087-68499109 CAGTAGGGGAAGAGGGAGGGAGG - Intergenic
1139869061 16:70089448-70089470 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1140442647 16:74999330-74999352 CCGCAGGGAAGGAGGGAGGGAGG - Exonic
1140683025 16:77404008-77404030 CGGTAGGGAGGGAGGGAGGGAGG - Intronic
1140725459 16:77807541-77807563 TAGATGGGCAGGAGGGAAGCTGG - Intronic
1141137220 16:81474289-81474311 CAGTAGGGAGAGAGGGAGGGAGG - Intronic
1141421984 16:83923591-83923613 CTCTAGGGAAGGAGGCAGGCTGG - Exonic
1141621920 16:85240848-85240870 CAGTCGGGGAGCAGAGAGGCTGG + Intergenic
1141741149 16:85894010-85894032 CTGTAGGGCACGGGGGATGCAGG - Intergenic
1141756238 16:85992961-85992983 CAGAAGGACAGAAGGGAGGAAGG - Intergenic
1141806757 16:86347110-86347132 CAGCAGGACAGGAAGGGGGCTGG - Intergenic
1141857197 16:86691464-86691486 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1141927651 16:87179602-87179624 CTTTAGGGCAGGCGTGAGGCTGG + Intronic
1142229979 16:88895565-88895587 CAGTGGCACAGGGGGGAGGCCGG + Intronic
1142292776 16:89200525-89200547 GAGGAGGGCAGGTGGGAGGTGGG + Intronic
1203143412 16_KI270728v1_random:1783808-1783830 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1142478718 17:204949-204971 CAGTCGGGAAGGAGGGAGCAGGG + Intergenic
1142737633 17:1911352-1911374 GAGGAGGGCAGGAGGTAAGCAGG - Intergenic
1142755990 17:2016705-2016727 CAGGCGGGCAGGCGGGAGGCCGG + Intronic
1142807956 17:2381338-2381360 CAGTAGGGCAGGCAGGGGGTAGG - Intergenic
1142889256 17:2932361-2932383 CAGTGGAGGAGGAGGGAGACTGG + Intronic
1143375259 17:6463428-6463450 AGGGAGGGAAGGAGGGAGGCAGG + Intronic
1143410236 17:6704218-6704240 AAGAAGGGAAGGAGGGAGGGAGG - Intronic
1143410827 17:6707378-6707400 CAGCTGGGAAGGAGGGAGGCAGG - Intronic
1143447943 17:7019830-7019852 GAGCAGGGCTGGCGGGAGGCAGG - Intergenic
1143544360 17:7587895-7587917 CAGAAGGGAAGCAGGGAGGCTGG - Exonic
1143669839 17:8389059-8389081 CAGAAGGGAGGGAGGGAGGGAGG - Intergenic
1143669843 17:8389067-8389089 AAGAAGGGCAGAAGGGAGGGAGG - Intergenic
1143673726 17:8415107-8415129 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1143963417 17:10738972-10738994 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1144495228 17:15741564-15741586 CTGTAGGGAGGGAGGGTGGCTGG - Intronic
1144645667 17:16971979-16972001 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1144781096 17:17809076-17809098 GAGTAAGGCGGGAGGGAGGGAGG + Intronic
1144786547 17:17835476-17835498 CAGTAGGGCAGGAGTGGTGGTGG + Intronic
1144807689 17:17978594-17978616 CAGCAGGGCTGGACTGAGGCAGG - Intronic
1144899261 17:18568927-18568949 GAGAAGGGAAGGTGGGAGGCAGG - Intergenic
1144943638 17:18958853-18958875 CAGTGGAGCAGGCCGGAGGCTGG + Intronic
1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG + Intronic
1145018399 17:19413154-19413176 GGGCGGGGCAGGAGGGAGGCGGG + Intronic
1145747064 17:27328246-27328268 CAGCAGGGCAGGGGGCAGGTGGG + Intergenic
1145788854 17:27611656-27611678 CAGTAGGGCTGGAGGTGGGGTGG + Intronic
1145883007 17:28365317-28365339 CGGTGGGGAAGAAGGGAGGCTGG + Intronic
1146176085 17:30667479-30667501 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146349543 17:32083589-32083611 CAGGAGAGGACGAGGGAGGCAGG + Intergenic
1146489443 17:33269675-33269697 CAGGCAGGCAGGAGGGAGGGAGG - Intronic
1146496220 17:33324840-33324862 GAGAAGGGCAGCAGGCAGGCTGG - Intronic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1146888237 17:36486766-36486788 CACTAGGGCACGCGGCAGGCTGG - Exonic
1146892248 17:36513731-36513753 GAGAAGGGTAGGTGGGAGGCTGG + Intronic
1146914608 17:36670616-36670638 GAGCAGGGCAGGACGGAGGGAGG - Intergenic
1146916079 17:36679350-36679372 CACTGAGGCAGGAGGGAGCCGGG - Intergenic
1147212574 17:38880467-38880489 CTGGAGGCCAGGAGGGAGACAGG - Intronic
1147384318 17:40072479-40072501 CAGGCGGGCAGGAGACAGGCGGG + Intronic
1147579974 17:41622720-41622742 AAGGAGGGGAGGCGGGAGGCGGG - Intronic
1147636541 17:41967551-41967573 CAGAAGGGCTGGTGGGGGGCAGG - Intronic
1147677923 17:42220102-42220124 CAGGCGGGCAGGAGGCAGGCAGG - Intronic
1147688125 17:42299470-42299492 CAGGCGGGCAGGAGGCAGGCAGG + Intronic
1147746747 17:42699353-42699375 CTTCAGGGCAGGGGGGAGGCTGG - Exonic
1147767124 17:42844722-42844744 CAGAGGGGCAGTGGGGAGGCTGG - Exonic
1147977341 17:44255347-44255369 ATATAGGGCAGGAGGAAGGCAGG - Intronic
1148014267 17:44510005-44510027 AAGAAGGGAGGGAGGGAGGCAGG + Intergenic
1148102190 17:45099047-45099069 CAGAAGGGGAGGAGGGAGGAGGG + Intronic
1148105791 17:45118189-45118211 GAGCAGGGCAGCAGGCAGGCTGG + Intronic
1148143034 17:45341862-45341884 CAGTAGGGGAGGAGGGGGCGTGG + Intergenic
1148182951 17:45620216-45620238 CAGAAGGGGAAGAGGGATGCAGG - Intergenic
1148397843 17:47324168-47324190 CAGTAGGGTGCGAGGGAGGAAGG + Intronic
1148545921 17:48518982-48519004 GAGTAGGGCAGGAGAGACGCTGG - Intergenic
1148564624 17:48625699-48625721 CCGAAGGCCAGGAGGGGGGCGGG - Intronic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1148758700 17:49988076-49988098 GAGGAAGGAAGGAGGGAGGCAGG - Intergenic
1148845821 17:50529217-50529239 GAATAAGGCAGGTGGGAGGCAGG - Intronic
1148956149 17:51355246-51355268 GAGTAAGGCAGGAGCCAGGCAGG + Intergenic
1149777737 17:59371240-59371262 CAGTAGGGAAGGGGGAAGGTCGG + Intronic
1149806184 17:59620029-59620051 GAGAAGGGGAGGGGGGAGGCTGG - Exonic
1149885301 17:60333659-60333681 GAGAAGGGAAGGAGGGAGGGAGG + Intronic
1149910049 17:60558783-60558805 CAGATGGACAGGAGGGAGCCAGG - Intergenic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150216734 17:63475588-63475610 CTGCAGGTCAGGAGGGAGGCTGG + Intergenic
1150220154 17:63491476-63491498 CAGCAGGGCAGGATGGGGACAGG + Intronic
1150223001 17:63507795-63507817 GCCTGGGGCAGGAGGGAGGCAGG + Intronic
1150345208 17:64399267-64399289 CAGCTGGGCAAAAGGGAGGCAGG + Intronic
1150425768 17:65075843-65075865 CAGAAGGGCAAGAAGGAAGCAGG - Intergenic
1150626087 17:66842073-66842095 CAGTGGGGCCGGAGAGAGCCGGG - Intronic
1151286182 17:73113329-73113351 AAGAAGGGTAGGAGGGAGGAAGG - Intergenic
1151328540 17:73393495-73393517 CAGATGGGCAGGAGGAAGGGCGG + Intronic
1151399737 17:73848322-73848344 CATTAGGGCATGAGGGTGGACGG - Intergenic
1151521296 17:74632249-74632271 AAGGAAGGCAGGTGGGAGGCTGG - Intergenic
1151698015 17:75727880-75727902 CAGCAGGGCAGGAGGGGGACAGG + Intronic
1151830111 17:76544514-76544536 AAGTAGGGCAGGCAGGAGGCAGG + Intronic
1152106887 17:78335433-78335455 GAAGAGGGCAGGAGGGAGGGAGG - Intergenic
1152225363 17:79090302-79090324 CTGCCGGGCAGGAGGGAGGTGGG + Intronic
1152328513 17:79656850-79656872 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1152403479 17:80083210-80083232 CAGTTGGGGAGGGGGGAGGCAGG + Intronic
1152484168 17:80578863-80578885 CAGGAGGGCATGGGGGCGGCCGG + Intronic
1152570484 17:81119334-81119356 CAGAAGGGCACGCGGGAGGCAGG - Intronic
1152686585 17:81696721-81696743 GCGTAGGGCAGGGGGAAGGCGGG - Exonic
1152740909 17:82017963-82017985 CACCAGGGCAGGAGAGAGGCTGG + Intergenic
1152803479 17:82343065-82343087 AAGAAAGGAAGGAGGGAGGCTGG - Intergenic
1152917833 17:83051283-83051305 CAGGTGCGCAGGAGCGAGGCGGG + Intronic
1153266013 18:3270161-3270183 CAGAAGGGAAGGAGAGAGGGTGG + Intronic
1153468275 18:5414656-5414678 CAGGAGGGCTGCAGGGAGCCTGG + Intronic
1153631299 18:7072865-7072887 CTGGAGGGCTGGAGGGAGGCAGG + Intronic
1153994113 18:10424758-10424780 CCGGAGGGAGGGAGGGAGGCAGG + Intergenic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154095796 18:11413824-11413846 CAGGAGGGAAGGAAGGAGGGAGG - Intergenic
1154346242 18:13545840-13545862 CAATGGGGCAGGATGGAGGCTGG + Intronic
1154358587 18:13641566-13641588 CTGCAGAACAGGAGGGAGGCCGG + Intronic
1155533645 18:26793919-26793941 CAGGAAGGCAGAAGGGAGGAAGG - Intergenic
1156076771 18:33288328-33288350 CAGGAGGGGAGGAGAGAGGAGGG - Intronic
1156146963 18:34194405-34194427 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1156367310 18:36440923-36440945 TAGCAGGGCAGGAGGGTGGCGGG - Intronic
1156761803 18:40601049-40601071 AAGAAGGGAAGGAGGGAGGAAGG - Intergenic
1157091575 18:44643195-44643217 CAGTAAGGCAGGGTGGAGGTTGG + Intergenic
1157302463 18:46488934-46488956 CATTGGCTCAGGAGGGAGGCAGG - Intronic
1157557345 18:48621545-48621567 CAGTGAGGCAGGAGGGAACCAGG + Intronic
1158339923 18:56454824-56454846 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1158536957 18:58316785-58316807 AAGAAGGCCAGGAGGAAGGCTGG - Intronic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158611121 18:58941967-58941989 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1159019461 18:63131482-63131504 CAGTGGGGCAGGAAGGAGTCAGG + Intronic
1159360969 18:67402093-67402115 CAGTAGTCCAGGTGGGAGGTGGG + Intergenic
1159771230 18:72547344-72547366 CAGAAGGGCAGGAGGGTAGGAGG + Intronic
1159987285 18:74858133-74858155 AGGAAGGGAAGGAGGGAGGCAGG - Intronic
1160022685 18:75192679-75192701 CAGCAGGGCAGGTAGGAGCCAGG - Intergenic
1160194123 18:76738964-76738986 CAGGAGGGAGGGAGGGAGGGAGG - Intergenic
1160194143 18:76739016-76739038 CAGGAGGGAGGGAGGGAGGGAGG - Intergenic
1160194160 18:76739056-76739078 CAGGAGGGAGGGAGGGAGGGAGG - Intergenic
