ID: 1062711217

View in Genome Browser
Species Human (GRCh38)
Location 9:137976143-137976165
Sequence GCCTGAAGACAGTGAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 325}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062711208_1062711217 28 Left 1062711208 9:137976092-137976114 CCATGCCCAGTGTGGGCTGGGGT 0: 1
1: 0
2: 4
3: 39
4: 386
Right 1062711217 9:137976143-137976165 GCCTGAAGACAGTGAGGAGCAGG 0: 1
1: 0
2: 4
3: 36
4: 325
1062711215_1062711217 -2 Left 1062711215 9:137976122-137976144 CCTACATGGGTCAGAAAGGCTGC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1062711217 9:137976143-137976165 GCCTGAAGACAGTGAGGAGCAGG 0: 1
1: 0
2: 4
3: 36
4: 325
1062711210_1062711217 22 Left 1062711210 9:137976098-137976120 CCAGTGTGGGCTGGGGTCTGTGA 0: 1
1: 0
2: 2
3: 25
4: 293
Right 1062711217 9:137976143-137976165 GCCTGAAGACAGTGAGGAGCAGG 0: 1
1: 0
2: 4
3: 36
4: 325
1062711214_1062711217 -1 Left 1062711214 9:137976121-137976143 CCCTACATGGGTCAGAAAGGCTG 0: 1
1: 0
2: 0
3: 12
4: 148
Right 1062711217 9:137976143-137976165 GCCTGAAGACAGTGAGGAGCAGG 0: 1
1: 0
2: 4
3: 36
4: 325
1062711209_1062711217 23 Left 1062711209 9:137976097-137976119 CCCAGTGTGGGCTGGGGTCTGTG 0: 1
1: 0
2: 4
3: 43
4: 469
Right 1062711217 9:137976143-137976165 GCCTGAAGACAGTGAGGAGCAGG 0: 1
1: 0
2: 4
3: 36
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062711217 Original CRISPR GCCTGAAGACAGTGAGGAGC AGG Intronic
900099810 1:957007-957029 GCAGGAAGCCAGTGAGGAGGAGG - Exonic
900397080 1:2457470-2457492 GCCAGGAGACATTGGGGAGCAGG - Intronic
901493755 1:9609819-9609841 GTCTGGAGACAGAGAGAAGCGGG - Exonic
901751041 1:11408865-11408887 GCCTGAAGAGAGAGAGAAGGGGG - Intergenic
903072367 1:20732658-20732680 GCAGGAAGAAAGTGAGGAGGAGG - Intronic
904300190 1:29549209-29549231 CCTTGAGGACAGTGAGGAGCTGG - Intergenic
904458046 1:30658907-30658929 CCTCGAGGACAGTGAGGAGCTGG + Intergenic
905770888 1:40637154-40637176 CCCTGAAAACAGTGGGGAGCAGG + Intronic
905805895 1:40877415-40877437 GCCTGAAGACAGTGAGATCAAGG - Intergenic
906135166 1:43494282-43494304 GCCTGAGGAGACTGAGGAGTCGG - Intergenic
907560515 1:55383354-55383376 GCCTGAAGCCAGTCAGGATTTGG - Intergenic
907577306 1:55538714-55538736 GCCTGAATAGAGTAAGGAGGCGG + Intergenic
908530861 1:65032720-65032742 GCATGAAGACACTGAGAAGATGG - Intergenic
910524652 1:88164137-88164159 CCCTGAAGACAGTGAACAGGTGG + Intergenic
910637522 1:89425541-89425563 CCCTGAAGGCAGGGAAGAGCCGG + Intergenic
911294738 1:96101398-96101420 GCCTGAAGAAAGTCAGAATCTGG + Intergenic
911754936 1:101543099-101543121 GTCTGAATAGAGTGAGGAGAAGG + Intergenic
912690923 1:111804158-111804180 GGCGGAAGCCAGGGAGGAGCTGG - Intronic
914420104 1:147521272-147521294 ACTTGAAGACCTTGAGGAGCAGG + Intergenic
915089551 1:153414928-153414950 CACTGGAGACAGTGAAGAGCAGG - Intergenic
915139721 1:153759809-153759831 TCCTGAAGACTGTGGGGAGGAGG - Intronic
916195222 1:162216102-162216124 GACTGATGACAGGGAGGAGATGG - Intronic
918953511 1:191173599-191173621 GCCTGAAGCCAGTAATGAGGTGG - Intergenic
919526784 1:198663461-198663483 GCCTGAATACATTGAGGTACTGG + Intronic
919753316 1:201051876-201051898 GCCTGCACACGGTGAGGTGCCGG + Intronic
920380123 1:205530339-205530361 GCTTGAAGACAGTGAGTACTGGG + Exonic
920461154 1:206141429-206141451 GCATGCAGACAGTCAGGTGCAGG - Intergenic
920961935 1:210671305-210671327 CCCTGAACCCACTGAGGAGCAGG + Intronic
