ID: 1062718581

View in Genome Browser
Species Human (GRCh38)
Location 9:138023320-138023342
Sequence GACCCCCGCGGCGGGGGACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 125}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062718573_1062718581 1 Left 1062718573 9:138023296-138023318 CCACCGGCACCGCGACAAGGACA 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1062718581 9:138023320-138023342 GACCCCCGCGGCGGGGGACCAGG 0: 1
1: 0
2: 1
3: 15
4: 125
1062718575_1062718581 -8 Left 1062718575 9:138023305-138023327 CCGCGACAAGGACAAGACCCCCG 0: 1
1: 0
2: 0
3: 0
4: 53
Right 1062718581 9:138023320-138023342 GACCCCCGCGGCGGGGGACCAGG 0: 1
1: 0
2: 1
3: 15
4: 125
1062718571_1062718581 12 Left 1062718571 9:138023285-138023307 CCGCGCAGGCACCACCGGCACCG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1062718581 9:138023320-138023342 GACCCCCGCGGCGGGGGACCAGG 0: 1
1: 0
2: 1
3: 15
4: 125
1062718570_1062718581 15 Left 1062718570 9:138023282-138023304 CCTCCGCGCAGGCACCACCGGCA 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1062718581 9:138023320-138023342 GACCCCCGCGGCGGGGGACCAGG 0: 1
1: 0
2: 1
3: 15
4: 125
1062718566_1062718581 29 Left 1062718566 9:138023268-138023290 CCGAGGGCGTCGACCCTCCGCGC 0: 1
1: 0
2: 0
3: 4
4: 32
Right 1062718581 9:138023320-138023342 GACCCCCGCGGCGGGGGACCAGG 0: 1
1: 0
2: 1
3: 15
4: 125
1062718565_1062718581 30 Left 1062718565 9:138023267-138023289 CCCGAGGGCGTCGACCCTCCGCG 0: 1
1: 0
2: 0
3: 4
4: 28
Right 1062718581 9:138023320-138023342 GACCCCCGCGGCGGGGGACCAGG 0: 1
1: 0
2: 1
3: 15
4: 125
1062718574_1062718581 -2 Left 1062718574 9:138023299-138023321 CCGGCACCGCGACAAGGACAAGA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1062718581 9:138023320-138023342 GACCCCCGCGGCGGGGGACCAGG 0: 1
1: 0
2: 1
3: 15
4: 125
1062718569_1062718581 16 Left 1062718569 9:138023281-138023303 CCCTCCGCGCAGGCACCACCGGC 0: 1
1: 0
2: 1
3: 9
4: 106
Right 1062718581 9:138023320-138023342 GACCCCCGCGGCGGGGGACCAGG 0: 1
1: 0
2: 1
3: 15
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062718581 Original CRISPR GACCCCCGCGGCGGGGGACC AGG Exonic
900096402 1:941842-941864 GACCCGAGCGGCGGGGGAAGCGG - Intronic
905741370 1:40374017-40374039 GTGCCCCTGGGCGGGGGACCGGG + Exonic
906263163 1:44407925-44407947 GCCCCGCGCGGCTGCGGACCAGG + Intronic
906961330 1:50421031-50421053 GCCGCCGACGGCGGGGGACCTGG - Exonic
914852780 1:151327279-151327301 GACCCCCGCGGAGGGGGTGCGGG + Exonic
922505037 1:226121537-226121559 GGCCCCTGCGGGGGGGGGCCTGG - Intergenic
924835111 1:247639647-247639669 GACGCCCGCGACTGGGGACTCGG + Intergenic
1062890567 10:1056762-1056784 GAACCCAGCGGCGCGGGACTGGG + Intronic
1066464213 10:35639472-35639494 GGCGGCGGCGGCGGGGGACCCGG - Exonic
1066703707 10:38156539-38156561 GGCCCCGGCAGTGGGGGACCGGG + Intergenic
1070152236 10:73811886-73811908 CAGCCCCGCGGAGGGGGAGCCGG + Intergenic
1070915944 10:80154788-80154810 GGCCCCCGCCGAGGGGCACCAGG + Exonic
1072151686 10:92689704-92689726 GACAGCCGCGGCGGGGCACCAGG + Intergenic