1160317086 18:77858470-77858492 GAGTACAGCAGGTGGGAGGCAGG + Intergenic
1160346877 18:78139508-78139530 CAGAAAAGCAGGAGGGAGGGTGG - Intergenic
1160393947 18:78558574-78558596 CACTTGGGGAGGAGGGAGGGCGG - Intergenic
1160511220 18:79454552-79454574 CAGCAGGGCAGGAGGAGGGTGGG + Intronic
1160560268 18:79751347-79751369 CAGGAGGGAAGGAGGGAGCGGGG + Intronic
1160635278 19:70840-70862 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1160899973 19:1422888-1422910 CAGCAGGGCAGGTGGGAGGAGGG + Intronic
1160916844 19:1500815-1500837 GAGAAGGGGAGGAGGGAGGAGGG + Intergenic
1160916851 19:1500830-1500852 GAGGAGGGGAGGAGGGAGGAGGG + Intergenic
1160969727 19:1762248-1762270 CAGGAGGGCAGGAGGGTTGGAGG - Intronic
1160969730 19:1762256-1762278 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1160982156 19:1821417-1821439 CCGCAGGGCAGGGGCGAGGCTGG + Intronic
1161141639 19:2651397-2651419 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1161141649 19:2651428-2651450 AAGGAAGGCAGGAGGGAGGGAGG - Intronic
1161210611 19:3063299-3063321 CAGGAAGGCCGGAGGGAGGCAGG + Intergenic
1161233769 19:3188180-3188202 CCGGGGGGCTGGAGGGAGGCCGG - Intronic
1161354200 19:3810161-3810183 CCGCAGGGCGGGGGGGAGGCCGG + Intronic
1161500250 19:4610453-4610475 GAGGAGGGCAGGGTGGAGGCGGG + Intergenic
1161716822 19:5880842-5880864 CCCTGGGCCAGGAGGGAGGCTGG + Intronic
1161738442 19:6005841-6005863 CAGTGGGGCTTAAGGGAGGCTGG + Intronic
1161833373 19:6627024-6627046 AAGAAAGGAAGGAGGGAGGCAGG - Intergenic
1161994235 19:7702661-7702683 TAGGAGGGAAGGAGGGAAGCGGG + Intergenic
1162237708 19:9321729-9321751 GAGTGGGGGAGGAGGGTGGCAGG - Intergenic
1162343773 19:10107941-10107963 CTGTAGGACAGGAGAGAGGAGGG - Intronic
1162479779 19:10921509-10921531 CAAGAGGGCAGGCGGGCGGCCGG - Intronic
1162512911 19:11130547-11130569 CAGAGGGCCAGGAGGGAGGAAGG + Intronic
1162736167 19:12748210-12748232 CACTTGGGCAGGAGGCAGGGAGG + Exonic
1162812453 19:13172468-13172490 CATGAGGGCAGAAGGCAGGCAGG - Intergenic
1162964942 19:14151160-14151182 CAGGAGGGGAGGAGAGGGGCCGG + Exonic
1162968654 19:14167486-14167508 CAGGAGGGCAGCAGGCAGGGTGG - Intronic
1163034733 19:14564100-14564122 AAGTGGGGCAGGTGGGAGGAGGG + Intronic
1163106128 19:15124040-15124062 CAGGAGGGCATCAGGGAGGCTGG - Intronic
1163354658 19:16802168-16802190 CAGCTGTTCAGGAGGGAGGCAGG + Intronic
1163500678 19:17674419-17674441 CAGGAGGCCAGGGCGGAGGCTGG + Intronic
1163584104 19:18154696-18154718 CAGTAGGCCAGGAGGAAGCCAGG - Intronic
1163689523 19:18730954-18730976 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1163763602 19:19150205-19150227 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1164423027 19:28113945-28113967 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1164448048 19:28334370-28334392 CAGCAGGGGAGGAGACAGGCAGG + Intergenic
1164522251 19:28988465-28988487 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1164588694 19:29494520-29494542 AAGAAGGGAAGGAGGGAGGCAGG + Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1164975626 19:32570945-32570967 AGGGAGGGAAGGAGGGAGGCAGG - Intergenic
1165136962 19:33675612-33675634 CAGTGGGGCAGGAAGGAGGCTGG - Intronic
1165703226 19:37954490-37954512 CAGTGGGGAAGGAGACAGGCTGG + Intronic
1165742803 19:38213611-38213633 CAGCAGGGCACGCGGGGGGCGGG + Intronic
1165898394 19:39156613-39156635 ACGGAGGGCGGGAGGGAGGCGGG - Intronic
1166062445 19:40335027-40335049 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1166076798 19:40418351-40418373 CAGGAGGGAAGGAAGGAGGGAGG - Intergenic
1166226577 19:41399409-41399431 AAGTGGGGCAGGAGGTGGGCAGG + Intronic
1166283305 19:41809226-41809248 AAGTAGGGAGGGAGGGAGGGAGG + Intronic
1166329599 19:42070262-42070284 CAGGAGGAAGGGAGGGAGGCAGG + Intronic
1166534256 19:43562296-43562318 CTGTATGGAAGGAGGGAGCCTGG + Intronic
1166559117 19:43720137-43720159 GGGGAGGGGAGGAGGGAGGCAGG + Intergenic
1166668845 19:44697976-44697998 CAGGTGGGCAGGAGTCAGGCCGG + Intergenic
1166766448 19:45254206-45254228 CAGCCGGGCGGGAGGGAGCCAGG + Intronic
1166792232 19:45405104-45405126 GACTTGGGCTGGAGGGAGGCGGG + Intronic
1166918754 19:46213910-46213932 TAGGAGAGCAGGAGAGAGGCAGG + Intergenic
1166954672 19:46455344-46455366 AAGGAAGGAAGGAGGGAGGCGGG - Intergenic
1167125498 19:47545714-47545736 CGGTGGGGCAGGAGGGAGCCGGG + Exonic
1167146177 19:47681741-47681763 AGGTGGGGCAGGAGAGAGGCAGG + Intronic
1167303764 19:48695641-48695663 CAGGAAGGCAGCATGGAGGCGGG - Intergenic
1167396805 19:49234915-49234937 TGGGAGGCCAGGAGGGAGGCTGG + Intergenic
1168109148 19:54181908-54181930 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1168147299 19:54426902-54426924 GAGCAGCCCAGGAGGGAGGCGGG + Intronic
1168240827 19:55088073-55088095 TAGGAGGTCAGGAGGGAGCCTGG - Intergenic
1168464978 19:56594981-56595003 CAGGAGGGAAGGGGGGAGGAGGG - Intergenic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
925160060 2:1677500-1677522 CAGCTGTGGAGGAGGGAGGCTGG - Intronic
925173532 2:1767166-1767188 CAGAAGGGCAGGATGGAGTGTGG - Intergenic
925235573 2:2274353-2274375 GAGAAGGGAAGGAGGGAGGGAGG + Intronic
925399700 2:3563446-3563468 CAGAAATGAAGGAGGGAGGCCGG - Intergenic
925456445 2:4020548-4020570 CAGACGGACAGGAGGGAGCCAGG + Intergenic
925659236 2:6184543-6184565 ATGGAGGGCAGGAGGGAGGGAGG + Intergenic
925799450 2:7583466-7583488 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
925913460 2:8587992-8588014 CAGTGGGGCAGGTGGGAACCTGG + Intergenic
925969201 2:9095386-9095408 GAGTGGGGCAGGAAGGACGCTGG + Intergenic
926010100 2:9400440-9400462 GAGGATGGCAGGAGGGAGGAGGG - Intronic
926192913 2:10741875-10741897 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
926251458 2:11157474-11157496 GGGAAGGGCATGAGGGAGGCAGG - Intronic
926579092 2:14615165-14615187 AAGTAAGGAAGGAGGGAGGGAGG + Intergenic
926921908 2:17947251-17947273 CAGTGGGGCCTGAGTGAGGCTGG + Intronic
927194685 2:20539375-20539397 CACTAGGGCAGGAGGGGAGGTGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927963279 2:27254223-27254245 CAGGCTGGCTGGAGGGAGGCTGG - Intronic
928225953 2:29448300-29448322 CAGTAATTTAGGAGGGAGGCTGG + Intronic
928251596 2:29686001-29686023 TAAAAGGGAAGGAGGGAGGCAGG - Intronic
928602363 2:32915984-32916006 CAGGAGGGAAGGAGGAAGGGAGG - Intergenic
928602366 2:32915992-32916014 AAGTAGAGCAGGAGGGAAGGAGG - Intergenic
928789013 2:34928755-34928777 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
928919488 2:36511842-36511864 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
928921898 2:36535162-36535184 AAGGAGGACAGGAGGGAGGGAGG + Intronic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929238833 2:39632744-39632766 CAGTAGGGCAGCATGAAGGCTGG + Intergenic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929342202 2:40834242-40834264 CAGATGGGAAGGAGGGAGGAAGG - Intergenic
930016162 2:46971957-46971979 AGGTAGGGAGGGAGGGAGGCAGG + Intronic
930288095 2:49459395-49459417 AGGGAGGGAAGGAGGGAGGCAGG + Intergenic
930424963 2:51201626-51201648 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
930762089 2:55049235-55049257 CAGGAGGTGAGGAGGGAGCCCGG + Intronic
931667275 2:64618326-64618348 CAGTGGGGCAGGAGAGAGCAGGG + Intergenic
932050777 2:68395824-68395846 CAGGAGGGGAGGAGGAATGCAGG - Exonic
932071631 2:68626426-68626448 CAGAAGGGAGGGAGGGAGGGAGG - Intronic
932166772 2:69514966-69514988 CTGTAGTGCAGGAGGCAGCCTGG - Intronic
932457185 2:71857371-71857393 AAATAGGGCAGTAGGGAGGAAGG - Intergenic
932564855 2:72899745-72899767 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
932568876 2:72926587-72926609 CAGTAAGTTAGCAGGGAGGCAGG - Intronic
932576164 2:72963521-72963543 CAGTAGGACAGGGGGAAGGGAGG + Intronic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
932852515 2:75200504-75200526 CGGCAGGGCAGGATGGAGGCGGG - Intergenic
933946249 2:87288557-87288579 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
934588571 2:95526891-95526913 CAGCCGGGCAGGTGGGAGGCCGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935224171 2:101038681-101038703 CAGAAGGGCGGGAGGAAGGTAGG + Intronic
935400067 2:102651127-102651149 GAGTAGGGCAGGAGGGGGATGGG - Intronic
935682187 2:105647694-105647716 CAGCAGGTCAGTGGGGAGGCTGG - Intergenic
935706496 2:105861916-105861938 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
936093142 2:109513705-109513727 CACAAGGGAAGGAGGGAGGTGGG + Intergenic
936105105 2:109615972-109615994 CTGGAGGGCAGGGGGGAGGAGGG + Exonic
936233943 2:110726859-110726881 CAGAAGGTCAGGAGTGTGGCTGG - Intergenic
936333966 2:111573026-111573048 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
936566202 2:113584203-113584225 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
936914140 2:117622821-117622843 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
937025722 2:118695707-118695729 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
937206207 2:120238696-120238718 CAGTGGGGCAGGAGGAGGACAGG + Intergenic
937289544 2:120773894-120773916 AAGGAAGGAAGGAGGGAGGCAGG - Intronic
