ID: 1062715933

View in Genome Browser
Species Human (GRCh38)
Location 9:138010074-138010096
Sequence CAAGGTAGGTGGCGACAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062715922_1062715933 17 Left 1062715922 9:138010034-138010056 CCATCGCTGTGGACAACCTGGCC 0: 1
1: 2
2: 2
3: 8
4: 127
Right 1062715933 9:138010074-138010096 CAAGGTAGGTGGCGACAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 136
1062715923_1062715933 1 Left 1062715923 9:138010050-138010072 CCTGGCCAACGCCCAAGAGCTGA 0: 1
1: 0
2: 0
3: 13
4: 228
Right 1062715933 9:138010074-138010096 CAAGGTAGGTGGCGACAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 136
1062715924_1062715933 -4 Left 1062715924 9:138010055-138010077 CCAACGCCCAAGAGCTGACCAAG 0: 1
1: 0
2: 2
3: 10
4: 103
Right 1062715933 9:138010074-138010096 CAAGGTAGGTGGCGACAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 136
1062715927_1062715933 -10 Left 1062715927 9:138010061-138010083 CCCAAGAGCTGACCAAGGTAGGT 0: 1
1: 0
2: 1
3: 14
4: 102
Right 1062715933 9:138010074-138010096 CAAGGTAGGTGGCGACAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062715933 Original CRISPR CAAGGTAGGTGGCGACAGGG AGG Exonic
900463434 1:2812230-2812252 CAAGGCTGGGGGCGACAGGTGGG - Intergenic
900527251 1:3135268-3135290 CAGGGTAGGGGGCCTCAGGGAGG + Intronic
901441935 1:9283284-9283306 AAAGGAAGGGGGTGACAGGGAGG + Intergenic
901620973 1:10586988-10587010 GAAGTTAGGTGGTGACTGGGAGG + Intronic
903008595 1:20314669-20314691 CAGGGTGGGGGGAGACAGGGAGG + Intronic
906932535 1:50183715-50183737 CAAGGCAGGTGGATGCAGGGAGG - Intronic
907268848 1:53278678-53278700 CAAGTTGGGTGGGGACAGGCAGG - Intronic
907455494 1:54572699-54572721 CAAGGGAGGAAGCCACAGGGAGG + Intronic
911091208 1:94018813-94018835 CAAGGTTGGTGGGGGTAGGGAGG - Intronic
916149188 1:161769513-161769535 CACAGGAGGTGGGGACAGGGAGG + Intronic
920560532 1:206935467-206935489 GAAGGTAGGAGTTGACAGGGAGG - Exonic
921088820 1:211823436-211823458 AGTGGTAGGTGGTGACAGGGAGG - Intronic
921777627 1:219120524-219120546 AAGGGTAGGTGGAGTCAGGGAGG + Intergenic
924701107 1:246453698-246453720 CCAGGTAGGTGGCGAAACGGTGG - Intronic
1067806195 10:49395204-49395226 GGAGGCAGGTGGCGACGGGGCGG + Intronic
1069092961 10:64223875-64223897 CAGTGTTGGTGGCGACAGGCTGG - Intergenic
1070236396 10:74631876-74631898 AGAGGTAGGTGGGAACAGGGTGG - Intronic
1072627095 10:97119553-97119575 GAAGGTGGGTTGCGACGGGGCGG + Intronic
1074691040 10:116004352-116004374 CATGGTAGATGGAGACATGGAGG - Intergenic
1074815702 10:117139801-117139823 CAGGGGAGGTGGCGGCGGGGCGG - Intergenic
1075010900 10:118869376-118869398 CAAGGTAGGTGGCACAAGGTAGG - Intergenic
1076384787 10:130048284-130048306 CAAGGCAGGTGGGTCCAGGGAGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077280463 11:1742714-1742736 TAAGGTTGGTGGGGACAGGATGG + Intronic
1078436283 11:11328378-11328400 CAAGGAAAGAGGCCACAGGGAGG + Intronic
