ID: 1062713258

View in Genome Browser
Species Human (GRCh38)
Location 9:137988214-137988236
Sequence CCCGTAGGGTCCTGAATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062713250_1062713258 14 Left 1062713250 9:137988177-137988199 CCAGCCACACGACGGGGAGGTCA 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1062713258 9:137988214-137988236 CCCGTAGGGTCCTGAATGTCAGG No data
1062713251_1062713258 10 Left 1062713251 9:137988181-137988203 CCACACGACGGGGAGGTCACAGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1062713258 9:137988214-137988236 CCCGTAGGGTCCTGAATGTCAGG No data
1062713249_1062713258 15 Left 1062713249 9:137988176-137988198 CCCAGCCACACGACGGGGAGGTC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1062713258 9:137988214-137988236 CCCGTAGGGTCCTGAATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062713258 Original CRISPR CCCGTAGGGTCCTGAATGTC AGG Intronic
No off target data available for this crispr