937305454 2:120867803-120867825 CTGGAGGGAAGGAGGGAGGGAGG + Intronic
937559296 2:123201669-123201691 GAGTAGTGGAGGAGGGAGGCTGG - Intergenic
937615848 2:123921405-123921427 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
938092039 2:128440577-128440599 CAGAAGGGGAGAGGGGAGGCTGG + Intergenic
938138456 2:128777590-128777612 CAGAAGGGACGGAGGGAGGGAGG - Intergenic
938139897 2:128786998-128787020 CGGGAGAGCAGGAGGGAGGCAGG - Intergenic
938240266 2:129737934-129737956 CAGGAGGGCAGGAGGGCAGGAGG - Intergenic
938860583 2:135364091-135364113 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
939476511 2:142694357-142694379 CACTAGGACAGGAGCGAGGCTGG + Intergenic
939825919 2:147015502-147015524 AAGAAGGGAGGGAGGGAGGCAGG + Intergenic
939833310 2:147098712-147098734 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
940551881 2:155169320-155169342 CAGTGAGCCAGCAGGGAGGCTGG + Intergenic
941987459 2:171522888-171522910 CGGCTGGGCGGGAGGGAGGCTGG + Intronic
942181873 2:173387943-173387965 CAGCAGAGCAGAAGGGAGGCTGG + Intergenic
942289431 2:174454663-174454685 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
942629431 2:177939493-177939515 GAGGAGGGAAGGAGGGAGGGAGG + Intronic
942849975 2:180472830-180472852 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
942943716 2:181650076-181650098 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
943729094 2:191282807-191282829 AAGTAGGGAAGGAAGGAGGAGGG + Intronic
943860631 2:192857762-192857784 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
944171426 2:196783265-196783287 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
944897211 2:204177521-204177543 GAGTAGGGAAGGAGGGAGGGAGG - Intergenic
944941607 2:204634115-204634137 AGCTAGGGCAGGAGGGAGGTGGG - Intronic
944982120 2:205133417-205133439 CAGTAGGTGTGGAGGGAGCCTGG - Intronic
945546878 2:211165740-211165762 CAGGATGGAAGGAGGGAGGGAGG + Intergenic
946081392 2:217122731-217122753 CAGTCGGGCATGCGGGAGGAGGG - Intergenic
946421287 2:219566497-219566519 CAACATGGCAGGAGGCAGGCAGG + Intronic
946973659 2:225123246-225123268 AGGGAGGGCAGGAGGGAGGGAGG - Intergenic
947077723 2:226363934-226363956 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
947077775 2:226364065-226364087 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
947524520 2:230870118-230870140 CAGTGGGGCATCAGGGAGCCTGG - Intronic
947833388 2:233158033-233158055 GAGAGGGGAAGGAGGGAGGCAGG + Intronic
948025282 2:234771554-234771576 AAGTAGGACAGGAGGAAGGTAGG + Intergenic
948072940 2:235142032-235142054 CTGTAGGGCAGCTGGCAGGCTGG - Intergenic
948319768 2:237060069-237060091 CGGTAGAGCAGGAAGGATGCGGG + Intergenic
948443538 2:238013796-238013818 CAGTGGGGCAGGGGCCAGGCTGG + Intronic
948479507 2:238240820-238240842 GAGGAGGGGAGGAGGGAGGCGGG - Intergenic
948550278 2:238766203-238766225 GAATAGGGCAGGAAAGAGGCAGG - Intergenic
948650663 2:239441388-239441410 CAGCAGGGAGGGAGGGAGGCCGG + Intergenic
948654999 2:239471080-239471102 CAGGAGGGCAGGAGGGTGGGTGG - Intergenic
948708132 2:239807772-239807794 AGGTAGGGCAGGGGGCAGGCAGG + Intergenic
948815912 2:240510260-240510282 GAGGAGGGCAGGAGGCAGGGAGG - Intronic
948815927 2:240510304-240510326 GAGGAGGGCAGGAGGCAGGGAGG - Intronic
948931946 2:241137535-241137557 CAGCAGGGAGGGAGGGAGGGAGG + Intronic
1168854145 20:997187-997209 CACTGAGGAAGGAGGGAGGCGGG - Intronic
1169150386 20:3285002-3285024 GTGGAGGGCAGGAGGGAGGTGGG - Intronic
1169276505 20:4236729-4236751 CAGACAGGAAGGAGGGAGGCAGG + Intronic
1169280141 20:4260198-4260220 CTGTAGGGCAGGCTGCAGGCTGG + Intergenic
1169509906 20:6252209-6252231 GAGAGGGGAAGGAGGGAGGCAGG + Intergenic
1169856643 20:10110640-10110662 CAGTCTGGCAGGAGGAGGGCAGG - Intergenic
1169968754 20:11246411-11246433 CAGTAGGGGAGGGGGCAGGAAGG + Intergenic
1170639451 20:18138483-18138505 CCTTGGGCCAGGAGGGAGGCTGG - Intronic
1170770598 20:19328980-19329002 AAGTTGGGCACCAGGGAGGCGGG + Intronic
1170813908 20:19696928-19696950 CAATGGGGAAGGAGGGAGGGAGG + Intronic
1170880940 20:20296138-20296160 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG + Intronic
1170906235 20:20517276-20517298 CATTAGGACAGGAGTGAGGCTGG + Intronic
1171182061 20:23098169-23098191 GAGTTGGGCAGGAGAGAGACAGG - Intergenic
1171216592 20:23356866-23356888 CAGTGGGGTAGGAGGTGGGCAGG + Intergenic
1171862402 20:30412933-30412955 AAGTAGGGAGGGAGGGAGGTAGG + Intergenic
1172027772 20:31960722-31960744 CACTGTGGCAGGAGGGAGCCAGG + Intergenic
1172096786 20:32464301-32464323 CAGAAAGGCAGGAGGGGTGCAGG + Intronic
1172108628 20:32532052-32532074 TAAGAGGGCAGGTGGGAGGCTGG - Intronic
1172116555 20:32576675-32576697 CGGCAGAGCAGGTGGGAGGCTGG - Intronic
1172427290 20:34863754-34863776 CAGCTGGGCAGCAGGGAGGCTGG + Intronic
1172468083 20:35171930-35171952 AGGGAGGGCAGGAGGGAGGCCGG + Intergenic
1172649707 20:36494030-36494052 AAGAAAGGCAGCAGGGAGGCAGG - Intronic
1172785974 20:37469263-37469285 CAGGAAGGAAGGAGAGAGGCAGG - Intergenic
1172841055 20:37903045-37903067 AGGGAGGGGAGGAGGGAGGCGGG + Intergenic
1172938877 20:38641070-38641092 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1173197167 20:40925110-40925132 CTGGAGAGCAGGAGGGAGGTGGG + Intergenic
1173397750 20:42696312-42696334 GAGGAGGGAAGGAGGGAGGGAGG - Intronic
1173432371 20:43000052-43000074 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1173557698 20:43978347-43978369 AAGAAGGGCGGGAGGGAGGCAGG - Intronic
1173671709 20:44803648-44803670 CAGAAGGGGAGGGGGGAGGAAGG + Intronic
1174405297 20:50298949-50298971 CGGGTGGGCAGGTGGGAGGCAGG + Intergenic
1174469345 20:50744636-50744658 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1174502593 20:50996638-50996660 CTGTAAAGGAGGAGGGAGGCAGG + Intergenic
1174543798 20:51309772-51309794 TCGGAGGGCAGGAGAGAGGCTGG + Intergenic
1174545653 20:51323187-51323209 CAGTAAGGAAGGAGCAAGGCGGG - Intergenic
1174769103 20:53281719-53281741 CAGTAAGGGAGTAGGGAAGCAGG + Intronic
1174797399 20:53533737-53533759 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1174926543 20:54766746-54766768 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1174959537 20:55139541-55139563 CAGAAGGGAGGGAGGGAGGGAGG - Intergenic
1175288041 20:57850923-57850945 CAGGAAGGAAGGAGGGAGGGAGG + Intergenic
1175717144 20:61262785-61262807 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1175877916 20:62238940-62238962 CAGCGGGGCAGCAGGGGGGCTGG - Intronic
1175918430 20:62438441-62438463 CAGTGGTGCAGGAGGGCTGCCGG + Intergenic
1175923237 20:62459591-62459613 GGGCAGGGCGGGAGGGAGGCAGG - Intergenic
1175983467 20:62752880-62752902 CAGGAGAACAGGAGGGACGCGGG + Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176093383 20:63328809-63328831 CAGGAGGGCGGGAGGGCGGGAGG - Intronic
1176388025 21:6149034-6149056 CTGCAGGGCAGGCGGCAGGCAGG - Intergenic
1176424674 21:6540901-6540923 AAGCAGGGAAGGAGGGTGGCAGG - Intergenic
1176425677 21:6547036-6547058 CTGCAGGGCAGGCGGCAGGCTGG - Intergenic
1176778203 21:13160250-13160272 AGGAAGGGAAGGAGGGAGGCCGG + Intergenic
1176946632 21:14990200-14990222 GAGGAGGGGTGGAGGGAGGCAGG - Intronic
1177046895 21:16182539-16182561 AAGGAGGGATGGAGGGAGGCAGG - Intergenic
1178131303 21:29575312-29575334 CAGAAGGGTGGGAGGGTGGCAGG + Intronic
1178163918 21:29950205-29950227 AAGGAGGGAAAGAGGGAGGCAGG - Intergenic
1178407948 21:32339916-32339938 GAGTGAGGAAGGAGGGAGGCCGG - Intronic
1178422778 21:32455585-32455607 CAGGAGGGCAGCAGGTAGCCTGG - Intronic
1178690660 21:34746987-34747009 CAGGAGGGCAGATGGGAGGGAGG - Intergenic
1178830004 21:36048074-36048096 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1179030052 21:37712545-37712567 GAGAAGGGGAGGAGGGAGGGAGG - Intronic
1179296820 21:40070243-40070265 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1179296847 21:40070334-40070356 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
1179450689 21:41466553-41466575 AGGCAGGGCAGGAGGGAAGCTGG - Intronic
1179544515 21:42105362-42105384 GAGGATGGGAGGAGGGAGGCAGG - Intronic
1179563796 21:42234160-42234182 CAGAAGGGAAGGAGGGTGGAGGG + Intronic
1179700163 21:43149210-43149232 AAGCAGGGAAGGAGGGTGGCAGG - Intergenic
1179701168 21:43155353-43155375 CTGCAGGGCAGGCGGCAGGCTGG - Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179720908 21:43315599-43315621 CAGGCAGCCAGGAGGGAGGCTGG + Intergenic
1179735447 21:43389214-43389236 CTGCAGGGCAGGCGGCAGGCAGG + Intergenic
1179912601 21:44458170-44458192 CAGAGGGGCAGGAAGCAGGCGGG - Exonic
1180063843 21:45403211-45403233 GAGTGGGGCAGGAGAGAGGTAGG + Intergenic
1180137342 21:45870459-45870481 TCCTAGGGCAGCAGGGAGGCCGG + Intronic
1180151561 21:45950801-45950823 CAACAGGGCTGGAGGGAGGGAGG - Intergenic
1180237556 21:46472831-46472853 GAGTAAGGCAGGAGGGGTGCTGG + Intronic
1180463982 22:15594264-15594286 GAGGAGGGAAGGAGGGAGGGTGG + Intergenic
1180650125 22:17370048-17370070 CAAAAGGGCAGGAGGGCGGGCGG + Intronic
1180938391 22:19641172-19641194 CCGAAGGGAAGGAGGGAGCCAGG - Intergenic
1181062453 22:20288168-20288190 CAGAGGGGCAGGAGCGAGGAGGG - Intergenic