1082912118 11:58389476-58389498 AAAGGTAGGTGGCAACATGCAGG + Intergenic
1083756907 11:64796790-64796812 CGGGGTAGGTGGGGGCAGGGAGG - Exonic
1083983154 11:66191079-66191101 CACGGAAGGTGTGGACAGGGTGG + Intronic
1085031632 11:73274832-73274854 CAAGGCAGGAGGGGGCAGGGTGG - Intronic
1088812201 11:113399460-113399482 CAAAGTAGGCGGCCACATGGAGG - Exonic
1089762577 11:120739136-120739158 CAGGGCAGGTGGCTACAGGAGGG - Intronic
1090305051 11:125684126-125684148 AAAGGTATGTGGCGGCAGGTGGG + Intergenic
1095218362 12:39577498-39577520 AAAGGTAGGTGGGGCCTGGGAGG + Intronic
1096706197 12:53423980-53424002 GAAGGTAAGTGTCTACAGGGAGG + Exonic
1100185348 12:92133013-92133035 GAAGGTGTGTGGGGACAGGGCGG + Intronic
1104282385 12:127389888-127389910 CAAGGAAGGTGACGGCAGAGCGG + Intergenic
1105005445 12:132718327-132718349 CAAGGGTGGTGCAGACAGGGAGG + Intronic
1117836040 14:59807177-59807199 CATGGTGGGTGGTGACAGTGAGG + Intronic
1118315083 14:64721277-64721299 TTGGGTAGGTGGGGACAGGGGGG + Intronic
1120953108 14:90060707-90060729 CAAGGAGGCGGGCGACAGGGTGG + Intergenic
1121548301 14:94779240-94779262 CAAGGAAGGTGGTGGGAGGGAGG - Intergenic
1122902091 14:104786191-104786213 CAGAGTAGGAGGCGCCAGGGAGG - Intronic
1126534771 15:49749548-49749570 CAAGGCAGATGGCTACATGGGGG - Intergenic
1126559868 15:50031695-50031717 CAAGGAAGGTGGTGGTAGGGGGG - Intronic
1128606834 15:69042802-69042824 CAAGGTAGGTGGCTACTGGAGGG + Exonic
1130813950 15:87411002-87411024 CAAGGCAGGGGGAGAAAGGGAGG - Intergenic
1132328833 15:100996245-100996267 GAGGGTATGTGGCGCCAGGGCGG - Intronic
1132664596 16:1075863-1075885 CAGGGTAGGGGGAGAGAGGGAGG - Intergenic
1133342197 16:5044164-5044186 CAGGGTAGGTGGGGGCCGGGAGG - Exonic
1138578297 16:57922925-57922947 AAAGGTCAGTGGGGACAGGGAGG - Intronic
1140544666 16:75795622-75795644 AAAGGTAGTGGGGGACAGGGTGG - Intergenic
1142140886 16:88472206-88472228 CAGGGCAGGTGCCCACAGGGTGG + Intronic
1142279472 16:89140245-89140267 CAGGGGAGGTGGCTGCAGGGAGG - Intronic
1144831966 17:18136813-18136835 CAAGGGAGATGGTGACAGGGAGG - Intronic
1146288813 17:31593829-31593851 CAAGGCAGGTGGGGAGAGAGAGG - Intergenic
1147548147 17:41419089-41419111 CAAGAAAGGTGGGGACAGGTCGG + Intergenic
1147602523 17:41755130-41755152 CCAGGCAGCTGGAGACAGGGAGG + Exonic
1152293161 17:79452299-79452321 CAGCGGAGGTGGTGACAGGGTGG - Intronic
1153688529 18:7568409-7568431 CCGGGCAGGGGGCGACAGGGAGG - Intronic
1155826237 18:30446828-30446850 CGGGGTAGGGGGCGGCAGGGGGG - Intergenic
1157482777 18:48066188-48066210 CAAGGCTGGTGGAGCCAGGGTGG - Intronic
1159065663 18:63565412-63565434 CAAGGTAGGAGGTCACAGGACGG - Intronic
1161618029 19:5283150-5283172 CAGGGTTGGAGGGGACAGGGTGG - Intronic
1161924879 19:7293282-7293304 CAAGGTAGTTGGGTAGAGGGGGG + Intronic
1162202831 19:9033585-9033607 TAAGGTAGGGAGGGACAGGGAGG - Intergenic
1164339342 19:24372184-24372206 CAAGGTAAATGGAGGCAGGGCGG - Intergenic