921459516 1:215411704-215411726 GCCTGAATAATGTGAGGAACAGG + Intergenic
922508244 1:226139971-226139993 ACCTGAAGAATCTGAGGAGCAGG + Intergenic
922855657 1:228773154-228773176 GCCAGCAGGCAGTGAGGTGCAGG - Intergenic
923202671 1:231727081-231727103 ACCTGAAGACAAGCAGGAGCAGG - Intronic
923377788 1:233382361-233382383 GGCAGATGACTGTGAGGAGCAGG - Exonic
923519449 1:234724741-234724763 GGCTGCAGACAGAGAGGGGCTGG + Intergenic
923615218 1:235531596-235531618 ACATGAAAACAGTGAGCAGCTGG - Intergenic
924271852 1:242342133-242342155 GCCTGAAGTCAGGGAGGAGAAGG + Intronic
924311458 1:242747884-242747906 GTCAGAAGGCAGGGAGGAGCAGG - Intergenic
1062960443 10:1569392-1569414 GCCTGCAGAACGTGAGCAGCAGG + Intronic
1063252231 10:4286246-4286268 GCCTGAAGACAATTAGGAAGAGG - Intergenic
1063288805 10:4719234-4719256 GCATGATGACAGTTCGGAGCAGG + Intergenic
1063968956 10:11368027-11368049 TCCTGAAGGCAGTGATAAGCCGG - Intergenic
1065374443 10:25023937-25023959 GCCTGAAGACTGTGAACAGAAGG + Exonic
1065902059 10:30217125-30217147 ACCTGAAGGCAGTTAGGAGGAGG - Intergenic
1066656346 10:37702227-37702249 GGCTGAGGACAGGGAGGAGGGGG - Intergenic
1067681552 10:48445053-48445075 GCCTGGAGACAATGGGTAGCTGG + Intergenic
1067703777 10:48592137-48592159 GATTGAAGACAGTGAGGTGCTGG - Intronic
1067715906 10:48691104-48691126 GCCTGGACCCAGTGAGGATCAGG - Intronic
1068838550 10:61583842-61583864 GCCTGAAGCCATTGATGACCAGG - Intergenic
1069580627 10:69563695-69563717 GCCAAAAGCCAGTGAGGAACTGG + Intergenic
1070359113 10:75670528-75670550 GCATGTAGATGGTGAGGAGCTGG + Intronic
1071878191 10:89865518-89865540 CCCAGAAGATAGTGAGAAGCAGG + Intergenic
1073301090 10:102471291-102471313 GCTTGTAGGCAGTGAGGAGGCGG + Exonic
1073321197 10:102617255-102617277 ACATGGAGACAGTGAGGAGCTGG - Intronic
1073497688 10:103908553-103908575 GCCTGAGGACAGCAAGGAGAGGG + Intronic
1075826354 10:125359859-125359881 GGCTAGAGAAAGTGAGGAGCGGG - Intergenic
1076998111 11:308928-308950 GGGAGGAGACAGTGAGGAGCTGG + Intronic
1077611275 11:3644481-3644503 CCCTGAAGCCAGAGAGGAGGTGG - Intergenic
1078941492 11:16011568-16011590 GCCTGGAGGCAGTGAGGAAAAGG - Intronic
1079121710 11:17689946-17689968 ACTTGAAGACAGTGAGGATTTGG - Intergenic
1080699084 11:34629075-34629097 GCCTGATGAAAATGAGGAGAGGG - Intronic
1082715043 11:56602087-56602109 CCCTGAAGACAGTGTGGAGTTGG - Intergenic
1082800354 11:57409825-57409847 GCCTGGAGGCAGTCAGGTGCGGG - Intronic
1083441230 11:62678063-62678085 GCGTGAAGAAAGAGAGGAACGGG - Exonic
1083745990 11:64736741-64736763 GCCTGCTCACGGTGAGGAGCAGG - Exonic
1084948493 11:72651899-72651921 GCCTGAAAAGAGGGAAGAGCTGG + Intronic
1085295208 11:75427593-75427615 GCCTGCAAAGAGTAAGGAGCAGG - Intronic
1085318198 11:75558689-75558711 GCATGAAGAAACTGAGGATCAGG - Intergenic
1086211038 11:84319159-84319181 ACCTGAAGACAGTGACGAAAAGG + Intronic
1086781743 11:90915447-90915469 GAGTGAAGACAGTATGGAGCAGG + Intergenic
1087314936 11:96591878-96591900 GCCTGATGAGGGTGAGGAACAGG - Intergenic
1088915544 11:114225104-114225126 GCCAGAAGTCAGTGGGGAGTTGG + Intronic
1089459582 11:118644766-118644788 GCCTGCAGGCAGTGGGGACCTGG - Intronic
1089812037 11:121140311-121140333 GCCTAGAGACAGTGGGGAGTCGG - Intronic
1089957447 11:122584854-122584876 GCCTGAAGACACTAAGCAGATGG + Intergenic
1090582777 11:128178268-128178290 GCCTGACGAGAGGGAGGAGGTGG - Intergenic
1090655551 11:128841546-128841568 CCCTGAAGACATTGCGGACCAGG - Intronic