1181202760 22:21227457-21227479 CAACAGGGCAGGGAGGAGGCAGG - Exonic
1181314149 22:21961059-21961081 CAGAGGGGCAGAAAGGAGGCTGG + Intronic
1181622385 22:24099902-24099924 AAGCAGGAAAGGAGGGAGGCAGG + Intronic
1181630250 22:24147344-24147366 AAGCAGGGAGGGAGGGAGGCAGG - Intronic
1182150490 22:28024031-28024053 CAGAAGGGAGGGAGGGAGGGAGG - Intronic
1182164732 22:28161811-28161833 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1182548433 22:31088792-31088814 CAGCAGGGCAGGGGTGGGGCCGG - Intronic
1182669539 22:31984208-31984230 GAGAAGGGCAGGAGGCTGGCTGG + Intergenic
1182767155 22:32765704-32765726 GAGAAGGGGAGGAGGAAGGCTGG + Intronic
1183055084 22:35300198-35300220 CAGTAGGTAAGGAGAGAGGGTGG + Intronic
1183056214 22:35307703-35307725 CAGAAGGGAAGGACGGAGCCAGG + Intronic
1183174529 22:36213048-36213070 CAGAAGGGCTGGAGTGGGGCTGG + Intergenic
1183295844 22:37029190-37029212 CAGCAGGGGAGCAGGGAGGAGGG - Intronic
1183310788 22:37108512-37108534 CAGAAGGGCAGGAGGGAGTGAGG - Intronic
1183363367 22:37394470-37394492 GAGGAGGGCGGGAGGGAGCCTGG - Intronic
1183417091 22:37688774-37688796 CTCCAGGGCGGGAGGGAGGCTGG + Intronic
1183432431 22:37773818-37773840 CAGGAGGGAAGGAGGGCGGCTGG - Exonic
1183616756 22:38950420-38950442 CAGGAGGGCAGGAAGAAGTCTGG + Intergenic
1183618323 22:38958394-38958416 CAGAAGGGAAGGAAGGAGGGAGG - Intronic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
1183638932 22:39081768-39081790 CAGGAAAGCAGGTGGGAGGCAGG - Intronic
1183853989 22:40617175-40617197 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1184103370 22:42353400-42353422 GAGTAGGGAAGGAAGGAGGGAGG + Intergenic
1184109923 22:42388646-42388668 CGGGAGGGAAGGAGGGAGGGAGG + Intronic
1184280798 22:43436379-43436401 CAGAGGGCCAGGAGTGAGGCAGG + Intronic
1184362623 22:44027305-44027327 CAGTGGGCCAGGATGGAGGTCGG + Intronic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184503002 22:44885293-44885315 CAGCAGTGCAGGAAGGAGCCAGG - Intronic
1184711248 22:46250639-46250661 CGGGAGGGCAGGTGGGAGACTGG - Exonic
1184718184 22:46293883-46293905 CATCAGGGCAGGAAGCAGGCAGG + Exonic
1184781718 22:46652936-46652958 CTGGTGGGCAGGAGGCAGGCCGG + Intronic
1184836069 22:47021804-47021826 CACTGGGGCGGGAGGGAGACAGG - Intronic
1185014047 22:48333246-48333268 GAGTGAGGCTGGAGGGAGGCGGG - Intergenic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
1185058605 22:48593817-48593839 CAGCAGGGCAGGAGGGCGGCAGG - Intronic
1185108025 22:48885342-48885364 GAGGACGGGAGGAGGGAGGCAGG - Intergenic
1185108039 22:48885387-48885409 GACGAGGGGAGGAGGGAGGCAGG - Intergenic
1185108053 22:48885432-48885454 GACGAGGGGAGGAGGGAGGCAGG - Intergenic
1185134285 22:49060308-49060330 CAGGAGGGCTGGAGGGTGGAAGG - Intergenic
1185151600 22:49167102-49167124 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1185202677 22:49517655-49517677 CTGTAGGGCAGTGGGGAGGGTGG - Intronic
1185273154 22:49937794-49937816 CCACAGGGCAGGTGGGAGGCTGG - Intergenic
1185315033 22:50175282-50175304 CAGTAGGGCCGCAGGGAGATGGG - Intronic
949928759 3:9061723-9061745 CTGGAGGACAGGAGGGAGGGAGG + Intronic
950089463 3:10285135-10285157 CAGTAGTGGAGAAGGGAGGAAGG + Intronic
950201945 3:11050720-11050742 CATCAGGGCATGAGGGAAGCAGG - Intergenic
950331328 3:12158449-12158471 CAGTATGGCCGGAGTGAGGGAGG + Intronic
950484249 3:13263791-13263813 CCTTAGGGCAAGGGGGAGGCTGG - Intergenic
950513940 3:13451738-13451760 CTGTAAGGCAGGAGGCAGCCGGG + Intergenic
950526866 3:13529356-13529378 AAGGAGGGCAGGAGGGATGGAGG - Intergenic
950795352 3:15505984-15506006 CAGGTGGGGAGGAGGGAGGCTGG + Intronic
950907584 3:16553049-16553071 GAGAAGGGGAGGAGGGAGGGAGG + Intergenic
950964457 3:17136685-17136707 GAGTAGGGCAGGAGCAGGGCAGG - Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951508940 3:23480158-23480180 TACGAGTGCAGGAGGGAGGCCGG - Intronic
952344163 3:32468541-32468563 AAATAGGGAAGGAGGGAGGAAGG - Intronic
952623583 3:35376292-35376314 AAGGAGGGCCGGAGGGAGGGAGG + Intergenic
953000975 3:38932643-38932665 CTGCAAGGCAGCAGGGAGGCTGG + Intronic
953104017 3:39857240-39857262 CAGGAGGGAGGGAGGGAGGAAGG + Intronic
953242410 3:41161332-41161354 CAGGAGGGTATGAGGAAGGCTGG - Intergenic
953337283 3:42104095-42104117 CTGCAAGGCAGCAGGGAGGCTGG + Intronic
953349426 3:42203468-42203490 CAGGAGGGCAAGAGGGAGAGAGG - Intronic
953771317 3:45780296-45780318 CAGAAGGTGAGGAGGGAGGTTGG - Intronic
953961940 3:47273292-47273314 CATTTGGGAAGGAGGGAGTCAGG - Intronic
954262480 3:49449593-49449615 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
954373877 3:50184243-50184265 CAGCTGTGCAGGAGGGAGACGGG + Intronic
954387366 3:50251204-50251226 CAGAAGGGCAAGAGGGTGGAGGG - Intronic
954795599 3:53160080-53160102 CAGCAGGGCAGAGGAGAGGCTGG - Intronic
955412324 3:58663814-58663836 CAGCAGGGCCGGGGAGAGGCTGG - Intronic
955996932 3:64687690-64687712 AAGGAGGGCAGGAGGGAGGGGGG - Exonic
956181314 3:66520415-66520437 CAGGAGGACAGCAGAGAGGCTGG - Intergenic
956219312 3:66884752-66884774 CAGAAGGGAGGGAGGGAGGGAGG + Intergenic
956643677 3:71435977-71435999 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
956836514 3:73100431-73100453 CCATAGGGCAGGAGGGAGGGGGG + Intergenic
957040063 3:75329570-75329592 CGGGAGGGGAGGGGGGAGGCTGG + Intergenic
957611422 3:82472164-82472186 GAGAAGGACAGGAGGGAGACAGG + Intergenic
958496106 3:94846438-94846460 CTGTAAGGCAGCAGCGAGGCTGG + Intergenic
959455303 3:106552635-106552657 CAGATGGACAGGAGGGAGCCAGG - Intergenic
960506553 3:118501321-118501343 CAGGAGGGAGTGAGGGAGGCAGG - Intergenic
960708505 3:120504593-120504615 CTGAAGGGCAGGAGAGAGGAGGG - Intergenic
960891423 3:122452535-122452557 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
960891471 3:122452672-122452694 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
961029243 3:123587521-123587543 CAGTTTGGCAGGCAGGAGGCTGG + Intergenic
961041017 3:123678381-123678403 CACAAGTGCAGGAGGGAGGTGGG - Intronic
961064444 3:123862788-123862810 AAGTAGGGGAGAAGGGAGGTGGG - Intronic
961329001 3:126128018-126128040 CAGTGGGGCATGAGGGTGGAGGG + Intronic
961331936 3:126147617-126147639 CAGTGGGGCAGGAGTCAGGAGGG + Intronic
961345261 3:126260041-126260063 GAGGAGGGGAGGAGGGAGGAGGG - Intergenic
961552983 3:127679722-127679744 TGGCAGGGCAGGCGGGAGGCAGG - Intronic
961560833 3:127728549-127728571 CAGTAAGGCAGAATGGAGGCAGG - Intronic
961653176 3:128427562-128427584 CTGTGGGCCATGAGGGAGGCTGG - Intergenic
961660221 3:128464776-128464798 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
961807660 3:129500915-129500937 CAGTAGAGCAGGAGGGAACTTGG + Intronic
961933300 3:130556030-130556052 GAGAAGGGCAGGAGGGTTGCAGG - Intergenic
961995006 3:131233109-131233131 AGGTAGGGAAGGAGGGAGGGAGG + Intronic
962057057 3:131883691-131883713 AAGAAGGGCAGCAAGGAGGCAGG - Intronic
962066142 3:131982077-131982099 CATAATGGCAGAAGGGAGGCAGG - Intronic
962095127 3:132285286-132285308 CGGTAGGCCAGCAGGGCGGCAGG - Exonic
962270654 3:133975653-133975675 CAGTATGGCTGGATGGAGGGAGG - Intronic
962316899 3:134364611-134364633 GGGTGGGGCAGGAGGTAGGCTGG - Intronic
962369040 3:134805527-134805549 CAGGAGGGCAGGAGGCAAGGTGG - Intronic
962485519 3:135838805-135838827 CATTAGGGAAGGTTGGAGGCTGG - Intergenic
962519002 3:136180751-136180773 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
962530536 3:136276443-136276465 CACTAGGGCAGGAGCGAGTCTGG - Intronic
962557135 3:136565039-136565061 CAGAAGGGAGGGAGGGAGGGAGG + Intronic
962736541 3:138330109-138330131 AGGCAGGGCAGGAGGGATGCAGG - Intergenic
963016423 3:140828415-140828437 CAGGAGGGCAGGTGGGTGGGTGG - Intergenic
963256797 3:143152998-143153020 GACTGGGGCAGGAGGGAGGAGGG - Intergenic
963321628 3:143815044-143815066 CAAAAGGGAAGGAAGGAGGCAGG + Intronic
963526869 3:146426182-146426204 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
963631204 3:147732387-147732409 CAGGTGGGGAGGAAGGAGGCAGG - Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964421736 3:156510846-156510868 CAAAGGGGCAGGAGGGAAGCCGG - Intronic
964531363 3:157671439-157671461 AAGAAGGGAAGGAGGGAGGGAGG - Intronic
964903843 3:161693954-161693976 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
965083887 3:164069463-164069485 CAGGAGGGAAGGAGGGAAGGTGG + Intergenic
965282788 3:166775217-166775239 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
965445610 3:168770042-168770064 CTGCAAGGCAGCAGGGAGGCTGG - Intergenic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
965988992 3:174792285-174792307 AAGGAGGGAGGGAGGGAGGCAGG + Intronic
966140413 3:176750640-176750662 CAATAAGGCAGGAGAGAGGGTGG + Intergenic
966418441 3:179714110-179714132 GAGTAGGGCAGGACGGAGACGGG + Intronic
966461486 3:180181673-180181695 AAGGAGGGAGGGAGGGAGGCAGG - Intergenic
966881214 3:184352333-184352355 TAGTAGAGAGGGAGGGAGGCTGG + Intronic
966886494 3:184380283-184380305 CAGCTGGGGAGGAGGGAGGGAGG - Exonic
967253967 3:187571023-187571045 CAGTAGGACAGGAGGATGGCAGG - Intergenic
967350709 3:188511148-188511170 AAGGAGGGAGGGAGGGAGGCAGG - Intronic