1164694625 19:30234007-30234029 CCAGGTAGGTGGTGGCAGGAAGG + Intronic
1164951076 19:32337750-32337772 CAAGGGAGTTGGCCACAGAGAGG - Intergenic
1165493153 19:36136946-36136968 CAGGTTGGGTGGAGACAGGGAGG + Intergenic
1165894026 19:39130883-39130905 CGCGGGGGGTGGCGACAGGGAGG + Intronic
928160924 2:28923830-28923852 AAAGGTAGCTGGCCACAGTGAGG + Intronic
929109665 2:38396129-38396151 CAAGGTTTGTGGGGAGAGGGAGG - Intergenic
929699429 2:44149137-44149159 CAGGGTAGGTGGGGAGAGAGGGG - Intergenic
931642978 2:64397474-64397496 CAAGAGAGGTGGAGACAGAGAGG + Intergenic
932081185 2:68716454-68716476 CAAGGTAGATGGGGACACTGTGG + Intronic
932502270 2:72193677-72193699 CCAGGTAGGTGGTGACTGGTAGG + Intronic
937016495 2:118610897-118610919 CAAAGTGGGTGGGCACAGGGAGG - Intergenic
937932844 2:127219586-127219608 CTCGGGAGGTGGCGGCAGGGAGG - Intronic
938693789 2:133816232-133816254 CTAGGTGGGTGGTGACAGGCTGG - Intergenic
942428408 2:175883736-175883758 CAAGGCCGGTGGGGGCAGGGAGG + Intergenic
946143029 2:217707417-217707439 CAGGGAAAGTGGAGACAGGGTGG + Intronic
946147583 2:217742647-217742669 AAAGGCAGGTGGAGACAGGATGG - Intronic
948902908 2:240965187-240965209 CCAGGTAGGTGTCTACAGAGTGG + Intronic
1170567231 20:17614229-17614251 GAAGGCAGGTGGCGTGAGGGGGG + Intronic
1171183025 20:23104971-23104993 CAAGGGAGTTGGCGACTGTGAGG + Intergenic
1179198110 21:39184071-39184093 CCAGGTAGGTGGCGGCGCGGTGG + Intergenic
1181466805 22:23114810-23114832 CAAGGTGGGTGAGGACAGGCAGG - Intronic
1181627321 22:24130702-24130724 CCAGATAGGTGCTGACAGGGAGG - Intronic
1183720252 22:39558061-39558083 CAAGGTAGGTGGGGGCTGGGTGG + Intergenic
1184566643 22:45295959-45295981 CAGGGTAGGTGGGAGCAGGGGGG + Intergenic
1184798609 22:46746747-46746769 CAGGGAAGGTGGAGAGAGGGAGG + Intergenic
949965682 3:9354122-9354144 GAAGGAAGGGGGCGACAGGATGG + Intronic
950145445 3:10646614-10646636 CTGGGTGGGTGGCGCCAGGGAGG - Intronic
952165488 3:30744067-30744089 AAAGGTGGGTGGGGAGAGGGAGG + Intronic
953585687 3:44199250-44199272 AAAGGTAGGTGGCCAAAGGCAGG + Intergenic
954700093 3:52446449-52446471 GAAGGGAGCTGGGGACAGGGAGG - Intergenic
955230484 3:57094982-57095004 CATGGCAGGTGGGGAAAGGGGGG - Exonic
966435128 3:179875501-179875523 TGAGGCAGGTGGCGGCAGGGCGG + Intronic
966710349 3:182966268-182966290 CAAGGTAGGTGGTGTTGGGGAGG - Intronic
968620741 4:1602374-1602396 CCAGGAAGGTGGCGACAGGCTGG + Intergenic
968645441 4:1738262-1738284 CCAGGGAGGTGCAGACAGGGTGG + Intronic
969593316 4:8133934-8133956 CAAGGCACGTGGGGACATGGGGG + Intronic
970937911 4:21596547-21596569 AAAGGTAGATGGAGATAGGGAGG - Intronic
972321616 4:37977526-37977548 CAAGGTAGGCGGCGTCGGGCGGG + Intronic
973982360 4:56316686-56316708 AAAGGTAGGTAGCTGCAGGGTGG + Exonic
974374254 4:61056409-61056431 CAAGGTAGGTGGAGAAATGCAGG + Intergenic
983266008 4:165508636-165508658 CAAGGTAGTGGGGGGCAGGGAGG + Intergenic