1092015968 12:5158780-5158802 GCCTGAAGACTGTGGGGAGTGGG - Intergenic
1092241060 12:6836927-6836949 CCCTGCAGACAGTGAGGGGCTGG + Intronic
1095710431 12:45282337-45282359 GCCAGCAGACAAAGAGGAGCAGG + Intronic
1096534356 12:52261639-52261661 GCCTGAAGAAGGTGAGGACTTGG + Intronic
1096572549 12:52532048-52532070 TCCTGAGGGCTGTGAGGAGCTGG - Intergenic
1097107972 12:56636218-56636240 GCCCAAGGACAGTGAGGAGCTGG - Exonic
1097169173 12:57102920-57102942 GCCTGAAGAGGGTGAGGACAGGG + Exonic
1097657722 12:62388693-62388715 GCTAGAAGACAGTAGGGAGCTGG + Intronic
1098250088 12:68560445-68560467 CCCTGAATAAAGTGTGGAGCTGG + Intergenic
1100525328 12:95413718-95413740 GACTGAAGACATTGAGGTTCAGG + Intergenic
1102057698 12:109909027-109909049 GAATGAAGACAGTGAGGGGTTGG + Intronic
1103465651 12:121140030-121140052 TTCTGAAGACAGTCAGGGGCAGG - Intronic
1103564534 12:121808811-121808833 GCCTGATGCCAGGGAGGAGCTGG - Intronic
1104361237 12:128135248-128135270 GCCTGAGGCCTGTTAGGAGCCGG + Intergenic
1104575171 12:129959868-129959890 GCCTGAAGGCAAACAGGAGCTGG - Intergenic
1104597842 12:130132077-130132099 GCCTGGAGACAGGCAGAAGCAGG - Intergenic
1104850785 12:131872559-131872581 GCCTGAAGACAGTGGGAGACAGG - Intergenic
1105272782 13:18893779-18893801 GCATGAGGGCCGTGAGGAGCAGG + Intergenic
1107543738 13:41417395-41417417 GCCTGAAGAGAGTGTAGAGTGGG + Intergenic
1107556594 13:41521023-41521045 GCCAGGATACAGTGGGGAGCAGG + Intergenic
1108682194 13:52790127-52790149 GCCTGAAGACACTGAGATGGTGG - Intergenic
1108762782 13:53589894-53589916 GCTTGTAGAAAGTGGGGAGCTGG + Intergenic
1109300775 13:60587639-60587661 GCATGCAGACAGTCAGGGGCAGG - Intergenic
1110003751 13:70238898-70238920 GCCTGCAGACAGGCAGGTGCAGG - Intergenic
1112242515 13:97695882-97695904 GGAGGAAGACAGTGAAGAGCGGG + Intergenic
1113442584 13:110340781-110340803 GCCTGAAGCAAGCGAGAAGCTGG - Intronic
1113521864 13:110947163-110947185 GCTTGTGGACAGTGAGGGGCTGG + Intergenic
1113706029 13:112433536-112433558 GCTTGTGGACAGTGAGGGGCTGG - Intronic
1113812565 13:113151442-113151464 CCCTGAGGACTGTGAGCAGCAGG + Intergenic
1114696648 14:24632508-24632530 GCCCAGAGACAGTGAAGAGCAGG + Intronic
1115049903 14:29046029-29046051 TCCTGCGGACAGTGAGGAGATGG + Intergenic
1116246352 14:42418559-42418581 GGCTGAATACAGTGAGGACTGGG - Intergenic
1116603471 14:46958637-46958659 TCATGAAGACAGTGAGGAAAAGG + Intronic
1116783923 14:49267400-49267422 ACTTGAAGGCAGTGAGGAGGGGG + Intergenic
1119156959 14:72420296-72420318 GCCTGCAGACAGTTAGCATCTGG - Intronic
1119505288 14:75167466-75167488 GCATGAGGACAGAGAGGAGAGGG - Intronic
1119756657 14:77124738-77124760 GCCAGGAGACAGAGAGGAGGTGG + Intronic
1120856435 14:89216683-89216705 GCCTGAGGTCAGTGAGAACCTGG - Intronic
1121005887 14:90490476-90490498 GCCAGGAGAGAGTGAGGCGCAGG + Intergenic
1121167641 14:91822608-91822630 GCCTCGGGACAGTGAGGAGTGGG + Intronic
1121949870 14:98162504-98162526 CACTGCAGACAGTGAGGAGAGGG - Intergenic
1122312568 14:100806489-100806511 CCCAGGAGACAGTGATGAGCTGG + Intergenic
1122717804 14:103705960-103705982 GCCTGGAGACAGCCAGAAGCCGG - Intronic
1122798769 14:104219562-104219584 GCCAGAGGACAGTGAGGGGCTGG - Intergenic
1122875945 14:104664925-104664947 GCCTGATGCCCCTGAGGAGCTGG + Intergenic
1123177413 14:106434065-106434087 GGCAGAAGACAAAGAGGAGCAGG - Intergenic
1123983522 15:25624227-25624249 GCCTGGAGTCTGTGAGCAGCAGG - Intergenic
1124126913 15:26944819-26944841 GTCTGAGGTCAGGGAGGAGCCGG + Intronic