1073326093 10:102644561-102644583 GACCCCCGGGGCTGGGGAGTCGG + Exonic
1083958863 11:66002782-66002804 GAACCCCGCGGGCGGGGAGCGGG + Intronic
1089564512 11:119363806-119363828 GACCCCCGCGCCGAGGGCCTGGG - Intronic
1091206571 11:133825331-133825353 CACCCCCACCGCGGTGGACCTGG + Intergenic
1091404958 12:203492-203514 CACCCCCGCGGCGGACGCCCGGG - Intronic
1091549987 12:1530117-1530139 CACCCCCGCGGCGAGGCCCCCGG + Intronic
1092861631 12:12724442-12724464 GGCCCCCGCGCCGGGCGGCCGGG - Intergenic
1096533969 12:52258908-52258930 GGTGCCCGCTGCGGGGGACCGGG - Intronic
1101751732 12:107587497-107587519 GACCCTGGTGGCGGGGGAGCAGG + Intronic
1102962040 12:117099283-117099305 GGTGCCCGCGGCGGGGGCCCCGG + Exonic
1103516157 12:121509708-121509730 GACCTCCGTGGCGGGAGAGCCGG + Exonic
1103563276 12:121803678-121803700 GACCGCCGCGGCGTGCGTCCCGG - Intergenic
1103915141 12:124372275-124372297 GCCCCCCGCGGCTGAGGAGCTGG - Exonic
1103918858 12:124389255-124389277 GAGCCCGGCTGCGGGGGACACGG - Intronic
1105407091 13:20142100-20142122 GACCCCCGAGGAGGAGGAGCAGG - Exonic
1108577777 13:51804161-51804183 GACTCCCGGGGGGCGGGACCAGG - Intergenic
1112325905 13:98442698-98442720 GACCCCCGAAGCGGAGGAGCAGG + Intronic
1114526114 14:23367686-23367708 GACCCCAGCCCTGGGGGACCTGG + Intergenic
1122418583 14:101561709-101561731 GCCCCCGGCGGCGGCGGCCCAGG - Exonic
1123041318 14:105491399-105491421 GGACCCCGCGGCTGGGGCCCGGG + Exonic
1129104432 15:73296351-73296373 CATCCCCACGGCGGGGGAGCTGG - Intronic
1133022782 16:2974193-2974215 GACCCCCGGGGCTGGGGAGCAGG + Intronic
1137057089 16:35751028-35751050 GACCCCCACGGAGAGGGCCCGGG - Intergenic
1138961576 16:62035545-62035567 GACCCCCGCGGCAGGGCTGCGGG - Intronic
1141157778 16:81609368-81609390 GCCCCCCTCGGCGGGGGAGATGG + Intronic
1141665431 16:85463052-85463074 GCCCCCCGGGCCGCGGGACCCGG - Intergenic
1141828416 16:86496529-86496551 GACCCACGAGGCTGGTGACCTGG - Intergenic
1203104283 16_KI270728v1_random:1345319-1345341 GACCCCCGAGCCGGGAGAGCTGG + Intergenic
1203129231 16_KI270728v1_random:1617049-1617071 GACCCCCGAGCCGGGAGAGCTGG - Intergenic
1142799650 17:2337372-2337394 GACCCCCGTGGCGCGCGCCCGGG + Exonic
1144653312 17:17020192-17020214 GACTCCTTCGGCGGGGGGCCTGG + Intergenic
1147393125 17:40122209-40122231 GAGCTCCGGGGCGGGGGGCCGGG + Intergenic
1148246316 17:46033079-46033101 CACCCCAGCGGCGGGGCAGCAGG - Exonic
1148899696 17:50866488-50866510 GAGCCGGCCGGCGGGGGACCGGG - Intronic
1149314022 17:55421945-55421967 GAGCCCCGGGGCGGAGGAGCCGG - Exonic
1149610389 17:57954958-57954980 GCCCCCCGCGCCCGGGGCCCGGG + Intronic
1152225408 17:79090472-79090494 GAGCCCAGCGGCGGCGGAGCAGG - Intronic
1152352263 17:79790535-79790557 GGCCACCGCGGCGGGGAACCTGG - Intergenic
1152718370 17:81910823-81910845 TAGCCCCGCGGAGGAGGACCCGG + Intronic
1152759103 17:82098947-82098969 GACCCCGGCCGCGGGCGCCCCGG + Intergenic
1155199349 18:23503587-23503609 CGCGCCCGCGGCGGGGGCCCCGG - Exonic
1155519939 18:26657211-26657233 GCCCGCCGCGGCGGGCGACTAGG - Intronic
1156350442 18:36297672-36297694 GCCCCCCGCGGCCGGAGCCCGGG + Intergenic