967877462 3:194276968-194276990 CAGGAGGGCAGATGGCAGGCTGG - Intergenic
968066776 3:195763314-195763336 AAGCCGGGCAGGAGGGAGGGAGG - Intronic
968937145 4:3617359-3617381 CAGGAGGGAAGAAGGGAGGGAGG - Intergenic
969125549 4:4945284-4945306 TAGCAGGGCAGGCAGGAGGCTGG + Intergenic
969139429 4:5055671-5055693 CAGACGAGCAGGAAGGAGGCAGG - Intronic
969143558 4:5100760-5100782 AAGAAGGGAAGGAGGGAGGGAGG - Intronic
969172000 4:5371587-5371609 CTGAAGGGGAGGTGGGAGGCTGG + Intronic
969355216 4:6621069-6621091 CAGGAGGGTGAGAGGGAGGCTGG + Intronic
969402294 4:6963459-6963481 CAGCTGGGCAGGAGCGAGCCTGG - Intronic
969405260 4:6987267-6987289 CGGGAGGGAGGGAGGGAGGCCGG + Intronic
969439961 4:7211212-7211234 CAGGAGAGCGGGAGGGAGGGAGG + Intronic
969659539 4:8518414-8518436 CATTAGGGCAGAAGGGAGGGCGG + Intergenic
969682910 4:8653074-8653096 GAGAAGGGCAGGAGGGAGGGAGG - Intergenic
970050164 4:11905295-11905317 TAGGAGGCCAGGTGGGAGGCTGG - Intergenic
970137894 4:12945893-12945915 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
970534369 4:17014268-17014290 CAGAAGGGCTGGAAGCAGGCAGG - Intergenic
970654385 4:18214942-18214964 CAGGAGGGCAGGAGCAAGGCTGG + Intergenic
970856549 4:20655633-20655655 CAGAAGAGCAGGAGAGAGACAGG - Intergenic
971193428 4:24448812-24448834 AATTAGGGAAGAAGGGAGGCGGG + Intergenic
971289819 4:25327389-25327411 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
971394310 4:26214482-26214504 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
971489330 4:27194636-27194658 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
972924220 4:43983825-43983847 AGGAAGGGAAGGAGGGAGGCAGG + Intergenic
973596052 4:52490806-52490828 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
973676378 4:53268056-53268078 CGGTAGGGCAGGAGGAATGAAGG + Intronic
973772862 4:54222699-54222721 AAGCAGGGAAGGAGGGAGGGAGG - Intronic
973788072 4:54352822-54352844 CAGAAGGGTGGGAGGGTGGCAGG - Intergenic
973818848 4:54644646-54644668 TAGTGGGGGAGGTGGGAGGCTGG + Intergenic
974176677 4:58333743-58333765 CTGTAAGGCAGCAGAGAGGCTGG + Intergenic
974351697 4:60755843-60755865 CAGTGGGGGAGGAAGGAGGTGGG + Intergenic
974723521 4:65771854-65771876 CAGTAAGGTAGCAGCGAGGCTGG - Intergenic
975089240 4:70381418-70381440 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
975228462 4:71902921-71902943 CAGAAAGGAAGGAGGGAGGGAGG - Intergenic
975528136 4:75373654-75373676 CTGTAGGGGAGGAGGGAGGGAGG - Intergenic
976245525 4:83002468-83002490 GAGGAGGGAAGGAGGGAGGGAGG + Intronic
976907860 4:90262765-90262787 CACAGGGGCAGGAGTGAGGCTGG - Intronic
977577000 4:98685376-98685398 CAGTAGAGTAGGAAGGAGCCGGG - Intergenic
978297283 4:107220570-107220592 GAGTGGGGAAGGAGGGAGGGAGG + Intronic
978728631 4:111999344-111999366 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
979032414 4:115666286-115666308 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
979698555 4:123640969-123640991 CAGGAAGGAAGGAGGGAGGGAGG + Intergenic
979994319 4:127412156-127412178 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
980807148 4:137828332-137828354 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
981136500 4:141216543-141216565 CAGTAGGGCACAAGTGTGGCTGG + Intergenic
981413373 4:144458875-144458897 AAGAAGGGAAGGAGGGAGGAAGG + Intergenic
982129039 4:152210450-152210472 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
982294119 4:153808907-153808929 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982558628 4:156900886-156900908 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
982645208 4:158015507-158015529 CAGTAGGGCTGGAAAAAGGCTGG + Intergenic
982720012 4:158849511-158849533 CATAAGGGAAGGAGAGAGGCAGG + Intronic
983175742 4:164586029-164586051 CTGCAAGGCAGGAGTGAGGCTGG + Intergenic
984224997 4:177023800-177023822 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985453672 4:190073188-190073210 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
985455650 4:190079774-190079796 TAGGAGGGAGGGAGGGAGGCAGG + Intergenic
985552505 5:540787-540809 CAGCAGGCCAGGAGGGAGACGGG - Intergenic
985629971 5:1009096-1009118 CGGTAGGGCGGGAGGGCGGGCGG + Intronic
985680380 5:1252876-1252898 CCGAAGGGCAGCAGGGATGCTGG - Intergenic
985812892 5:2103270-2103292 CAGGAGAGCAGGGGGGTGGCGGG - Intergenic
985873940 5:2581098-2581120 CAGGAGGGAGGGAGGGAGGAAGG - Intergenic
985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG + Intergenic
985993706 5:3584640-3584662 GAGTAAGGAAAGAGGGAGGCGGG + Intergenic
986313332 5:6571010-6571032 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
986313384 5:6571157-6571179 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
986313397 5:6571192-6571214 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
986313421 5:6571262-6571284 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
986313476 5:6571429-6571451 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
986313489 5:6571464-6571486 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
986313502 5:6571499-6571521 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
986313526 5:6571569-6571591 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
986313554 5:6571648-6571670 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
986313567 5:6571683-6571705 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
986334259 5:6741416-6741438 GAGTAGGGCAGGAGAGTGCCAGG + Intronic
986349903 5:6867535-6867557 CAGGAGTGCAGGGGAGAGGCAGG + Intergenic
986696632 5:10362082-10362104 CAGAAGGGAAGGAGAGAGACAGG - Intronic
986733171 5:10649782-10649804 CCCCAGGGCGGGAGGGAGGCCGG - Exonic
987558358 5:19484651-19484673 CAGTAGTGCAGGAAGGGGGATGG - Intronic
988266207 5:28953761-28953783 CTGCAAGGCAGCAGGGAGGCTGG - Intergenic
988481076 5:31631096-31631118 CACGAGGGAAGGAGGGAGGTGGG + Intergenic
989360652 5:40597807-40597829 ATGTAGGGCCGCAGGGAGGCTGG + Intergenic
990179182 5:53141479-53141501 CAGCAAGGCAGCAGCGAGGCTGG + Intergenic
990830883 5:59955772-59955794 CCGAAGGGCAGGAGGGAGGGAGG - Intronic
991329873 5:65482547-65482569 AAGTAGGGGAGGAGGGAGCGGGG + Intergenic
991347233 5:65682423-65682445 CAGAAGGGTAGAATGGAGGCAGG + Intronic
991625148 5:68593558-68593580 CAGCAGGGCAGCACGGAGGAAGG + Intergenic
991898770 5:71435208-71435230 AAGTAGGGAGGGAGGGAGGGAGG - Intergenic
992093936 5:73342913-73342935 AAGGAGGGAGGGAGGGAGGCAGG + Intergenic
992257384 5:74934514-74934536 TAGGAGGGAAGGAAGGAGGCAGG + Intergenic
992760567 5:79947849-79947871 CAGTAGTTTAGGAGGGAGGGGGG + Intergenic
992778520 5:80108143-80108165 CAGTAGGGCAAGAGGGAGAGAGG + Intergenic
992955298 5:81901878-81901900 CAGACGGACAGGAGGGAGGCAGG + Intergenic
993042727 5:82834057-82834079 CAGTGGGGAAGGAGGCAGGGTGG + Intergenic
993168459 5:84385021-84385043 GAGGAGGGGAGGAGGGAGGAAGG - Intergenic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
993686678 5:90945988-90946010 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
994535608 5:101025991-101026013 TAGTTAGGCATGAGGGAGGCGGG + Intergenic
994596407 5:101843243-101843265 AAGTAGGGAAGGAGGGAGGGAGG + Intergenic
994608160 5:101997549-101997571 GAGTTGGGAAGGAGGGAGGGAGG - Intergenic
994730982 5:103490474-103490496 AAGGAGGGAAGGAGGGAGGTTGG - Intergenic
994856761 5:105131458-105131480 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
994918983 5:106017693-106017715 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
995840416 5:116438521-116438543 CCCAAGGGCAGGAGGAAGGCTGG + Intergenic
995982205 5:118117955-118117977 AAGTGGGGAGGGAGGGAGGCAGG - Intergenic
996387733 5:122926377-122926399 CTGCAGGGCAGGAGTGAAGCAGG + Intronic
997293852 5:132757397-132757419 CAGGAAGGCAGGAGGAAGCCAGG + Intronic
997355408 5:133259727-133259749 CAGTAGTTCAGGAGAGAGACAGG + Intronic
997567270 5:134898047-134898069 CAGTGGTGCTGAAGGGAGGCTGG - Intronic
997647236 5:135489501-135489523 CTGTCCGGCCGGAGGGAGGCCGG + Intergenic
997900059 5:137755262-137755284 AAGGAGGGCGGGAGGGTGGCAGG - Intergenic
998040003 5:138945840-138945862 CAGCAGGGCAGGCTGGAGGCAGG - Intergenic
998080769 5:139273545-139273567 CTGCAGGGCACTAGGGAGGCCGG + Intronic
998127004 5:139631038-139631060 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
998128355 5:139638817-139638839 CAGTGAGGCAGGAGGCTGGCTGG - Intergenic
998147830 5:139740324-139740346 CAGTAGGGCAGCTGGGAGGATGG + Intergenic
998154369 5:139776127-139776149 CAGGAGGTCAGGAAGGAGACTGG - Intergenic
998183428 5:139961359-139961381 CAGGAGGGGAGGAGGGGGGCAGG - Intronic
998499654 5:142621379-142621401 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
998621214 5:143796198-143796220 AAGGAGGGCAGCAGGGAGGGAGG - Intergenic
998704347 5:144741288-144741310 AAGAAGGGAGGGAGGGAGGCAGG - Intergenic
999255351 5:150206897-150206919 CAGCAGGGCAGCAGGGCAGCGGG - Intronic
999506137 5:152198458-152198480 CAGCAGGGCAGCAGGAGGGCAGG + Intergenic
999737929 5:154526652-154526674 CGGTGGGGCAGGAGGGGGCCAGG - Intergenic
999858560 5:155620975-155620997 CAGTCTGGCAGCAGGGAGGGAGG + Intergenic