1125745238 15:41993104-41993126 CCTGGCAGACAGTGAGGAGCAGG + Intronic
1128591298 15:68899908-68899930 CACTGAAGACAGTGAAGAGAAGG + Intronic
1129348244 15:74938035-74938057 GGCTGAGGACAGAGAGAAGCCGG + Exonic
1132416362 15:101622223-101622245 GCCTTAAGACATTGAGGGGAGGG + Intronic
1132572414 16:649773-649795 GTCTGAAGACGTTGAGGAACGGG - Exonic
1132654361 16:1035739-1035761 GACAGAAGCCAGTGAGGAGGCGG + Intergenic
1138280817 16:55771145-55771167 GCCTGTGGACAGGGAGGAGGGGG - Intergenic
1139245514 16:65438367-65438389 GCCAGAAGACACTGAGAAGCTGG - Intergenic
1139357129 16:66373041-66373063 GCCTGATCACAGTGGTGAGCAGG - Intronic
1140609920 16:76585778-76585800 GCCAACAGACAGTGAGGACCTGG - Intronic
1140793316 16:78412635-78412657 GCCAGAAGTGAGGGAGGAGCAGG + Intronic
1140859999 16:79010233-79010255 GCCAGACAAGAGTGAGGAGCTGG + Intronic
1141839735 16:86567054-86567076 TCCTGGAGCCAGCGAGGAGCGGG + Intergenic
1142214297 16:88823230-88823252 ACCCTAAGACAGGGAGGAGCAGG + Intronic
1142884872 17:2906193-2906215 GCCCCAGGACAGAGAGGAGCTGG - Intronic
1143054030 17:4149297-4149319 GCTGGTAGACAGTGAGGAGCTGG + Intronic
1144659018 17:17056430-17056452 GCTTGAATACAGTGGGGAGCAGG + Intronic
1145754762 17:27382325-27382347 GCATGGAGACAGGGAGGAGGAGG - Intergenic
1146001067 17:29130833-29130855 GGCTGGAGGCAGTGAGTAGCTGG + Intronic
1146582440 17:34050880-34050902 TCCTGGAAATAGTGAGGAGCTGG - Intronic
1146878139 17:36429073-36429095 GCCTGAACACCCTGCGGAGCGGG - Exonic
1147169415 17:38609331-38609353 GCCTGCAGACAGTGAGGGCCTGG + Intergenic
1147372892 17:40005787-40005809 GCCTCTAGACAGTGAGCAGACGG - Intergenic
1147564341 17:41527502-41527524 GCCTGAAGAGTGGGAGGAGATGG - Intronic
1147910050 17:43850150-43850172 GACTGACGACAGTGATGTGCTGG + Intronic
1148105035 17:45114479-45114501 GTCAGAAGAGAGTGAGGAGCGGG - Intronic
1152368671 17:79871631-79871653 GCCTGAAGCCATTGGGGAGGAGG + Intergenic
1152769129 17:82156801-82156823 GCTCCAGGACAGTGAGGAGCAGG - Intronic
1153305552 18:3627560-3627582 GGAGGAAGACAGTGAAGAGCAGG + Intronic
1153323731 18:3797377-3797399 ACGTCAAGACAGTGAGGAGGTGG + Intronic
1153771864 18:8423183-8423205 GCCTGGGAACAGTGAGGAGAGGG - Intergenic
1154464566 18:14631358-14631380 GCATGAGGGCCGTGAGGAGCAGG + Intergenic
1155000273 18:21679247-21679269 GCTTGAAGACAGAAAGAAGCAGG + Intronic
1155389729 18:25322104-25322126 GCCGGAAGACGGGGAGGAGTTGG - Exonic
1156395945 18:36700124-36700146 GTATGAAGATAGAGAGGAGCTGG - Intronic
1157340260 18:46771841-46771863 GGCTGAAGTCACAGAGGAGCAGG - Intergenic
1157546968 18:48553434-48553456 GGCAGATGACGGTGAGGAGCGGG + Intronic
1157881754 18:51327542-51327564 TCCTGCAGCCAGTGAGGAACAGG + Intergenic
1159901552 18:74052242-74052264 TCTTGAAGGCAGTGAGGATCTGG + Intergenic
1160170169 18:76546316-76546338 GCATGAAGAAAGTAAGGAGGGGG - Intergenic
1160528108 18:79548948-79548970 GCACGAAGGCACTGAGGAGCCGG + Intergenic
1160538563 18:79608268-79608290 GCCCGGGGACAGTGCGGAGCTGG + Intergenic
1160575188 18:79849129-79849151 GACTGAAGACAGGGTGGGGCTGG - Intergenic
1161073980 19:2276105-2276127 GGCCAAAGTCAGTGAGGAGCAGG + Exonic
1161117125 19:2503918-2503940 GCCTGTGGCCAGTGAGGAGCCGG + Intergenic
1161243115 19:3233972-3233994 GCTGGAAGACAGAGTGGAGCAGG + Intronic
1161642824 19:5435095-5435117 GCTTTGAGACAGTGAGGAGCAGG + Intergenic
1162787366 19:13044102-13044124 GCCTGAGGACAGTCAGGTTCTGG - Intronic