985657987 5:1142062-1142084 CGGGGCAGGTGGCGTCAGGGTGG + Intergenic
994778207 5:104061946-104061968 CAAGACAGGTGGGGAGAGGGAGG - Intergenic
997225115 5:132204092-132204114 CCCGGTAGCTGGCGACAGTGAGG + Exonic
997293532 5:132754916-132754938 AAAGGTAGGTGGGCTCAGGGAGG + Intronic
999303043 5:150502803-150502825 CAAGGTTGGGGGCGGAAGGGTGG + Intronic
1000810469 5:165855305-165855327 CAAGGTAGGTGGCTGGTGGGTGG + Intergenic
1013043317 6:106458430-106458452 CAAGGTAAGTGGCAACACAGGGG - Intergenic
1017223431 6:151992648-151992670 CAAGGTGGGTGGGGAAAGGATGG + Intronic
1024295444 7:47838274-47838296 CAACGCAGGTGGCAACAGGGCGG + Intronic
1029189152 7:98759734-98759756 GAAGGTTGGTGGGGACTGGGAGG + Intergenic
1031373935 7:121001585-121001607 AAAAGTAGGTGGCGTTAGGGTGG + Intronic
1031805294 7:126300476-126300498 TAAGGTAGGTGGTGGCGGGGTGG - Intergenic
1036061102 8:5321725-5321747 TAAGGTAGCTGGTGACAGGGAGG - Intergenic
1036530032 8:9576558-9576580 AAAAGTAGGTGGCAACAGGGAGG - Intronic
1037622508 8:20577178-20577200 CTAGGTAGGGGGTGACGGGGAGG + Intergenic
1040538833 8:48333220-48333242 CAAGGCAAGTGGAGGCAGGGTGG + Intergenic
1040597448 8:48853050-48853072 CAAGGTCAGTTGCTACAGGGAGG + Intergenic
1041706109 8:60847952-60847974 AAAGGAAGATGGTGACAGGGTGG - Intronic
1041724383 8:61004659-61004681 ACAGGAAGCTGGCGACAGGGTGG + Intergenic
1044549745 8:93498463-93498485 CAAGGTTGGTGGAGGCAGGTGGG - Intergenic
1048810756 8:138283922-138283944 GAAGGTAGCTTGTGACAGGGAGG + Intronic
1048810845 8:138284598-138284620 AAAGGTAGCTTGTGACAGGGAGG - Intronic
1049155271 8:141062446-141062468 CAAGGTAGGTGGGGGGATGGTGG + Intergenic
1049466267 8:142752512-142752534 CAAGTGAGGTGGCGACAGACTGG + Exonic
1049546470 8:143233988-143234010 GAAGGTGGATGGCCACAGGGAGG - Intergenic
1050352730 9:4755692-4755714 CAAGGTAGTTGGTGACAGTTTGG + Intergenic
1050662024 9:7893107-7893129 CACGGTATTTGGCAACAGGGAGG + Intergenic
1058543380 9:106035422-106035444 CAAGGTAGAGGGCAACATGGTGG - Intergenic
1058955173 9:109940161-109940183 TAAGGTAGGTGCTGACAGGGAGG + Intronic
1059200272 9:112408253-112408275 CAAGGTTTATGGAGACAGGGAGG + Intronic
1060208910 9:121698901-121698923 CAAGCTCGGAGGCGGCAGGGAGG + Intronic
1061378499 9:130240339-130240361 CAGGGTCAGTGGGGACAGGGTGG - Intergenic
1062715933 9:138010074-138010096 CAAGGTAGGTGGCGACAGGGAGG + Exonic
1185943567 X:4348763-4348785 GAAGGGAGGTGGGGACAGGTTGG - Intergenic
1186989233 X:15049750-15049772 TCAGGTAGCTGGTGACAGGGAGG + Intergenic
1189377967 X:40480590-40480612 CTAGGTAGGTGGAGGCAGAGAGG + Intergenic
1193743228 X:85243891-85243913 CAGGGTAGGGGGCCAAAGGGGGG - Intergenic
1195291395 X:103434302-103434324 CCAGGAAAGTGGAGACAGGGTGG + Intergenic
1198276229 X:135098014-135098036 AAAGGTAGGAGGCGACAGGTTGG - Intergenic
1198310283 X:135422727-135422749 AAAGGTAGGAGGCGACAGGTTGG + Intergenic
1200135169 X:153871237-153871259 GAAGGGAGGTGGGGGCAGGGGGG + Intronic