1000168342 5:158677301-158677323 CCTTGGGGCAGGAGGGAGGAAGG - Intergenic
1000981932 5:167825457-167825479 TAGAAGAGCAGAAGGGAGGCTGG + Intronic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001142530 5:169156857-169156879 CAGGAGAGCAGAAGGCAGGCTGG + Intronic
1001311039 5:170611175-170611197 CAGCTGGGCAGGAAGGAAGCAGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001646670 5:173287277-173287299 TACCAGGGCAGTAGGGAGGCGGG + Intergenic
1001691785 5:173638774-173638796 CAGTCGGGAAGGAGAGAGGAAGG - Intergenic
1001860210 5:175047763-175047785 CTCTGGGGCAGGAGGGTGGCAGG + Intergenic
1002047234 5:176549069-176549091 CACTGGGGCAGGCTGGAGGCGGG - Intronic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002101657 5:176860897-176860919 CAGGTGGGCAGGAGGCAGGCAGG + Intronic
1002191867 5:177482556-177482578 AGGGAGTGCAGGAGGGAGGCTGG - Intergenic
1002283413 5:178146604-178146626 CATTAGGTCATGAGGAAGGCGGG - Intronic
1002356406 5:178632885-178632907 CACACGGGCAGGAGGGAGCCAGG - Intergenic
1002432319 5:179210754-179210776 GAGGAGGACAGGAGGGGGGCTGG - Intronic
1002470613 5:179433159-179433181 CAGTGAGCCAGGAGAGAGGCCGG - Intergenic
1002618303 5:180468926-180468948 CAGAAGGCCACGGGGGAGGCTGG + Intergenic
1002854872 6:1027668-1027690 AAGAAGGGAGGGAGGGAGGCAGG + Intergenic
1002883380 6:1272583-1272605 CAGACGGACAGGAGGGAGCCAGG + Intergenic
1002917717 6:1542190-1542212 GGGGAGGGAAGGAGGGAGGCAGG + Intergenic
1002918191 6:1545888-1545910 GGGCAGGGCAGGAGAGAGGCTGG + Intergenic
1003153423 6:3571641-3571663 CAGTAGGGCTGGAGCAAGGCTGG + Intergenic
1003189017 6:3856726-3856748 GAGGAGGGCAGGAGGGAGCGTGG - Intergenic
1003438939 6:6121937-6121959 GAGGAGCACAGGAGGGAGGCTGG + Intergenic
1003464867 6:6369271-6369293 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1003712138 6:8603836-8603858 AAGAAGGGAGGGAGGGAGGCAGG - Intergenic
1004396192 6:15248355-15248377 CAGGCGGGCAGGAGGGCGGGTGG + Intronic
1004692542 6:18004772-18004794 CAGTGAGGCTGGAGGGAGCCAGG - Intergenic
1005008294 6:21311961-21311983 CAGAAGGGGAGTAGGGAGGTGGG - Intergenic
1005441892 6:25878943-25878965 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1005631058 6:27708423-27708445 AAGTAGGGAGGGAGGGAGGTAGG - Intergenic
1006075530 6:31529829-31529851 TTGAAGGGCAGGAGGGAGCCTGG + Exonic
1006441683 6:34057278-34057300 CAGTATGGCAGGGGGGCGTCTGG - Intronic
1006513543 6:34534074-34534096 CAGGTGTGCAGGAGGGAGGAGGG - Exonic
1006516875 6:34550181-34550203 CAGCAGGGCAAGAGAGAGGCTGG - Intronic
1006827749 6:36948645-36948667 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1006888205 6:37400052-37400074 GAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1007237564 6:40401789-40401811 TAGTGGGGCAGAGGGGAGGCTGG - Intronic
1007322809 6:41039426-41039448 CTGGAAGGAAGGAGGGAGGCAGG + Intronic
1007406413 6:41638428-41638450 GAGTAGGGGAGGAGCGAGGGGGG + Exonic
1007817253 6:44533358-44533380 CACTAGGGCAGGAGTGGGGATGG + Intergenic
1007844423 6:44741743-44741765 CAGTAGGACATGAGGGTGGGAGG + Intergenic
1008489014 6:52065891-52065913 CTGTATGGCATGAGGGATGCAGG - Intronic
1009418062 6:63437173-63437195 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1009820183 6:68790238-68790260 CTGCAAGGCAGCAGGGAGGCTGG + Intronic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1010725217 6:79325344-79325366 CTGTAAGGCAGCAGCGAGGCTGG - Intergenic
1011222230 6:85066904-85066926 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1011260198 6:85462264-85462286 AAGTAGGGCTGGAGGCAGTCCGG - Intronic
1011280288 6:85670779-85670801 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1011893448 6:92194900-92194922 CATCATGGCAGGAGGCAGGCAGG - Intergenic
1011946702 6:92913729-92913751 AAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1013201158 6:107897018-107897040 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1013459137 6:110358387-110358409 CGGTCGGGAGGGAGGGAGGCGGG - Intergenic
1013536908 6:111071377-111071399 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1014356059 6:120411649-120411671 CAGGAAGGAAGGAGGGAGGGAGG + Intergenic
1015085574 6:129287088-129287110 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1015122181 6:129711781-129711803 CAGTTGTGCAGGGGGGAGGGAGG - Intergenic
1015153307 6:130062961-130062983 AAGAAGGGAAGGAGGGAGGGAGG - Intronic
1015966315 6:138698254-138698276 CAGTACAGGAGGAGGGAGACAGG - Intergenic
1015998506 6:139018829-139018851 AAGGAGGACAGGAGGGAGGGAGG + Intergenic
1015998510 6:139018837-139018859 CAGGAGGGAGGGAGGGAGGGAGG + Intergenic
1016278449 6:142382882-142382904 GAGTAGGGCAGGCAGGAGGTGGG + Intronic
1016393333 6:143597002-143597024 CAGGAGGGAAGGAGGCAGGAGGG - Intronic
1016731753 6:147435114-147435136 CAAAAGGGCAGGATGGAGGGTGG - Intergenic
1016804873 6:148202487-148202509 CAGGAGGGCTGCCGGGAGGCTGG + Intergenic
1016841924 6:148533517-148533539 CTGCAGGGCAGGAGGGTGGAGGG + Intronic
1016902418 6:149115495-149115517 GAGTAGGTCAGGAAGGAGGAAGG + Intergenic
1016934078 6:149436107-149436129 CAGTAGGGGCTGGGGGAGGCCGG + Intergenic
1016974137 6:149790681-149790703 CAGAAGGGGAGAAGGAAGGCTGG + Intronic
1016981652 6:149860400-149860422 CAGGAGGGAGGGAGGGAGGGAGG - Intronic
1017206486 6:151808409-151808431 CAGGAGGGAGGGAGGGAGGGAGG + Intronic
1017297228 6:152812049-152812071 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1017336993 6:153272607-153272629 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1017574551 6:155787584-155787606 CAGATGGACAGGAGGGAGACAGG + Intergenic
1017904963 6:158751647-158751669 GAGTAGGGCCTGAGGAAGGCAGG + Intronic
1018759968 6:166885195-166885217 CTGCAAGGCAGCAGGGAGGCTGG + Intronic
1019062053 6:169263615-169263637 CAGAAGGGCAGCTGGGAGGGAGG - Intergenic
1019357138 7:586495-586517 CAACAGGGCTGGAGGGTGGCAGG - Intronic
1019367430 7:642012-642034 CACTTGGGGAGGAGGGAGGAGGG - Intronic
1019416744 7:931140-931162 CAGGAGGGAAGGAAGGAGGGAGG + Intronic
1019524455 7:1474469-1474491 CCTTAGGGCAGGAGGGTGGTTGG - Intronic
1019542871 7:1559439-1559461 CAGCAGTGAAGGAGGCAGGCAGG - Intronic
1019549225 7:1593944-1593966 AAGCAGGGAAGGAGGGAGGAAGG - Intergenic
1019891993 7:3954479-3954501 CAGGAGGGGAGGGGGGAGGGTGG - Intronic
1020106132 7:5423198-5423220 CAGGAGGGCCGGAGCGGGGCTGG + Intronic
1020722255 7:11761897-11761919 AAGGGGGGAAGGAGGGAGGCAGG - Intronic
1020749309 7:12120492-12120514 TTGGAGGGCAGTAGGGAGGCAGG + Intergenic
1021112450 7:16710656-16710678 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1021588887 7:22239551-22239573 CAGTAAGGCAGCAGGGAGGGTGG - Intronic
1021862821 7:24923731-24923753 CAGTGGGGCAGGCGGGCGGCCGG + Intronic
1021995857 7:26177595-26177617 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1022041752 7:26588151-26588173 CTGGTGGGGAGGAGGGAGGCTGG + Intergenic
1022101945 7:27174086-27174108 CCGTAGGGCAGGTCGGCGGCGGG + Exonic
1022170195 7:27820012-27820034 CAGTAAGGCTGGAGTGGGGCAGG - Intronic
1022522844 7:31019148-31019170 GGGTAGGGCAGGAGGGAGGTGGG + Intergenic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1023718170 7:43065188-43065210 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1023848148 7:44134821-44134843 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1024022479 7:45384781-45384803 CAGCTGGGCAGAAGGGAGCCAGG + Intergenic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1024706535 7:51967221-51967243 CAGTAGGACAGGAAGGACGGGGG + Intergenic
1024867361 7:53919468-53919490 CAGTGGGTCAAGATGGAGGCAGG - Intergenic
1024917367 7:54516040-54516062 CAGCATGGCAGATGGGAGGCAGG - Intergenic
1025031062 7:55557273-55557295 CAGGAGGGCAGCACGGAGCCTGG + Intronic
1025085595 7:56020701-56020723 CGGGAGGGCAGGAGGGAGAGAGG + Intronic
1025151232 7:56552445-56552467 AAGGAAGGAAGGAGGGAGGCAGG - Intergenic
1025232855 7:57214326-57214348 CAGTAAGACAGGAGAGTGGCAGG - Intergenic
1025582923 7:62742489-62742511 CAGCAAGGCAGCAGTGAGGCTGG - Intergenic
1025992835 7:66508587-66508609 AAGTAGGGAGGGAGGGAGGAAGG - Intergenic
1026207278 7:68269031-68269053 AAGTAGGGAAGGAGGGAGGGAGG - Intergenic
1026539836 7:71270038-71270060 GTGTAGGGCAGCAGGGAGGTAGG - Intronic
1026578522 7:71594654-71594676 CAGAAGGGGAGGAGGCAGGCAGG + Intronic
1026595745 7:71733014-71733036 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1026877172 7:73886481-73886503 CTCTGGGACAGGAGGGAGGCGGG + Intergenic
1026896493 7:74012888-74012910 CTGGAGTGCAGGAGGGAAGCTGG + Intergenic
1027035587 7:74922808-74922830 AAGGAGGGGATGAGGGAGGCAGG + Intergenic
1027416875 7:77983392-77983414 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1027416889 7:77983428-77983450 AAGGAGGGAGGGAGGGAGGCAGG - Intergenic
1027416904 7:77983472-77983494 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1027733580 7:81905222-81905244 AAGGAAGGCAGGAGGGAGGAAGG - Intergenic
1028167592 7:87556431-87556453 TAGCAGTGCAGGAGGGAAGCTGG - Intronic
1028371795 7:90100335-90100357 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1028480884 7:91303397-91303419 CAGAAGGGCAGCAGGTAGCCAGG + Intergenic