1158893848 18:61895306-61895328 GAGCCCTGCTGCTGGGGACCGGG - Intergenic
1160631149 18:80247197-80247219 GCGCCCCGCGGAGGGGGACTGGG - Intronic
1165065484 19:33225855-33225877 GCCCCGGGCGGCGGGGGCCCGGG + Intergenic
1165349357 19:35267989-35268011 GCCGCGCGGGGCGGGGGACCGGG + Intergenic
1166100360 19:40567983-40568005 GACCCCCGCGGCGGCGGAGCAGG + Exonic
1167019086 19:46861074-46861096 GGCTCCGGCGGCGGGGGGCCGGG - Intergenic
1167463853 19:49640040-49640062 CGGCCCCGGGGCGGGGGACCTGG - Exonic
1168154520 19:54465347-54465369 GGCCCCCGCGGGGGGCGCCCGGG + Exonic
927713789 2:25340850-25340872 GGCCCCCGCGGCCCGGGCCCGGG + Intronic
927713929 2:25341173-25341195 GCCCCGCGGGGCGGGGGACCCGG - Intronic
929780142 2:44952207-44952229 GGCCCCCGGGGCAGGGGTCCGGG + Intergenic
935196626 2:100820191-100820213 GACCCGCGCGGCTGCGGCCCAGG + Exonic
937438904 2:121900666-121900688 GGGCCCAGGGGCGGGGGACCAGG + Intergenic
938727294 2:134120150-134120172 GGCTCCCGCGGCGGCGGCCCCGG + Intronic
948479334 2:238240234-238240256 GACCCCCGCGGGGGCGGCACCGG + Intronic
948870687 2:240796415-240796437 GACCTCCGTGGCCGGGGCCCTGG - Intronic
1172110327 20:32540866-32540888 GACCCCAGCTGCTGGGGACTTGG - Intronic
1172317461 20:33967298-33967320 GGCCCCAGTGGCGGGGGAGCTGG - Intergenic
1173165147 20:40682770-40682792 GCGCCCCGCTGCGGGGGAACCGG - Intergenic
1174611659 20:51802279-51802301 GGCGCCCGCGGCGGGGGAGCTGG - Exonic
1175962050 20:62642326-62642348 GGAACGCGCGGCGGGGGACCAGG - Exonic
1176103974 20:63377072-63377094 GACCACCGGGGCCGAGGACCTGG + Intronic
1176164183 20:63664303-63664325 GACCCCCGCTGCATGGGACTGGG - Intronic
1176185169 20:63774488-63774510 CACCTCCGCGGCTGGGGTCCAGG - Intronic
1176550042 21:8217066-8217088 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
1176568969 21:8400101-8400123 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
1176576883 21:8444336-8444358 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
1180599837 22:17008480-17008502 GACCACCGGGGCGGGGGACATGG + Intergenic
1181902786 22:26169680-26169702 GAGTCCCGCGGCGGGCGGCCGGG - Exonic
1184141813 22:42581962-42581984 GAAGCTCGCGGCGCGGGACCCGG - Intergenic
1184932374 22:47690810-47690832 CACCCCAGCAGCGGGGGGCCTGG + Intergenic
1185409664 22:50674948-50674970 GACTCCTTCGGCGGGGGCCCGGG + Intergenic
1203254932 22_KI270733v1_random:133392-133414 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
1203262988 22_KI270733v1_random:178471-178493 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
955170356 3:56557678-56557700 GGCCCACGAGGCGGGGAACCAGG + Intronic
962809778 3:138950186-138950208 GACCTCCGAGGCGCGGGGCCAGG - Intronic
967684822 3:192407932-192407954 GACCCCCGTGGAAGGGAACCAGG - Intronic
968066439 3:195762011-195762033 GACCCCCACGCCGGCGGCCCGGG - Intronic
968515096 4:1012392-1012414 GATCCCCGCGGCCCGGGACCGGG + Intronic
972396840 4:38664722-38664744 GACCCCGGGTGCGGGGGAGCGGG + Intronic
973888505 4:55346568-55346590 GACCACCGCGGCTCGGGACCGGG - Intronic
975666806 4:76741137-76741159 GACCCCTGCTGAGGGCGACCTGG + Exonic