1163497687 19:17656133-17656155 GCCTGAAGATGAGGAGGAGCTGG - Exonic
1164674938 19:30094724-30094746 GGCTCAAGACAGTCGGGAGCAGG + Intergenic
1164892757 19:31839251-31839273 GCCATAAGACAGAGAGGAGCAGG + Intergenic
1166727776 19:45039158-45039180 GCCTGAGGAAAGGGAGAAGCTGG - Intronic
1167289666 19:48617432-48617454 ACGGGAAGACAGTGAGAAGCTGG + Intronic
1167339336 19:48905613-48905635 TCCTGGAGACTCTGAGGAGCTGG + Intronic
1167344581 19:48937247-48937269 GCCTGAGGGCACTGGGGAGCCGG - Intronic
1167353578 19:48990747-48990769 GCCTGAGGTCAGGAAGGAGCAGG - Intronic
1167642411 19:50688967-50688989 CGCTGCAGACAGGGAGGAGCCGG + Exonic
1167671591 19:50856686-50856708 GACTGAAGACAGAGAAGAGAGGG - Intronic
1167705725 19:51079811-51079833 GCCTGCAGTTAGTGAGAAGCAGG - Intronic
1167849159 19:52188985-52189007 GCCTGAAGACAGAGAGGAAAGGG + Intergenic
1168115189 19:54218369-54218391 GTCTGAGGACAGGGTGGAGCTGG - Exonic
1168400698 19:56084793-56084815 GCCTGAAGGCAGTGTTGATCTGG - Intergenic
1168515169 19:57004683-57004705 TCCTGCAGCCAGTGGGGAGCTGG - Intergenic
925001386 2:405581-405603 GCCTGAGGAAAGTGAGGGGCTGG - Intergenic
925377707 2:3400162-3400184 GCCTGGAGACAGCAAGCAGCCGG - Intronic
925869248 2:8254910-8254932 GCCAGGAGAAAGTGAGGGGCTGG - Intergenic
927097585 2:19759331-19759353 GCCTGTAGACTGATAGGAGCTGG - Intergenic
927504397 2:23603690-23603712 GCCTGGAGACAGGGAAGGGCTGG - Intronic
928310676 2:30207127-30207149 GCATGCAGACAGGGAGGAGGAGG - Intergenic
929123225 2:38500403-38500425 GCTTGGAGACAGCGAGGAGCAGG + Intergenic
929280198 2:40069896-40069918 GCCAGAAGTCATTCAGGAGCAGG + Intergenic
929948589 2:46389105-46389127 GCCGGAGGGAAGTGAGGAGCAGG - Intergenic
932690965 2:73913464-73913486 GCCTGTGGACAGAGAGGATCAGG - Exonic
933895618 2:86807855-86807877 GGCTGAAGGCAGGCAGGAGCAGG + Intronic
933935113 2:87197364-87197386 ATGTGAAGACAGTGAGGAGTCGG + Intergenic
934147073 2:89105343-89105365 GCTTGCAGTCAGAGAGGAGCTGG + Intergenic
934222193 2:90095252-90095274 GCTTGCAGTCAGAGAGGAGCTGG - Intergenic
934233119 2:90205011-90205033 GCTTGCAGTCAGAGAGGAGCTGG - Intergenic
936056193 2:109264062-109264084 GCTTAAAGACAGGGAGGAGCTGG - Intronic
936358031 2:111768534-111768556 ATGTGAAGACAGTGAGGAGTCGG - Exonic
937002928 2:118484631-118484653 CCCAGAAGACATAGAGGAGCCGG - Intergenic
937321872 2:120965807-120965829 GCCTGAGGACAGAAAGAAGCAGG - Intronic
937503258 2:122506797-122506819 GACTGAAGACAGGGAGGAATGGG + Intergenic
939113334 2:138033223-138033245 GCCAGAAGACAGACAGGGGCGGG + Intergenic
939378542 2:141403011-141403033 GTATGAAGACATTGAGAAGCAGG + Intronic
939952223 2:148488832-148488854 GCCTGAAAAGGTTGAGGAGCAGG + Intronic
944314065 2:198266683-198266705 GCCTGAAGGGAGTGAGGATGGGG + Intronic
945936085 2:215904140-215904162 ACCTCAAGCCAGGGAGGAGCAGG + Intergenic
946405141 2:219488477-219488499 GTCTGGGGACAGGGAGGAGCAGG - Exonic
946446091 2:219740886-219740908 GCATAAAGAAAATGAGGAGCAGG + Intergenic
946558776 2:220889537-220889559 GATGGAAGACAGTGAGGAGGAGG - Intergenic
946676952 2:222170426-222170448 GGCTGAAGGCAATGAGGAGCAGG + Intergenic
947562617 2:231170601-231170623 CAGTGAAGACATTGAGGAGCTGG + Exonic
947663955 2:231891319-231891341 CCCTGAAGGCAGTGGAGAGCTGG + Intergenic
948579351 2:238973457-238973479 GCCTGGAGACAGGGAGGAGGAGG - Intergenic
1170326987 20:15167447-15167469 GACTGAATACAGCGAGGAGGAGG - Intronic
1171953291 20:31440443-31440465 GCCTGAACCCAGTGACCAGCAGG - Intergenic