1028696386 7:93717753-93717775 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1029088270 7:98028305-98028327 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1029257105 7:99277150-99277172 CAGTAGGGAAGGAAGGAGGGAGG + Intergenic
1029280943 7:99435134-99435156 CAGGTGGGCAGGAGGCAGGGAGG - Exonic
1029303868 7:99604595-99604617 CAGTAAGGAGGGATGGAGGCGGG + Exonic
1029394471 7:100298329-100298351 AAGGAGGGGATGAGGGAGGCAGG - Intergenic
1029519411 7:101050704-101050726 CAGGAGGGCGGGAGTGAGGATGG + Intronic
1029706090 7:102276789-102276811 CAGTAGGGGAGGAGGGAATGGGG + Intronic
1030114587 7:106053670-106053692 AAGAAGGGAAGGAGGGAGGGAGG - Intergenic
1030338548 7:108351192-108351214 CAGAAGGGCAAGAGAGAGGAGGG - Intronic
1030466103 7:109905839-109905861 CTGCAGGGCGGCAGGGAGGCTGG + Intergenic
1030553424 7:110993742-110993764 CAGTAGGGGAGCAGGGAGAGAGG - Intronic
1031340644 7:120595888-120595910 AAGGAGGGAGGGAGGGAGGCAGG + Intronic
1031385444 7:121144527-121144549 GAGTAGGGCAGTGGAGAGGCTGG + Intronic
1031483365 7:122303551-122303573 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1031584650 7:123519642-123519664 GAGAAGGGCAGGAGGGAGGAAGG + Intronic
1032087747 7:128892657-128892679 CAGCAGGGCAGCAGCAAGGCTGG + Intronic
1032357759 7:131226026-131226048 AAGTAGGGAGGGAGGGAGGGGGG - Intronic
1032856824 7:135841937-135841959 CAGAACAGCAGGAGGGATGCAGG + Intergenic
1033131782 7:138751252-138751274 CAGCAGGGCCGGTGGGAGGCAGG - Intronic
1033485165 7:141781828-141781850 AAGTAGGGAGGGAGGGAGGGAGG - Intronic
1033629040 7:143139296-143139318 CAGAAGGACAGAAGGGAGGGAGG + Intronic
1034436635 7:151065725-151065747 CAGGATGGCAGGGAGGAGGCTGG + Intronic
1034441725 7:151089042-151089064 CAGCAGGGCAGCAGGGCAGCAGG - Intronic
1034448138 7:151123703-151123725 GAGGGAGGCAGGAGGGAGGCCGG + Intronic
1034704440 7:153127826-153127848 CTGGAGGGCAGGAGGAAGGCAGG + Intergenic
1035136937 7:156712859-156712881 CAACAGGGCAGGGGGGAGGCTGG + Intronic
1035159877 7:156942863-156942885 CAGTGCGGCAGGCGTGAGGCTGG + Intergenic
1035221879 7:157411036-157411058 CAGCACGGCAGGTGGGCGGCCGG - Intronic
1035280537 7:157775676-157775698 CACAAGGGCAGGACGGAGCCTGG + Intronic
1035392315 7:158513074-158513096 CAGCAGGGAAAGAGGGAAGCGGG + Intronic
1035519425 8:265559-265581 CTGTATGACATGAGGGAGGCTGG + Intergenic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1035587187 8:785624-785646 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035587200 8:785658-785680 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035587225 8:785726-785748 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035587238 8:785760-785782 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035587251 8:785794-785816 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035587262 8:785828-785850 CCTGAGGGGAGGAGGGAGGCCGG - Intergenic
1035678645 8:1471575-1471597 GAGGAGGTTAGGAGGGAGGCTGG - Intergenic
1035746266 8:1963788-1963810 CAGCAGGGCAGGACAGAGACTGG - Intergenic
1035776256 8:2191160-2191182 GAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1036162986 8:6406511-6406533 CTGTAGGTGAGGCGGGAGGCTGG - Intergenic
1036338729 8:7895824-7895846 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1036338741 8:7895852-7895874 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1036612562 8:10362841-10362863 CAGGAGGGAAGGAGGAAGTCAGG - Intronic
1037474439 8:19242596-19242618 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1037611948 8:20483290-20483312 AGGTAGGGCAGGTGGCAGGCAGG + Intergenic
1037657376 8:20896733-20896755 CAGGAGGGTAGGAAGGAGACAGG + Intergenic
1037775788 8:21834803-21834825 CAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1037806664 8:22061643-22061665 GAGAGGGGCAGGAGGGAGACTGG - Intronic
1038150403 8:24938266-24938288 AAGGAGGGCAGAAGGGAGGGAGG + Intergenic
1038285607 8:26203873-26203895 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1038584661 8:28778048-28778070 CAGGGGGTCAGGAGGGAGCCAGG + Intronic
1039154564 8:34540646-34540668 CAGCAAGGCAGCAGCGAGGCTGG + Intergenic
1039471122 8:37814441-37814463 CAGAAGGTCTGGAGGCAGGCGGG - Intronic
1039772678 8:40703577-40703599 CAGTGGGGGAGCAGGGAGGAGGG + Intronic
1039808826 8:41026745-41026767 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1039903300 8:41767800-41767822 CATTCGGGGAGGCGGGAGGCAGG - Intronic
1040738495 8:50541399-50541421 GAGGAGGGCAAGAGGGATGCTGG - Intronic
1041659133 8:60384057-60384079 CAGGAGGGGAGGAGAGAGGAAGG - Intergenic
1041802317 8:61813488-61813510 AAGAAGGGAAGGAGGGAGGAAGG - Intergenic
1042036583 8:64540439-64540461 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1042059627 8:64802602-64802624 AAGTAGGGAAGCAGGGAGGGAGG + Intergenic
1042064023 8:64853970-64853992 CACAAGGGCAGGTGGGAGGTAGG + Intergenic
1042114349 8:65414783-65414805 CAGGAGGGGAGAAGGGAGGCAGG - Intergenic
1042182416 8:66104793-66104815 CAGTAGAGCAGGAGTGTGGCAGG - Intergenic
1042526801 8:69772540-69772562 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1042543783 8:69932767-69932789 CTGCACAGCAGGAGGGAGGCAGG - Intergenic
1042611889 8:70608620-70608642 CAGGAGGGCAGGAGGGCACCCGG - Exonic
1042901520 8:73733061-73733083 GTGTAGGGCAAGAGGGAGCCAGG - Intronic
1043037700 8:75218841-75218863 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1043373655 8:79622986-79623008 CAGGAGAGCAGGAGGGTGCCAGG - Intronic
1043511068 8:80950647-80950669 CTGGAGGCCAGGAGGGCGGCAGG + Intergenic
1043855780 8:85263137-85263159 CTCTAAGGCAGGAGTGAGGCTGG + Intronic
1044060065 8:87625217-87625239 CTGCAAGGCAGCAGGGAGGCTGG + Intergenic
1044429824 8:92095670-92095692 CAGGAGGGAAGGAGGGATGGAGG + Intronic
1044800418 8:95948291-95948313 GAGTTGGGCAGGAGGGAAGCAGG - Intergenic
1045487120 8:102640410-102640432 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1045523268 8:102921561-102921583 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1045789383 8:105964124-105964146 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1045870524 8:106921981-106922003 CAGTAGGTCAGGGAGGAAGCTGG - Intergenic
1046106274 8:109670856-109670878 CAAGAGGGAAGGAGGGAGGGAGG + Intronic
1046879490 8:119292446-119292468 CTGCAAGGCAGCAGGGAGGCTGG + Intergenic
1047018561 8:120750123-120750145 ACGTAGGGAAGGAGGGAGGGAGG - Intronic
1047096974 8:121636386-121636408 CAGAAGGGGAGAAGGGAGGTTGG - Intronic
1047490831 8:125373426-125373448 CAGGAGGCCAGCTGGGAGGCCGG - Intergenic
1047614265 8:126550250-126550272 CAGAAGTGGAGGAGGGAGCCAGG - Intergenic
1047812911 8:128429712-128429734 TAGGAGTGGAGGAGGGAGGCAGG + Intergenic
1048298617 8:133235095-133235117 CACGAGGTCAGGAGGGAGGGAGG - Intergenic
1048303051 8:133265525-133265547 AGGAAGGGCAGGAGGGAGGATGG - Intronic
1048306742 8:133289802-133289824 CAGTGGGGCAGCAGGAACGCTGG + Intronic
1048422509 8:134291291-134291313 CATGAGGGGAGGAGGCAGGCAGG + Intergenic
1048453561 8:134555957-134555979 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1048492388 8:134906199-134906221 CAGTGGGGAAAGAGGGATGCTGG - Intergenic
1048573009 8:135670380-135670402 CAGTGGGACAGTGGGGAGGCTGG - Intergenic
1048718457 8:137296173-137296195 AAGGAGGGAGGGAGGGAGGCAGG - Intergenic
1048955859 8:139535323-139535345 CAATAGGGAAGGAGGAAGACAGG + Intergenic
1048967668 8:139626158-139626180 CTGGAGTGCAGGAGCGAGGCTGG - Intronic
1048968023 8:139628144-139628166 TTGTAGGGGAGGAGGGCGGCAGG + Intronic
1048971664 8:139648509-139648531 CAGAGGGACAGGAGGCAGGCTGG - Intronic
1049081325 8:140445524-140445546 GAGCAGGGGAGGAGGGAGCCCGG + Intronic
1049216275 8:141409806-141409828 AAGCAGGGCAGGAGGGGGCCTGG - Intronic
1049288266 8:141788274-141788296 GAGCAGGGAAGGAAGGAGGCCGG - Intergenic
1049358032 8:142198383-142198405 CAGCCGGACAGGAGAGAGGCAGG - Intergenic
1049424511 8:142532144-142532166 GAGGAGGGGAGGAGGGAAGCTGG + Intronic
1049594599 8:143477580-143477602 CACCAGGCCTGGAGGGAGGCAGG + Intronic
1049640171 8:143711791-143711813 CTGGGGGGCAGGAGGGAGGCTGG - Intronic
1049710931 8:144063002-144063024 CAGTGGGGTAGGAGGCAGGTGGG - Intronic
1049730761 8:144176960-144176982 CAGTGAGGCAAGAGTGAGGCAGG - Intronic
1049771499 8:144384235-144384257 CGTCAGGGCAGGAAGGAGGCAGG + Intronic
1050160916 9:2718005-2718027 CAGCAGGGCCGGAGGGTCGCTGG - Exonic
1050796955 9:9558080-9558102 CAGATGGACAGGAGGGAGCCAGG - Intronic
1051366739 9:16326631-16326653 CGGTGGGGAAGGAGGGTGGCTGG + Intergenic
1051408512 9:16764898-16764920 AAGGAGGGAAGGAGGGAGGAGGG + Intronic
1051423121 9:16908527-16908549 AAGAAGGGCAAGAGGGAGGGAGG + Intergenic
1052077269 9:24158780-24158802 CAGGAGGGGAGGAGGGAGAGGGG - Intergenic
1052678917 9:31663249-31663271 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1052819012 9:33124246-33124268 GAGGAGGGCAGGAGTGAAGCTGG - Intronic
1052821285 9:33139588-33139610 CAGTATGGCAGGAGGTGTGCAGG - Intronic
1053609468 9:39697466-39697488 CAGGAGAGCAGAAGGGAGCCAGG - Intergenic
1053867364 9:42454051-42454073 CAGGAGAGCAGAAGGGAGCCAGG - Intergenic
1054088847 9:60774026-60774048 CAGGAGAGCAGAAGGGAGCCAGG + Intergenic