981782396 4:148443774-148443796 AAAGCCCGAGGCGGGGGACCGGG + Intronic
985660823 5:1155824-1155846 GACCCCCGCGGCGGGGGGTGCGG - Intergenic
988796307 5:34656331-34656353 GACCCCCGCAGCGGGGGAGGAGG + Intronic
992106363 5:73451694-73451716 GACCCCCGCGCAGGGGCTCCTGG - Intergenic
994171539 5:96663094-96663116 GATCCGCACGGCGGGGGAGCCGG - Intronic
1000281028 5:159782201-159782223 GACCCCTGTGGCAGGGGACAGGG + Intergenic
1000305024 5:159987078-159987100 GCCCCCAGCGGCGGGGGAGCCGG + Intergenic
1002980091 6:2127684-2127706 GGCCCCCTGGGCTGGGGACCAGG - Intronic
1003065878 6:2903258-2903280 GACCCCCGAGGCGCAGGACCCGG + Exonic
1003086301 6:3063996-3064018 GACTCCCGAGGCGCAGGACCGGG - Intronic
1003552142 6:7108887-7108909 GACCACCGCCCCGGGGGGCCTGG + Intronic
1006370375 6:33640508-33640530 GGAGCCCGCGGCCGGGGACCTGG + Exonic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1006922212 6:37634341-37634363 GACCCCCGCCAGGGGAGACCAGG - Exonic
1007628348 6:43259182-43259204 GACCCCCGGGGTGGGGGACAAGG - Exonic
1010980583 6:82364978-82365000 GTCCCCGGCGGCGGGGCCCCGGG - Exonic
1018704692 6:166455305-166455327 GGCCCACGCGGCGTGGGGCCCGG - Intronic
1019551020 7:1602598-1602620 GACCCCCGCGGCCCCGCACCTGG + Intergenic
1020418053 7:7968904-7968926 GACCCCTGCTTCTGGGGACCAGG - Exonic
1024030602 7:45456694-45456716 AACCCCCGCTGCGAGGGTCCTGG - Intergenic
1029445942 7:100612831-100612853 GACCCCCGCCCAGGGGGCCCCGG - Exonic
1029445943 7:100612835-100612857 GGCCCCCTGGGCGGGGGTCCCGG + Exonic
1032461898 7:132118026-132118048 GGCCCTCGCTGTGGGGGACCAGG - Intergenic
1038808068 8:30812658-30812680 GACTCCCGCGGCGCGCGGCCGGG - Exonic
1043847338 8:85177712-85177734 GACCCACGCGGCGAGGGGCTGGG - Intronic
1045270143 8:100654608-100654630 GACCCCCACCCCAGGGGACCTGG + Intronic
1045443640 8:102239077-102239099 GAGCCCCGAGGCGGGGGAGGCGG - Exonic
1048554030 8:135457766-135457788 GCCCCCAGCGGCGGGGACCCGGG - Exonic
1049254961 8:141608842-141608864 GACCCCCGCAGCGTGAGCCCCGG - Intergenic
1049425314 8:142535515-142535537 CACCCCCGAGGCTGAGGACCTGG - Intronic
1049691994 8:143965551-143965573 GACCCCAGCGGTGGGAGATCTGG + Intronic
1049748699 8:144273668-144273690 GACCCCCGGGGAGGTGGGCCGGG - Intronic
1049828639 8:144685890-144685912 GACCGCCGCGGGGGCGGAGCCGG - Intergenic
1049989397 9:977284-977306 TCCCCCGGCGGCGGGGGCCCTGG - Exonic
1053014108 9:34652138-34652160 CACCCCCGCTGCGGGGGCCCAGG + Intronic
1056224282 9:84480260-84480282 GACAGCCGCGGCGTGGGGCCCGG - Intergenic
1060713078 9:125889931-125889953 GTCCCCCGCGCCGGCGGCCCCGG + Intronic
1061720186 9:132546603-132546625 GACCCCCGCGCTGGATGACCCGG + Intronic
1061843989 9:133376416-133376438 GACCCACGCGGGGTGGGGCCAGG + Exonic
1062461942 9:136665897-136665919 GCCCCCGGGGGCGGGGAACCTGG + Intronic
1062626042 9:137441845-137441867 GACCCCGACGGCGGCGGCCCCGG - Intergenic
1062718581 9:138023320-138023342 GACCCCCGCGGCGGGGGACCAGG + Exonic
1203471334 Un_GL000220v1:116538-116560 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic
1203479155 Un_GL000220v1:160510-160532 GTCCCCCGCGAGGGGGGCCCGGG + Intergenic