1172209521 20:33187095-33187117 GACTGAGGACAGTGAGGGCCAGG + Intergenic
1172459889 20:35109610-35109632 GCCTGAAGAGAATGAAGAGACGG - Intergenic
1172515105 20:35527996-35528018 TGCTGAAGGCATTGAGGAGCAGG + Intronic
1172781258 20:37438169-37438191 GCCTGAATGAAGAGAGGAGCAGG - Intergenic
1172826409 20:37790915-37790937 GCCTGAAGACACTGAGGTAGGGG - Intronic
1173257593 20:41405787-41405809 GGCAGAAGAGAGTGGGGAGCTGG + Intronic
1174176395 20:48648015-48648037 GCCTCAGCACACTGAGGAGCTGG + Intronic
1176121522 20:63456288-63456310 GCATGAAGCGAGTGAGGAGCGGG - Intronic
1176384095 21:6128443-6128465 GCCGGAAGACTGTGAGGCTCAGG + Intergenic
1176809974 21:13527026-13527048 GCATGAGGGCCGTGAGGAGCAGG - Intergenic
1177047331 21:16186657-16186679 GCCTGAAGACAGTCATAAGGAGG + Intergenic
1178519151 21:33272744-33272766 TCCTGCAAAAAGTGAGGAGCTGG - Intronic
1179242350 21:39603467-39603489 GCCTGAAGTGAATGAGAAGCTGG - Intronic
1179739379 21:43409801-43409823 GCCGGAAGACTGTGAGGCTCAGG - Intergenic
1180145635 21:45917056-45917078 CCCTGAAGACAGGGAGGGGGTGG - Intronic
1180988874 22:19921715-19921737 CACAGAAGACAGTGAGGAGGGGG + Intronic
1182750771 22:32640548-32640570 TTATGAAGACTGTGAGGAGCTGG - Intronic
1182819708 22:33204861-33204883 GCTTTCAGACAGTGGGGAGCAGG - Intronic
1183133275 22:35860579-35860601 GCCTGCAGACAGTGTGGTGTTGG - Intronic
1183687346 22:39368709-39368731 CCCTGAAGACAGAGAGGAGGTGG - Intronic
1184265003 22:43342225-43342247 CCCTGAAGACAGAGAGCAGGAGG + Intronic
1184386916 22:44181771-44181793 GCCTGGAGGAAGTGAGCAGCGGG + Exonic
1185042312 22:48511375-48511397 CCCAGGAGACAGTGAGGAGGAGG - Intronic
1185207257 22:49547212-49547234 GCTTGAACACAGTGAAGAGAGGG - Intronic
1185348298 22:50320179-50320201 GCCCCCAGACAGTGAGGAGCCGG + Intronic
950213957 3:11144647-11144669 GCCTGAGAACAGGGAGGAGCAGG + Intronic
952951402 3:38528365-38528387 GCATGGAGACAGGCAGGAGCAGG - Intronic
954245425 3:49327641-49327663 ACCTGCAGACAGTGACCAGCAGG + Intronic
954420707 3:50417645-50417667 GCATGAAGACAGTGAGGAGGAGG - Intronic
954877797 3:53814433-53814455 GGCAGGAGACAATGAGGAGCAGG + Exonic
955857534 3:63289439-63289461 GGCAGAAGGCAGAGAGGAGCTGG + Intronic
956590447 3:70908792-70908814 GCCTGACGCCAGTGGGGAGAAGG + Intergenic
956664086 3:71625902-71625924 GCCTGAAAACAGTGGGGTGTGGG - Intergenic
957008262 3:74975453-74975475 GGCTGAAGGCAAAGAGGAGCTGG + Intergenic
958006529 3:87818961-87818983 AGCTGAAGACAGAGGGGAGCAGG - Intergenic
959016131 3:101135949-101135971 GCCCCAAAACAGTCAGGAGCAGG + Intergenic
959437192 3:106330427-106330449 GCCTGAGAACAGTGGGGACCAGG - Intergenic
961523424 3:127481626-127481648 TCCTGGTGACAGTGGGGAGCTGG - Intergenic
961821734 3:129578754-129578776 GCCCAGAGACAGGGAGGAGCTGG - Intronic
962082377 3:132154132-132154154 GCCTGCAGACAGGGAGAAGGGGG + Intronic
962904890 3:139792690-139792712 CCCTGCATGCAGTGAGGAGCAGG + Intergenic
963980439 3:151530528-151530550 GCCAGAAGAGAGTGGGGGGCAGG + Intergenic
965956562 3:174377590-174377612 GCCTGAAGACCGTGGCAAGCTGG + Intergenic
966736407 3:183190388-183190410 GACTGAAGACCGTTAGTAGCAGG - Intronic
966921246 3:184613075-184613097 AACTGAAGACATTGGGGAGCTGG - Intronic
966948571 3:184795660-184795682 GGCTGGAGACAGTGAGGGGGAGG - Intergenic
968230963 3:197004123-197004145 GCCTGAGCCCAGTGAGGAGCAGG - Intronic
969253784 4:5989271-5989293 CCCTCGAGAGAGTGAGGAGCAGG - Exonic