1054244056 9:62644931-62644953 CAGGAGAGCAGAAGGGAGCCAGG + Intergenic
1054558181 9:66679479-66679501 CAGGAGAGCAGAAGGGAGCCAGG + Intergenic
1054835605 9:69672389-69672411 CTGGAGGGCGGGAGGGAGGGTGG - Intergenic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1056024248 9:82476209-82476231 CAGTGAGGGAGGAGAGAGGCAGG - Intergenic
1056027547 9:82514777-82514799 AAGTAGGAAAGGAGGGAGGGAGG - Intergenic
1056221518 9:84454603-84454625 GGGTAGGGCAGGAGTGGGGCAGG - Intergenic
1056259486 9:84833632-84833654 CAGGAAGGAAGGAGGGAGGCAGG + Intronic
1056507978 9:87275406-87275428 CACTAGAGCAGGAGGGAGGCAGG + Intergenic
1056942942 9:90970866-90970888 CAATGGGGCTGGAAGGAGGCTGG - Intergenic
1056965170 9:91159373-91159395 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1056965190 9:91159467-91159489 GAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1057302294 9:93893958-93893980 CAGCAGAGCGGGAGGGAGGTGGG - Intergenic
1057565068 9:96160168-96160190 AAGGAGGGCGGGAGGGAGGGAGG + Intergenic
1058156818 9:101524971-101524993 CATCAGGGCAGATGGGAGGCAGG - Intronic
1058330465 9:103753971-103753993 AAGGAGGGAAGGAGAGAGGCAGG - Intergenic
1058547180 9:106073052-106073074 CTGCAGGGCAGGAGGGATACAGG - Intergenic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059760325 9:117331279-117331301 CAGAAGGGAAAGAGGAAGGCAGG - Intronic
1060109081 9:120893963-120893985 CAGTAGTTCTGGAGTGAGGCTGG - Intronic
1060266618 9:122115423-122115445 CAGCAGGGCAGCGAGGAGGCTGG - Intergenic
1060603234 9:124891939-124891961 AAGAAGGGAGGGAGGGAGGCTGG - Intronic
1060934140 9:127506045-127506067 CAGGCGGGCAGGAGGGAGGCAGG + Exonic
1060965030 9:127707468-127707490 CCATGGGGCAGGAGTGAGGCAGG - Intronic
1060991756 9:127853597-127853619 CAGGGAGGTAGGAGGGAGGCAGG + Intronic
1061160834 9:128892851-128892873 CAGGAGGGGAGGCGGGAGGTTGG - Intronic
1061277605 9:129578473-129578495 AAGAAAGGCAGGAGGGAGGCGGG + Intergenic
1061352725 9:130078581-130078603 CAGTGGGGCAGGCGAGAGACAGG + Intronic
1061454279 9:130686016-130686038 CTGCAAGGCAGGAGGGAAGCTGG - Intergenic
1061495388 9:130971022-130971044 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1061743927 9:132726199-132726221 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1061817791 9:133206890-133206912 CTCCAGGGCAGGAGGGTGGCCGG - Intronic
1061828772 9:133277397-133277419 AAGAAGGGAGGGAGGGAGGCAGG + Intergenic
1061838025 9:133342051-133342073 CAGTCAGGGAGGAGGGAGGGTGG - Intronic
1061841671 9:133362113-133362135 CTGCAGGGCAGGGGTGAGGCAGG - Exonic
1061872124 9:133526770-133526792 CTGCAGGGGAGGTGGGAGGCTGG - Intronic
1061884952 9:133586740-133586762 CAGTTGGGTAGGAGTAAGGCAGG + Intergenic
1062014839 9:134286161-134286183 CAGTAGGCGAGGAAGGAGGATGG - Intergenic
1062043733 9:134415718-134415740 CAGGAGGGCACAAGGGAGGGAGG + Intronic
1062144084 9:134979172-134979194 AGGAAGGGAAGGAGGGAGGCAGG + Intergenic
1062177331 9:135171061-135171083 CAGTAGGACAGGAAGGAGCCAGG + Intergenic
1062327288 9:136018301-136018323 GAGGAGGGCAGGAGGCAGGGAGG + Intronic
1062332544 9:136051024-136051046 CAGCGGGGAAGGAGGGAGGGAGG + Intronic
1062383746 9:136300002-136300024 CAGTGGGGCAGGACCCAGGCAGG - Intronic
1062519453 9:136951701-136951723 GAGCAGGCGAGGAGGGAGGCTGG - Intronic
1062573730 9:137197034-137197056 CAGAAGGGCAGGGTGGGGGCCGG - Intronic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1062720008 9:138035583-138035605 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1185477864 X:425774-425796 AAGGAAGGAAGGAGGGAGGCAGG - Intergenic
1185712350 X:2314297-2314319 AGGGAGGGAAGGAGGGAGGCAGG + Intronic
1186079274 X:5912838-5912860 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1186079290 X:5912889-5912911 AAGGAAGGCAGGAGGGAGGGAGG + Intronic
1186240017 X:7555514-7555536 AAGGAGGGAAGGAGGGAGGATGG + Intergenic
1186246671 X:7622655-7622677 AGGAAGGGAAGGAGGGAGGCAGG - Intergenic
1186482538 X:9907036-9907058 CGTTGGGGCAGGGGGGAGGCGGG + Intronic
1186490026 X:9964237-9964259 TGGAAGGGCAGGAGGGAGGGAGG - Intergenic
1186529360 X:10279670-10279692 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1186605118 X:11081487-11081509 CAGTATGTCTGGAGGGTGGCAGG + Intergenic
1187207599 X:17197778-17197800 CAGATGGACAGGAGGGAGCCAGG + Intergenic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187480210 X:19648372-19648394 AAGGAGGGCAAGAGGGAGGAGGG + Intronic
1188240766 X:27786630-27786652 CAGTAGAGCAGGAGGAAAGAAGG - Intergenic
1188242705 X:27809578-27809600 CGGTAGGACAGGAGGGGGGGTGG - Intronic
1188356104 X:29193610-29193632 GATTAGGGCAGGTTGGAGGCGGG + Intronic
1188415476 X:29927887-29927909 CAGGAGGGAGGGAGGGAGGGAGG + Intronic
1188510822 X:30934657-30934679 CATAAGGGAAAGAGGGAGGCAGG - Intronic
1188964288 X:36531882-36531904 GCGTTGGGCAGGAGGGAGGTAGG - Intergenic
1189172885 X:38926343-38926365 CAATAGGGGAGTAGGGAAGCAGG + Intergenic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189251291 X:39602257-39602279 CTGGCGGGGAGGAGGGAGGCTGG + Intergenic
1189778044 X:44487812-44487834 AAGAAGGGAAGGAGGGAGGGAGG + Intergenic
1189920799 X:45901414-45901436 CACTGGTACAGGAGGGAGGCAGG + Intergenic
1190220129 X:48507587-48507609 CAGTAGGGTAGGTAGAAGGCGGG + Intergenic
1190429946 X:50369545-50369567 AAGGAGGGAAGGAGGGAGGCAGG - Intronic
1190642275 X:52492391-52492413 AAGGAGGGAGGGAGGGAGGCAGG - Intergenic
1190645398 X:52520476-52520498 AAGGAGGGAGGGAGGGAGGCAGG + Intronic
1191072947 X:56421349-56421371 CTGAAGGGCAGCAGTGAGGCTGG - Intergenic
1191076675 X:56460914-56460936 CAGCAAGGCAGCAGCGAGGCTGG - Intergenic
1191254904 X:58275446-58275468 CAGTAGGGCATGGGGGCTGCTGG + Intergenic
1191664706 X:63688181-63688203 CTACAGGGCAGGAGGGAGGGGGG + Intronic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192341146 X:70264352-70264374 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1192353174 X:70373339-70373361 AAGAAGGGAAGGAGGGAGGGAGG + Intronic
1192436812 X:71148237-71148259 CAGCAGGGCAGGCGGGAGGCAGG - Intronic
1192500827 X:71650726-71650748 CAGTAGGTTAGGAGAGAGCCAGG + Intergenic
1192569255 X:72189343-72189365 AGGTGGGGCAGGAGGGAAGCGGG - Intronic
1192657008 X:73003115-73003137 CGGGAGGGCAGGAGGGCGGGTGG - Intergenic
1192665112 X:73079886-73079908 CGGGAGGGCAGGAGGGCGGGTGG + Intergenic
1193300983 X:79887894-79887916 CACTGGGACAGGAGTGAGGCTGG + Intergenic
1193582885 X:83286709-83286731 CTGTAAGGCAGCAGCGAGGCTGG + Intergenic
1193824412 X:86205457-86205479 AAGGAGGGAAGGAGGGAGGGAGG - Intronic
1194187615 X:90792505-90792527 CAGTAAGGTAGGAGGCTGGCAGG - Intergenic
1195000592 X:100639614-100639636 TGGTAGGGATGGAGGGAGGCTGG - Intronic
1195234905 X:102887781-102887803 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1195732414 X:107980720-107980742 CAGTAGGGGGGCGGGGAGGCGGG - Intergenic
1195886436 X:109643987-109644009 CAGTTGTGCAGGAGGTAGCCTGG - Exonic
1195966669 X:110435170-110435192 AAGGAGGGAAGGAGGGAGGGAGG + Intronic
1196986976 X:121284599-121284621 AAGGAGGGAAGGAGGGAGGGAGG - Intergenic
1197098394 X:122622427-122622449 CTGAAGGTGAGGAGGGAGGCGGG + Intergenic
1197175433 X:123480885-123480907 AAGGGGGGCAGGAAGGAGGCGGG - Intronic
1197207355 X:123801543-123801565 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1197207368 X:123801578-123801600 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1197207401 X:123801661-123801683 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1197207417 X:123801704-123801726 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1197526847 X:127575050-127575072 CACGAGCTCAGGAGGGAGGCTGG + Intergenic
1198518783 X:137432026-137432048 GAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1198615672 X:138456257-138456279 CTGCAAGGCAGCAGGGAGGCTGG + Intergenic
1198722494 X:139637868-139637890 CATTAGGATAAGAGGGAGGCAGG + Intronic
1199745312 X:150768741-150768763 CAGTAAAGCTGGAGGCAGGCTGG + Exonic
1199977054 X:152900323-152900345 GAGTAGGGAAGGAGGAAGGCAGG - Intergenic
1200062269 X:153488879-153488901 CAGGAGGGCAGGGGCCAGGCAGG + Intronic
1200090340 X:153633012-153633034 CAGGTGGGCAGGTGAGAGGCAGG + Intergenic
1200097680 X:153671833-153671855 CAGGTGGGCAGGTGGGAGGGTGG + Intronic
1200116906 X:153773443-153773465 CAGGAGGGAAGGTGGGATGCGGG + Intronic
1200243167 X:154508243-154508265 GAGCAGGGAAGGAGGGCGGCAGG + Intronic
1200534204 Y:4374459-4374481 CAGTAAGGTAGGAGGCTGGCAGG - Intergenic
1201438622 Y:13985557-13985579 AAGTGTGTCAGGAGGGAGGCAGG - Intergenic
1201445951 Y:14057151-14057173 AAGTGTGTCAGGAGGGAGGCAGG + Intergenic
1201515205 Y:14812962-14812984 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1201517636 Y:14835316-14835338 AAGAAGGGAAGGAGGGAGGAAGG + Intronic
1201652285 Y:16302751-16302773 AAGGAGGGAAGGAGGGAGGTTGG + Intergenic
1201737419 Y:17283813-17283835 AAGGAGGGAAAGAGGGAGGCAGG - Intergenic
1201738669 Y:17300231-17300253 AAGGAGGGAAGGAGGGAGGGAGG + Intergenic
1201953008 Y:19586170-19586192 CTGCAAGGCAGCAGGGAGGCTGG - Intergenic
1202103378 Y:21334648-21334670 GAGGAGGCAAGGAGGGAGGCAGG - Intergenic