969425584 4:7122076-7122098 GCCTGAGGACACGGAGGGGCTGG + Intergenic
970351481 4:15206087-15206109 GTCTGAAGAAAGTGAGGACATGG - Intergenic
971487759 4:27177362-27177384 CACTGGAGACAGTGCGGAGCTGG + Intergenic
971502565 4:27332697-27332719 GCCTGAAGCCACTCATGAGCTGG - Intergenic
974091097 4:57312223-57312245 GCCAGATGACAGGCAGGAGCTGG - Intergenic
976389882 4:84497129-84497151 GCTGGACGACAGGGAGGAGCCGG + Intronic
977243894 4:94606446-94606468 GGCTGAGGACAGTGAGGAGTAGG + Intronic
979514129 4:121587432-121587454 GCCTGCAGAGAGTGAGGGCCAGG - Intergenic
980347699 4:131643831-131643853 GACTGAACACACTGAGGAACTGG - Intergenic
980869373 4:138593602-138593624 GCCATCAGGCAGTGAGGAGCTGG - Intergenic
980980591 4:139651468-139651490 TCCTGAAGACAGAGAGGAGCAGG - Intergenic
982106813 4:152018385-152018407 GCCTGAAGGCACCCAGGAGCAGG - Intergenic
984183658 4:176515534-176515556 GCCTCAAGAGATTTAGGAGCGGG - Intergenic
985172742 4:187169685-187169707 GTCTGAAGGCAGTGTGGAGATGG + Intergenic
985605110 5:854102-854124 CACGGAGGACAGTGAGGAGCGGG + Intronic
985605275 5:854779-854801 CACGGAGGACAGTGAGGAGCGGG + Intronic
985946258 5:3186353-3186375 ACCTGGAGACAGGGAGGCGCCGG - Intergenic
987229031 5:15873164-15873186 GCCTTAAGTCATTCAGGAGCAGG - Intronic
988721292 5:33881643-33881665 GCTTGAACCCAGTGAGGAGGAGG - Intronic
990258552 5:53996856-53996878 GCCTGAAGGCAGAAGGGAGCAGG + Intronic
990347709 5:54885774-54885796 GGCTGAGGACAGTGATCAGCTGG - Intergenic
991416430 5:66397512-66397534 GGCTGAAGAGATTGTGGAGCAGG + Intergenic
992089927 5:73307679-73307701 GCCTGGAGACAGTGAGCCACTGG - Intergenic
995500748 5:112804296-112804318 GCTGGCATACAGTGAGGAGCAGG - Intronic
997365381 5:133322155-133322177 GCCTGAAGACAGGAAGGGGGTGG - Intronic
998262357 5:140641193-140641215 ACCTGAAGAGAGTGGGAAGCTGG + Intronic
999087619 5:148906942-148906964 CCCTGAAGGAAATGAGGAGCAGG + Intergenic
999273755 5:150314560-150314582 CCCTGAGGACACTGTGGAGCAGG - Intronic
999735391 5:154509235-154509257 GCCTGAAGGCAGAGTGGGGCAGG + Intergenic
1000330524 5:160201679-160201701 TCCTGAAGAAAGAGAGGAGGGGG - Intronic
1000482896 5:161801958-161801980 TCCTGAAAACAGTGTGGAGCAGG - Intergenic
1000861132 5:166457534-166457556 GCCTGAAGAAAGTGAAGTGAGGG + Intergenic
1000952098 5:167497223-167497245 GAGGGAAGAAAGTGAGGAGCAGG - Intronic
1001268130 5:170289994-170290016 GGCTGGAGACACAGAGGAGCAGG + Intronic
1001294390 5:170488941-170488963 GCCTGACTACAGTGAGGTGTGGG + Intronic
1003042617 6:2702001-2702023 GAGGGAAGCCAGTGAGGAGCGGG + Intronic
1005653249 6:27904622-27904644 GCCACAAGACAGGGACGAGCAGG + Intergenic
1006256383 6:32835758-32835780 GCCTGCAGACAGTGAGCTGTGGG + Exonic
1008019149 6:46556242-46556264 GCCTGAAGACTGCCAGAAGCAGG - Intronic
1010058111 6:71588899-71588921 GCCTGTAGACCGTGGGAAGCTGG + Intergenic
1012255019 6:97021449-97021471 GCATGAAGACAGTCAGTAGAGGG + Intronic
1012508496 6:99975988-99976010 GTATGCAGACAGTCAGGAGCAGG + Intronic
1015349075 6:132195531-132195553 TCCTGAAGGCAGGGAGGAGCTGG - Intergenic
1017006638 6:150032243-150032265 GCTTGAAGACAAGGAGGAGGAGG - Intergenic
1022096929 7:27147010-27147032 GCCTGAAGAGAGAGAGAGGCTGG - Intronic
1022286054 7:28956882-28956904 GCACGAAGACAGTGAGGAGCCGG + Exonic
1024674301 7:51624193-51624215 ACCTGATAAGAGTGAGGAGCTGG + Intergenic
1026176441 7:68001856-68001878 GCCTGACGTCTGTGAGGTGCAGG - Intergenic
1028840976 7:95429912-95429934 GCTAGAAGACTGTGGGGAGCTGG + Intronic
1030937885 7:115608501-115608523 ACCTAAAGACAGCTAGGAGCAGG - Intergenic
1032198734 7:129804644-129804666 GCCTGGAGGCAGTGGGCAGCCGG - Intergenic
1032439088 7:131928215-131928237 GCCTGAAGCCTGTGAGGAAAAGG - Intergenic
1034021336 7:147646666-147646688 GTCTGAAGCAAGGGAGGAGCAGG + Intronic
1034063765 7:148117428-148117450 GCCTGGAGGAGGTGAGGAGCCGG - Intronic
1034224386 7:149471517-149471539 GACAGAACACAGGGAGGAGCAGG - Intergenic
1037754647 8:21703037-21703059 GGGTGAAGAGTGTGAGGAGCAGG - Intronic
1038282823 8:26181321-26181343 GCCTGGAGGCAGTGATGAGTTGG - Intergenic
1039984681 8:42437263-42437285 CCCAGAGGACAGTGAGAAGCTGG - Exonic
1040871259 8:52101850-52101872 TCCTGAGAACAGTGAGGACCAGG + Intergenic
1042299991 8:67268287-67268309 GCTTGAAGACAGTAATGACCAGG + Intronic
1042576366 8:70224914-70224936 GCAGGAGGACAGGGAGGAGCGGG - Intronic
1042985223 8:74575868-74575890 GCCTGAAAACACTAAGGTGCTGG - Intergenic
1045414305 8:101951390-101951412 GAGTGAAGACAGTGAGGAGCTGG + Intronic
1046654017 8:116874090-116874112 GGCTCAAGAAAGTGCGGAGCTGG - Intronic
1046904227 8:119554948-119554970 GCCTGAATACAGTGGTGAGGTGG - Intergenic
1049042750 8:140124746-140124768 GTCTGAAGGCAGTGAGGTGGGGG + Intronic
1049242093 8:141543268-141543290 GCCTGAAGACAGTGACACGGAGG + Intergenic
1049359708 8:142206664-142206686 ACCTGCAGGCAGGGAGGAGCTGG - Intergenic
1049466684 8:142754264-142754286 GTCTGAGGACAGGAAGGAGCTGG - Intergenic
1049499442 8:142953662-142953684 GCATAAAGACAGAGAGAAGCCGG - Intergenic
1050757000 9:9016876-9016898 ACATGAAAACATTGAGGAGCAGG + Intronic
1050857831 9:10383985-10384007 ACATGAAGACAGAGAGGAGAAGG + Intronic
1051502489 9:17793152-17793174 GAATGAAGACAGTGAGGACATGG + Intronic
1052325971 9:27217057-27217079 GCCTGGAGGCAGTCAGGACCAGG + Intronic
1052995144 9:34547905-34547927 ACCTGAAGACAGGCAGGTGCAGG + Intergenic
1055830790 9:80376345-80376367 GCATGAAGCCAGTGTTGAGCAGG + Intergenic
1056107905 9:83365650-83365672 GGCTGAACACAGTGAGGTGTAGG + Intronic
1057024184 9:91723495-91723517 GTCAGAGGACAGAGAGGAGCAGG + Exonic
1057557759 9:96101150-96101172 GCCTGAAGAGAGTTCTGAGCAGG - Intergenic
1057846179 9:98526433-98526455 ACCTGAAAGCAGTGAGGGGCAGG - Intronic
1058627989 9:106955022-106955044 GCCAGAAGACAGTGGGGCTCTGG - Intronic
1059391517 9:114002318-114002340 GCGTGAGGCCAGTGGGGAGCAGG - Intronic
1060244270 9:121930960-121930982 GGCTGTACACAGTGAGGAGATGG + Intronic
1061424953 9:130493011-130493033 GCCGGAAGACAGGCAGGAGATGG - Intronic
1061907454 9:133705905-133705927 GCATGAGGACAGTGAGAAGGTGG + Intronic
1062711217 9:137976143-137976165 GCCTGAAGACAGTGAGGAGCAGG + Intronic
1187939251 X:24365094-24365116 GCCTCAAGACAGAGGGGAGCTGG - Intergenic
1189144833 X:38645007-38645029 GCAGCAAGACAGTGAGGGGCAGG - Intronic
1190337480 X:49270852-49270874 GCATGAAGCCGGTGAGGCGCAGG + Exonic
1190626419 X:52342554-52342576 ACCTGGAGGCAGTGAGGAGCAGG + Intergenic
1190701587 X:52993284-52993306 ACCTGGAGGCAGTGAGGAGCAGG - Intronic
1193652813 X:84159321-84159343 ACCTGAAGACAGGGAGGTGGAGG - Intronic
1197013341 X:121593898-121593920 GCCTGAAGACAGGCAGGTGTAGG + Intergenic
1198147088 X:133868256-133868278 GCATGCAGACAGGCAGGAGCAGG - Intronic
1199002321 X:142653758-142653780 GCCAGAAGAGAGTGAGTAACAGG + Intergenic
1199070924 X:143474606-143474628 GCTTGATGAGAGTGAGGAGTGGG - Intergenic
1199745963 X:150772124-150772146 GGCTGAAAACACTGAGAAGCTGG - Intronic